ID: 922748341

View in Genome Browser
Species Human (GRCh38)
Location 1:228059608-228059630
Sequence GGGGCAGAACTCCTACCTGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 104}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922748322_922748341 23 Left 922748322 1:228059562-228059584 CCTCCCTGGGGGCGGGACTCCTC 0: 1
1: 0
2: 2
3: 19
4: 165
Right 922748341 1:228059608-228059630 GGGGCAGAACTCCTACCTGAAGG 0: 1
1: 0
2: 0
3: 15
4: 104
922748334_922748341 0 Left 922748334 1:228059585-228059607 CCTGGGGGTGGGGCTCCTACCTG 0: 1
1: 0
2: 5
3: 44
4: 665
Right 922748341 1:228059608-228059630 GGGGCAGAACTCCTACCTGAAGG 0: 1
1: 0
2: 0
3: 15
4: 104
922748333_922748341 1 Left 922748333 1:228059584-228059606 CCCTGGGGGTGGGGCTCCTACCT 0: 1
1: 0
2: 6
3: 70
4: 317
Right 922748341 1:228059608-228059630 GGGGCAGAACTCCTACCTGAAGG 0: 1
1: 0
2: 0
3: 15
4: 104
922748332_922748341 4 Left 922748332 1:228059581-228059603 CCTCCCTGGGGGTGGGGCTCCTA 0: 1
1: 0
2: 0
3: 28
4: 227
Right 922748341 1:228059608-228059630 GGGGCAGAACTCCTACCTGAAGG 0: 1
1: 0
2: 0
3: 15
4: 104
922748324_922748341 19 Left 922748324 1:228059566-228059588 CCTGGGGGCGGGACTCCTCCCTG 0: 1
1: 0
2: 3
3: 24
4: 328
Right 922748341 1:228059608-228059630 GGGGCAGAACTCCTACCTGAAGG 0: 1
1: 0
2: 0
3: 15
4: 104
922748323_922748341 20 Left 922748323 1:228059565-228059587 CCCTGGGGGCGGGACTCCTCCCT 0: 1
1: 0
2: 3
3: 22
4: 210
Right 922748341 1:228059608-228059630 GGGGCAGAACTCCTACCTGAAGG 0: 1
1: 0
2: 0
3: 15
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922748341 Original CRISPR GGGGCAGAACTCCTACCTGA AGG Exonic