ID: 922752468

View in Genome Browser
Species Human (GRCh38)
Location 1:228077018-228077040
Sequence GCTTCCAGGCAGAGGCTAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922752468_922752473 -7 Left 922752468 1:228077018-228077040 CCTGCTAGCCTCTGCCTGGAAGC 0: 1
1: 0
2: 1
3: 17
4: 204
Right 922752473 1:228077034-228077056 TGGAAGCTTGGAAGGTGAAAAGG 0: 1
1: 0
2: 0
3: 40
4: 395
922752468_922752474 10 Left 922752468 1:228077018-228077040 CCTGCTAGCCTCTGCCTGGAAGC 0: 1
1: 0
2: 1
3: 17
4: 204
Right 922752474 1:228077051-228077073 AAAAGGAAGCCCTGAAAGAGAGG 0: 1
1: 0
2: 4
3: 45
4: 426

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922752468 Original CRISPR GCTTCCAGGCAGAGGCTAGC AGG (reversed) Intergenic
900291267 1:1924547-1924569 GCAGCCAGGCAGGGGCTGGCGGG - Intronic
901164489 1:7208142-7208164 GCTTTCTGGCAGAAGCCAGCTGG + Intronic
901656529 1:10772872-10772894 GCTTCAAGTCAGAGGCGAGGGGG - Intronic
903193661 1:21669804-21669826 GCTTCCTGGCAGAGGCCACGCGG + Intergenic
903859743 1:26357390-26357412 GCTTCCAGGCATAGGGTGACTGG + Intergenic
904627425 1:31814870-31814892 GCCTGCAGGGAGAGGCTTGCAGG - Exonic
904993115 1:34609922-34609944 GATTCCAGGCAGAGGGCAGGGGG + Intergenic
905007458 1:34721333-34721355 GCTGGAAGGCAGAGGCTAGAGGG - Intronic
907243081 1:53091374-53091396 CCTTCCAGGCAGAGGCCCGGGGG - Intronic
907983929 1:59511831-59511853 GCTTCCTGGCAGAGGATAAGAGG - Intronic
910934970 1:92480258-92480280 ACTTCCAGGCAGAGAGTGGCTGG + Intronic
912457738 1:109808908-109808930 TGTTCCAGGCTGAGCCTAGCTGG - Intergenic
912691902 1:111810961-111810983 GGTGACAGGCAGAGGCTAGAGGG - Intronic
913615142 1:120551516-120551538 GCTTCCAGTCAGTTGCTGGCAGG - Intergenic
914575132 1:148959392-148959414 GCTTCCAGTCAGTTGCTGGCAGG + Intronic
916128237 1:161589875-161589897 GCTTTCAGGCAGAGGTTTGCAGG + Intronic
916138154 1:161671705-161671727 GCTTTCAGGCAGAGGTTTGCAGG + Intronic
916202715 1:162287258-162287280 TTTTCCAGGCATGGGCTAGCTGG + Intronic
922752468 1:228077018-228077040 GCTTCCAGGCAGAGGCTAGCAGG - Intergenic
922930124 1:229382377-229382399 GCATTCAGGCCGAGGCCAGCAGG - Intergenic
1062814444 10:489441-489463 ACTGACAGGCAGAAGCTAGCTGG + Intronic
1063150491 10:3332219-3332241 GCTTCCAGGCGGGAGCCAGCTGG - Intergenic
1063357208 10:5412606-5412628 TCTGCCTGGCAGAGGCTGGCGGG + Exonic
1065773555 10:29099653-29099675 GCATGCAGGCAGAAGCTGGCTGG + Intergenic
1067218294 10:44322091-44322113 GCTTCCAAGCAGAGAAAAGCAGG + Intergenic
1067416118 10:46104536-46104558 TCTTCTAGCCAGAGGCCAGCAGG + Intergenic
1071799601 10:89043825-89043847 GCTTACAGGGAGAGGGTAGGTGG - Intergenic
1073454864 10:103630283-103630305 GCTTCCTGGCAGAGGCTGCTGGG - Intronic
1073616768 10:105004242-105004264 GCTCCCAGGCAGAGCCTGGCTGG - Intronic
