ID: 922748335

View in Genome Browser
Species Human (GRCh38)
Location 1:228059586-228059608
Sequence CTGGGGGTGGGGCTCCTACC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 386
Summary {0: 1, 1: 0, 2: 0, 3: 35, 4: 350}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922748313_922748335 23 Left 922748313 1:228059540-228059562 CCCACCTAAACGGGGCAGTACTC 0: 1
1: 0
2: 0
3: 0
4: 23
Right 922748335 1:228059586-228059608 CTGGGGGTGGGGCTCCTACCTGG 0: 1
1: 0
2: 0
3: 35
4: 350
922748323_922748335 -2 Left 922748323 1:228059565-228059587 CCCTGGGGGCGGGACTCCTCCCT 0: 1
1: 0
2: 3
3: 22
4: 210
Right 922748335 1:228059586-228059608 CTGGGGGTGGGGCTCCTACCTGG 0: 1
1: 0
2: 0
3: 35
4: 350
922748322_922748335 1 Left 922748322 1:228059562-228059584 CCTCCCTGGGGGCGGGACTCCTC 0: 1
1: 0
2: 2
3: 19
4: 165
Right 922748335 1:228059586-228059608 CTGGGGGTGGGGCTCCTACCTGG 0: 1
1: 0
2: 0
3: 35
4: 350
922748315_922748335 19 Left 922748315 1:228059544-228059566 CCTAAACGGGGCAGTACTCCTCC 0: 1
1: 0
2: 0
3: 4
4: 33
Right 922748335 1:228059586-228059608 CTGGGGGTGGGGCTCCTACCTGG 0: 1
1: 0
2: 0
3: 35
4: 350
922748314_922748335 22 Left 922748314 1:228059541-228059563 CCACCTAAACGGGGCAGTACTCC 0: 1
1: 0
2: 0
3: 4
4: 30
Right 922748335 1:228059586-228059608 CTGGGGGTGGGGCTCCTACCTGG 0: 1
1: 0
2: 0
3: 35
4: 350
922748324_922748335 -3 Left 922748324 1:228059566-228059588 CCTGGGGGCGGGACTCCTCCCTG 0: 1
1: 0
2: 3
3: 24
4: 328
Right 922748335 1:228059586-228059608 CTGGGGGTGGGGCTCCTACCTGG 0: 1
1: 0
2: 0
3: 35
4: 350

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922748335 Original CRISPR CTGGGGGTGGGGCTCCTACC TGG Exonic