ID: 922748343

View in Genome Browser
Species Human (GRCh38)
Location 1:228059613-228059635
Sequence AGAACTCCTACCTGAAGGCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 163}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922748324_922748343 24 Left 922748324 1:228059566-228059588 CCTGGGGGCGGGACTCCTCCCTG 0: 1
1: 0
2: 3
3: 24
4: 328
Right 922748343 1:228059613-228059635 AGAACTCCTACCTGAAGGCAGGG 0: 1
1: 0
2: 0
3: 18
4: 163
922748339_922748343 -10 Left 922748339 1:228059600-228059622 CCTACCTGGGGGCAGAACTCCTA 0: 1
1: 0
2: 0
3: 9
4: 131
Right 922748343 1:228059613-228059635 AGAACTCCTACCTGAAGGCAGGG 0: 1
1: 0
2: 0
3: 18
4: 163
922748333_922748343 6 Left 922748333 1:228059584-228059606 CCCTGGGGGTGGGGCTCCTACCT 0: 1
1: 0
2: 6
3: 70
4: 317
Right 922748343 1:228059613-228059635 AGAACTCCTACCTGAAGGCAGGG 0: 1
1: 0
2: 0
3: 18
4: 163
922748323_922748343 25 Left 922748323 1:228059565-228059587 CCCTGGGGGCGGGACTCCTCCCT 0: 1
1: 0
2: 3
3: 22
4: 210
Right 922748343 1:228059613-228059635 AGAACTCCTACCTGAAGGCAGGG 0: 1
1: 0
2: 0
3: 18
4: 163
922748322_922748343 28 Left 922748322 1:228059562-228059584 CCTCCCTGGGGGCGGGACTCCTC 0: 1
1: 0
2: 2
3: 19
4: 165
Right 922748343 1:228059613-228059635 AGAACTCCTACCTGAAGGCAGGG 0: 1
1: 0
2: 0
3: 18
4: 163
922748334_922748343 5 Left 922748334 1:228059585-228059607 CCTGGGGGTGGGGCTCCTACCTG 0: 1
1: 0
2: 5
3: 44
4: 665
Right 922748343 1:228059613-228059635 AGAACTCCTACCTGAAGGCAGGG 0: 1
1: 0
2: 0
3: 18
4: 163
922748332_922748343 9 Left 922748332 1:228059581-228059603 CCTCCCTGGGGGTGGGGCTCCTA 0: 1
1: 0
2: 0
3: 28
4: 227
Right 922748343 1:228059613-228059635 AGAACTCCTACCTGAAGGCAGGG 0: 1
1: 0
2: 0
3: 18
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922748343 Original CRISPR AGAACTCCTACCTGAAGGCA GGG Exonic