1073900506 10:108215295-108215317 GTTTCCAGGCAGTGGCAAGCAGG + Intergenic
1076250786 10:128982464-128982486 GCTTCCAGACAGAGGCTGCCAGG + Intergenic
1076359324 10:129875809-129875831 TCCTCCAGGCAGAGGCTGCCAGG - Intronic
1076462169 10:130655013-130655035 GGTTCCAGGCAGAGTCCAGTCGG + Intergenic
1076462179 10:130655044-130655066 GGTTCCAGGCAGAGTCCAGTCGG + Intergenic
1076898738 10:133326803-133326825 GCCTCCAGGCAGGGGGTGGCAGG - Intronic
1077038012 11:504498-504520 GCCTCCAGGCCGGGGCTGGCGGG + Intronic
1077081038 11:724875-724897 GCTTCAAGGGAGGGGCTACCAGG + Intronic
1078553012 11:12293350-12293372 GGTTCCAGGCAGATCCTGGCAGG + Intronic
1078606914 11:12785130-12785152 GCTCCCAGGCACAGGCCACCAGG - Intronic
1080700780 11:34642324-34642346 GCTCCCAGGGCGAGGCTGGCTGG - Intronic
1081579236 11:44340557-44340579 GATTCCAGGCTCAGCCTAGCTGG - Intergenic
1081582885 11:44364752-44364774 GCTTCCAGGCCGTGTCTGGCAGG - Intergenic
1082803697 11:57432855-57432877 GCTTCCAAGCAGAGGCTCCCAGG - Intergenic
1089008016 11:115108723-115108745 CCATTCAGCCAGAGGCTAGCAGG - Intergenic
1089774847 11:120828950-120828972 GCTGCCTGGCAGAGGCTGCCGGG - Intronic
1090193890 11:124799485-124799507 GCTCCCAGGCAGAGGCTTACCGG - Intronic
1090399969 11:126442862-126442884 GCTTCCAGGCAGAGAAAAGCTGG - Intronic
1090508041 11:127340598-127340620 GTTTCCTGCCAGAGGCTAGGAGG + Intergenic
1090976494 11:131684409-131684431 GTTTCCAGGCAGAGTGGAGCAGG - Intronic
1094642435 12:32289055-32289077 GCCTCAAGGCAGAAGCAAGCTGG + Intronic
1096513203 12:52143270-52143292 GCTTCCTGGTGGAGGCCAGCAGG - Intergenic
1096649919 12:53057382-53057404 GCTTTGAGGCAGAGGGGAGCAGG + Intronic
1098683061 12:73382392-73382414 GCATCCAGGCACAGCTTAGCTGG + Intergenic
1101709073 12:107248151-107248173 GATTCTGGGCAGAGGTTAGCTGG - Intergenic
1102797730 12:115703499-115703521 GAGTCCAGGCAGAGTTTAGCTGG + Intergenic
1104759096 12:131286469-131286491 GCTTCCTGGGAGAGGCGGGCAGG + Intergenic
1104821514 12:131680027-131680049 GCTTCCTGGGAGAGGCGGGCAGG - Intergenic
1110802194 13:79711687-79711709 TGTTCCAGGCAGAGGGAAGCAGG + Intergenic
1114707987 14:24746812-24746834 GCTTCAGGGCTGAGGCCAGCAGG + Intergenic
1114766299 14:25374419-25374441 CTTTCCAAGCAGAGGCTACCAGG - Intergenic
1117695112 14:58354027-58354049 GCTTCTAGCCAGAGACTACCAGG + Intronic
1118478762 14:66143130-66143152 GCTTTCAGGCAGAGCCTATGGGG - Intergenic
1119648010 14:76362495-76362517 GCTACCAGGATGAGGCTGGCAGG - Intronic
1120282184 14:82453826-82453848 GCTTCTACTCAGTGGCTAGCTGG - Intergenic
1121100091 14:91244587-91244609 GTTTGAAGGCAGAGCCTAGCTGG - Intronic
1121424964 14:93843834-93843856 GCTTCCAGGCAGATTCCAGGTGG + Intergenic
1122127693 14:99588011-99588033 GCTGGCAGGCACAGGCGAGCTGG - Intronic
