ID: 922748336

View in Genome Browser
Species Human (GRCh38)
Location 1:228059587-228059609
Sequence TGGGGGTGGGGCTCCTACCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 259}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922748313_922748336 24 Left 922748313 1:228059540-228059562 CCCACCTAAACGGGGCAGTACTC 0: 1
1: 0
2: 0
3: 0
4: 23
Right 922748336 1:228059587-228059609 TGGGGGTGGGGCTCCTACCTGGG 0: 1
1: 0
2: 1
3: 34
4: 259
922748324_922748336 -2 Left 922748324 1:228059566-228059588 CCTGGGGGCGGGACTCCTCCCTG 0: 1
1: 0
2: 3
3: 24
4: 328
Right 922748336 1:228059587-228059609 TGGGGGTGGGGCTCCTACCTGGG 0: 1
1: 0
2: 1
3: 34
4: 259
922748314_922748336 23 Left 922748314 1:228059541-228059563 CCACCTAAACGGGGCAGTACTCC 0: 1
1: 0
2: 0
3: 4
4: 30
Right 922748336 1:228059587-228059609 TGGGGGTGGGGCTCCTACCTGGG 0: 1
1: 0
2: 1
3: 34
4: 259
922748323_922748336 -1 Left 922748323 1:228059565-228059587 CCCTGGGGGCGGGACTCCTCCCT 0: 1
1: 0
2: 3
3: 22
4: 210
Right 922748336 1:228059587-228059609 TGGGGGTGGGGCTCCTACCTGGG 0: 1
1: 0
2: 1
3: 34
4: 259
922748322_922748336 2 Left 922748322 1:228059562-228059584 CCTCCCTGGGGGCGGGACTCCTC 0: 1
1: 0
2: 2
3: 19
4: 165
Right 922748336 1:228059587-228059609 TGGGGGTGGGGCTCCTACCTGGG 0: 1
1: 0
2: 1
3: 34
4: 259
922748315_922748336 20 Left 922748315 1:228059544-228059566 CCTAAACGGGGCAGTACTCCTCC 0: 1
1: 0
2: 0
3: 4
4: 33
Right 922748336 1:228059587-228059609 TGGGGGTGGGGCTCCTACCTGGG 0: 1
1: 0
2: 1
3: 34
4: 259

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922748336 Original CRISPR TGGGGGTGGGGCTCCTACCT GGG Exonic