ID: 922748337

View in Genome Browser
Species Human (GRCh38)
Location 1:228059588-228059610
Sequence GGGGGTGGGGCTCCTACCTG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 381
Summary {0: 1, 1: 0, 2: 2, 3: 47, 4: 331}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922748324_922748337 -1 Left 922748324 1:228059566-228059588 CCTGGGGGCGGGACTCCTCCCTG 0: 1
1: 0
2: 3
3: 24
4: 328
Right 922748337 1:228059588-228059610 GGGGGTGGGGCTCCTACCTGGGG 0: 1
1: 0
2: 2
3: 47
4: 331
922748313_922748337 25 Left 922748313 1:228059540-228059562 CCCACCTAAACGGGGCAGTACTC 0: 1
1: 0
2: 0
3: 0
4: 23
Right 922748337 1:228059588-228059610 GGGGGTGGGGCTCCTACCTGGGG 0: 1
1: 0
2: 2
3: 47
4: 331
922748314_922748337 24 Left 922748314 1:228059541-228059563 CCACCTAAACGGGGCAGTACTCC 0: 1
1: 0
2: 0
3: 4
4: 30
Right 922748337 1:228059588-228059610 GGGGGTGGGGCTCCTACCTGGGG 0: 1
1: 0
2: 2
3: 47
4: 331
922748315_922748337 21 Left 922748315 1:228059544-228059566 CCTAAACGGGGCAGTACTCCTCC 0: 1
1: 0
2: 0
3: 4
4: 33
Right 922748337 1:228059588-228059610 GGGGGTGGGGCTCCTACCTGGGG 0: 1
1: 0
2: 2
3: 47
4: 331
922748323_922748337 0 Left 922748323 1:228059565-228059587 CCCTGGGGGCGGGACTCCTCCCT 0: 1
1: 0
2: 3
3: 22
4: 210
Right 922748337 1:228059588-228059610 GGGGGTGGGGCTCCTACCTGGGG 0: 1
1: 0
2: 2
3: 47
4: 331
922748322_922748337 3 Left 922748322 1:228059562-228059584 CCTCCCTGGGGGCGGGACTCCTC 0: 1
1: 0
2: 2
3: 19
4: 165
Right 922748337 1:228059588-228059610 GGGGGTGGGGCTCCTACCTGGGG 0: 1
1: 0
2: 2
3: 47
4: 331

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922748337 Original CRISPR GGGGGTGGGGCTCCTACCTG GGG Exonic