1122913084 14:104843317-104843339 GCTTCGAGGAAGAGTCAAGCAGG + Intergenic
1202904333 14_GL000194v1_random:59780-59802 GCTGCCTGGCAGAGGCTGGATGG + Intergenic
1123428060 15:20188755-20188777 GCTTCCAGGCAGATGAAGGCAGG + Intergenic
1125756147 15:42066322-42066344 CCTACCAGCCAGAGGCCAGCAGG + Intergenic
1126398356 15:48243273-48243295 GCATTCAAGCAGAGGCTGGCAGG + Intronic
1126796119 15:52261599-52261621 GCTGCCAGGCAGAAGCTGGTGGG + Intronic
1128145093 15:65328650-65328672 GGTACCAGGCAGAGGCAAGGGGG + Exonic
1128499541 15:68218247-68218269 GCTTCCAGACACAGGCCAGAGGG + Intronic
1128544346 15:68557113-68557135 GCCTCCTGGCAGAGGCAAGTAGG - Intergenic
1128655968 15:69462339-69462361 GCTTAGAGGCCGAGGCTAGGCGG + Intergenic
1129169979 15:73801696-73801718 GATTTCAGGAAGAGGGTAGCTGG + Intergenic
1129904841 15:79179207-79179229 CCTCCCAGGCCGAGGCCAGCTGG - Intergenic
1130228165 15:82075826-82075848 GCTTCCATGCAGCAGGTAGCAGG + Intergenic
1131063042 15:89416314-89416336 GTTACCGGGCAGAGGCTATCAGG - Intergenic
1132697232 16:1207417-1207439 GCTTCCAGGCGGAGGTGAGGGGG + Exonic
1133111013 16:3548433-3548455 GCCTCCAGGCAGAGGCCATTTGG - Intronic
1135189152 16:20340854-20340876 GATTACAGGCAGAGGCCAGCAGG - Intronic
1135484874 16:22855432-22855454 GCTTCCAGGCCCTGGCTGGCTGG + Intronic
1137539896 16:49355138-49355160 GCCTGCAGGCAGAGGCCAGGTGG - Intergenic
1139950409 16:70665540-70665562 TCTGCCATGCAGAGGCCAGCAGG + Exonic
1140032789 16:71351726-71351748 GCCCCCAGGCAGAGCCAAGCCGG + Intergenic
1141732258 16:85830392-85830414 GCTTCCTGGGAGAGGCAGGCTGG - Intergenic
1141980290 16:87546065-87546087 GCATCCAGGCACAGCTTAGCTGG + Intergenic
1203117834 16_KI270728v1_random:1509484-1509506 GCTTCCAGGCAGATGAAGGCAGG - Intergenic
1143088686 17:4435568-4435590 ACTTCCAGGCAGAGGCCCCCAGG + Intronic
1143384773 17:6522489-6522511 ACATCCAGGTAGAGGTTAGCAGG + Intronic
1143775357 17:9195518-9195540 CCTTGCTGGCAGAGGCTGGCAGG + Intronic
1148214616 17:45827663-45827685 GTTTCCAGGCAGAGGCTTTCTGG - Intronic
1148744191 17:49909374-49909396 GCTTCTAGGCAGAGGGGAGCGGG + Intergenic
1149014004 17:51887298-51887320 GCCTCTAGGCTGAGGCAAGCAGG + Intronic
1149441771 17:56680124-56680146 GCTTCCTGGCATAGGGTGGCGGG - Intergenic
1152411369 17:80125162-80125184 GTTTCCAGTCAGTGGGTAGCTGG - Intergenic
1152654872 17:81514811-81514833 GCTTCCCGGCGGAGGCGGGCGGG - Intronic
1155999426 18:32368271-32368293 GTTACAAGGGAGAGGCTAGCAGG - Intronic
1156157525 18:34321148-34321170 GCTGCTTGGAAGAGGCTAGCAGG + Intergenic
1158395234 18:57074462-57074484 AGCACCAGGCAGAGGCTAGCTGG + Intergenic
1160927424 19:1553625-1553647 GCTTCCAGGAGGAGGCGAGGAGG - Intergenic
1161772944 19:6241277-6241299 ACTGCCAGGCAGAGTCCAGCTGG + Intronic
1161801888 19:6420961-6420983 TCTTCCTGGAAGAGGCTAGGAGG - Intronic
1163572500 19:18090745-18090767 GCTGCCAGGCAGAGGCCACTGGG - Intronic
1165362349 19:35344759-35344781 CCTTCCAGGCAAAGGCTGCCAGG + Intronic
1165741262 19:38206531-38206553 GGTCCCAGGAAGAGGCTAGATGG - Exonic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925305624 2:2846404-2846426 GCCTGCAGGCTGAGGCTTGCTGG + Intergenic
926104706 2:10142825-10142847 GGTTCAAGGCAGAGGTGAGCGGG - Intronic
930075138 2:47400433-47400455 GATTCCAGGCTGAGGCTGGGCGG + Intergenic
930556419 2:52901377-52901399 GCTTCTTGGCAGAGGCTATGGGG - Intergenic
931569951 2:63657845-63657867 CCTGCCAAGCAGAGGCCAGCTGG - Intronic
933844191 2:86312132-86312154 GCTTTCAGGCAGGGGTGAGCTGG - Intronic
934188620 2:89766209-89766231 GCTCCCAGGCCGAGGGCAGCCGG + Intergenic
934307976 2:91841744-91841766 GCTCCCAGGCCGAGGGCAGCAGG - Intergenic
934522311 2:95026955-95026977 GCTTGCGGGCAGAGGCTAAGAGG + Intronic
934580707 2:95435387-95435409 TCCTCCAGGCAGAGGCGAGTGGG - Intergenic
934598744 2:95641330-95641352 TCCTCCAGGCAGAGGCGAGTGGG + Intergenic
935660954 2:105466432-105466454 GCTTCCAGCCACAGCCCAGCTGG - Intergenic
938984117 2:136556677-136556699 GCTTCCAGAGAGAGGGAAGCAGG + Intergenic
940739493 2:157490854-157490876 GCTTCAAGACAGAGGGTACCAGG - Intergenic
944117442 2:196204617-196204639 GCATCCAGGCACAGCTTAGCTGG - Intronic
947795000 2:232889079-232889101 GCTGCCAGGCAGAGGCGGGCAGG - Intronic
948212829 2:236207708-236207730 ACTGCCAGGAAGAGGGTAGCAGG - Intronic
948928770 2:241117005-241117027 CCCTCCAGGCAGAGGGCAGCGGG + Intronic
1169358712 20:4929331-4929353 GCTTCCAGGCTCAGCCCAGCAGG - Intronic
1171032563 20:21690829-21690851 GCTGACAGGCAGTGGATAGCAGG + Intergenic
1173922587 20:46757430-46757452 GCCTGCAGGCAGCAGCTAGCTGG + Intergenic
1176145722 20:63564578-63564600 ACGTCCTGGCAGAGGCTGGCCGG + Exonic
1177828674 21:26112184-26112206 GCTCCAAGGCAGAGGCTTGGAGG + Intronic
1178602031 21:34002833-34002855 CCTTCCAGGCAGTGGCTTTCAGG - Intergenic
1179309761 21:40185268-40185290 GACTCCAGGCAGAGGGCAGCTGG + Intronic
1179959565 21:44760515-44760537 GACTCCAGGCAGAGCCTGGCAGG + Intergenic
1179990317 21:44944824-44944846 GTGTCCAGCCAGAGGCTACCAGG - Intronic
1180535058 22:16388827-16388849 GCTCCCAGGCCGAGGGCAGCAGG - Intergenic
1180844261 22:18972857-18972879 ACTTCCAGGCTGAGGCTGGGCGG + Intergenic
1181057210 22:20265854-20265876 ACTTCCAGGCTGAGGCTGGGCGG - Intronic
1183716631 22:39537006-39537028 GCATCCAGGCAGAGGCCAAGTGG + Intergenic
1184330498 22:43824154-43824176 GCTCCCAGGCAGAGACTGGGAGG + Intergenic
1185130407 22:49035589-49035611 GCTTCCTGGGTGAGGCTTGCTGG + Intergenic
949399502 3:3651284-3651306 GCTTCCAGCTCGAGGCCAGCTGG + Intergenic
953972034 3:47355485-47355507 AATTCCAGGCAGAGGAAAGCAGG + Intergenic
954711541 3:52507461-52507483 CATTCCAGGCAGAGGAGAGCAGG - Intronic
955162589 3:56479186-56479208 GGATCCAAGCAGAGGCTAGCTGG - Intergenic
957565217 3:81876851-81876873 GAGTCCAGGCACAGGTTAGCTGG + Intergenic
961675587 3:128563666-128563688 GTTTCCAGGCAGTGGGGAGCAGG - Intergenic
968845779 4:3040939-3040961 GCACCCAGGGAGAGGCCAGCGGG + Intergenic
968912027 4:3481270-3481292 GCTTGGAGGAAGAGGCTGGCAGG + Intronic
969686913 4:8680730-8680752 GCTTGCAGGCAGAAGCTAGAGGG + Intergenic
970570117 4:17371867-17371889 TGTTCCAGGCAGAGGGAAGCTGG - Intergenic
971193395 4:24448661-24448683 TGTTCCAGGCAGAGGCCAGGTGG - Intergenic
972737583 4:41859279-41859301 GCCTCCAGCCAGAAGCCAGCAGG - Intergenic
976444471 4:85114761-85114783 GCTTCCTGCCAGAGGCTGCCGGG - Intergenic
976462893 4:85333452-85333474 ATTTCCAGGCAGAGGTGAGCAGG - Intergenic
976562126 4:86513863-86513885 GCTTTCAGGCTAAGGCTACCTGG - Intronic
978239026 4:106493313-106493335 GCTTCCATGTAAAGGCCAGCTGG + Intergenic
979381462 4:120011555-120011577 GCAGCCAGCCAGAGGCCAGCAGG - Intergenic
979665280 4:123304336-123304358 GCTTCAAGGAGGAGGCTACCTGG - Intronic
979903769 4:126257513-126257535 GTTTCCATGCAGACACTAGCTGG - Intergenic
982074961 4:151730054-151730076 GTTTCCAGGCAGAGGGCAGGTGG - Intronic
984950691 4:185005354-185005376 GCTTCTAAGGAGAGGCTGGCTGG - Intergenic
996396018 5:123014875-123014897 GGTTTCAGGCAGAGACTGGCAGG - Intronic
996920150 5:128758715-128758737 GCTTTCAGGCAGAGACTATGGGG - Intronic
997951099 5:138243116-138243138 GATTACAGGCAGACGCTACCAGG - Intergenic
999763587 5:154721583-154721605 GCTTCCCTGCAGTGGCTGGCAGG - Intronic
1000997908 5:167977503-167977525 GCTTTCAGGGAGAGCCTAGTGGG - Intronic
1001219007 5:169883333-169883355 GCTTCCAAGCATATGCTAACAGG + Exonic
1001638460 5:173229183-173229205 GGTTCCCGGCAAAGGCGAGCCGG - Intergenic
1001727518 5:173918590-173918612 GTTTCCATTCAGAGGCTAGAGGG - Intronic
1005981977 6:30843704-30843726 GATTCTAGGCACAGGCTAGTTGG + Intergenic
1006287468 6:33107534-33107556 GGTCCCAGGCAGAAGCTAGGTGG + Intergenic
1007155938 6:39743777-39743799 GCTTCCAGGAAAAGGGTAGCTGG - Intergenic
1007315804 6:40987916-40987938 GGGTCCAGGCACAGCCTAGCTGG + Intergenic
1011669999 6:89674344-89674366 CCTTCCAGGCAGGGGCCAGGAGG + Exonic
1014709107 6:124785689-124785711 GCTATCAGTCAGAGGCTAGTGGG - Intronic
1016071656 6:139746754-139746776 TTTTCCAGGCAGATGGTAGCGGG + Intergenic
1018686165 6:166306859-166306881 GCCTCCAGGCAGAGGGTCTCTGG + Exonic
1019289101 7:241267-241289 GCTCCCGGGCAGAGGGCAGCAGG - Intronic
1019496205 7:1341688-1341710 GGATCCAGGCAGGGGCAAGCAGG + Intergenic
1020170062 7:5838153-5838175 GATTACAGGCATAGGCCAGCTGG - Intergenic
1022519256 7:30995289-30995311 GTCTTCAGGCAGAGGCTAGAGGG - Intergenic
1022520089 7:31000556-31000578 CCTTCCAGGCTGGGGGTAGCAGG + Intergenic
1027151009 7:75733640-75733662 GCTTCCTGGAGGAGGCTGGCAGG + Intronic
1027551592 7:79604190-79604212 GCCTCCAGGCAGAGGCCAACAGG - Intergenic
1031552999 7:123137729-123137751 GACTCCAGGCAAAGGTTAGCTGG - Intronic
1032408569 7:131675687-131675709 GATTACAGGCACATGCTAGCAGG + Intergenic
1033493085 7:141863539-141863561 TCCTCCAGCCAGAGGCTAACGGG - Intergenic
1034544283 7:151779660-151779682 GCTCCTAGTCAGAGGCAAGCAGG - Intronic
1036079132 8:5534133-5534155 GCTAACAGGAAGAGGCTACCTGG - Intergenic
1036696817 8:10980200-10980222 CCTTCCAGGCAGAGGCAGGAAGG + Intronic
1036808226 8:11849499-11849521 GTTTCCAGGCAGAGGTTCACGGG - Intronic
1036822316 8:11950830-11950852 GTTTCCAGGCAGAGTCTCCCGGG - Intergenic
1037752342 8:21690998-21691020 CCTTCCATGCAGAGGCTGGAAGG + Exonic
1039984576 8:42436724-42436746 GCTTCCAGGGAAGGGCTGGCCGG - Intronic
1041548524 8:59074942-59074964 GCTTACAGGAACAGACTAGCAGG - Intronic
1042325979 8:67528328-67528350 GCTTCCATGCAGAGGCTGGTTGG + Intronic
1043547754 8:81334432-81334454 GATTACAGGCACATGCTAGCTGG + Intergenic
1049391481 8:142373782-142373804 CACTCCAGGCAGAGGCAAGCAGG + Intronic
1049422432 8:142522895-142522917 GCTGCCAGGGAGAAGCTGGCTGG - Intronic
1050940501 9:11451802-11451824 GCATCCAGCCAGTGGCTAGAAGG + Intergenic
1054770492 9:69078811-69078833 GCATCCAGGCAGAGGCTGAGTGG - Intronic
1054864952 9:69990301-69990323 GGCTCCAGGCAGAGGCAGGCAGG + Intergenic
1055482843 9:76726875-76726897 CCTTCCAGGCAGAGAATACCTGG + Intronic
1061075645 9:128340186-128340208 GGTTTCAGGCAGAGGTGAGCGGG - Intergenic
1061523794 9:131140320-131140342 GCTTCTAGGCAGGGCCCAGCAGG + Intronic
1061623272 9:131825171-131825193 GGTTCCAGGGAGGGGCTGGCGGG + Intergenic
1062048028 9:134433357-134433379 GGGTCCAGGCACAGGCTTGCAGG + Intronic
1062080112 9:134619271-134619293 AGTTCCAGGCAGAGGCTCGGGGG + Intergenic
1062206786 9:135341908-135341930 GCTTCGAGGCTGAGGAAAGCAGG - Intergenic
1062353403 9:136150048-136150070 GCTTCCAGGGTGAGGGTGGCCGG - Intergenic
1062355877 9:136162091-136162113 GCCTCCAGGCAGAGGCTGCTGGG - Intergenic
1203563219 Un_KI270744v1:74505-74527 GCTGCCTGGCAGAGGCTGGATGG - Intergenic
1185930986 X:4203216-4203238 GGTTCCAGGGAGAGGCTAGCAGG + Intergenic
1190780481 X:53589802-53589824 GCTTCCAGGAAGTTGCTTGCCGG - Exonic
1194244920 X:91499623-91499645 GCTTCCTGGCTGTGTCTAGCTGG - Intergenic
1197725391 X:129773047-129773069 GCCTCTGGGCAAAGGCTAGCTGG - Intergenic
1199636236 X:149814734-149814756 GCTTCTGGGCAGAGACTATCGGG - Intergenic
1199692340 X:150318144-150318166 GCTTCCAAGCAGAGGCATGATGG - Intergenic
1200111179 X:153741678-153741700 GCTCCCAGGCTGAGGGCAGCAGG - Intronic
1200563896 Y:4740933-4740955 GCTTCCTGGCTGTGTCTAGCTGG - Intergenic