ID: 922752980

View in Genome Browser
Species Human (GRCh38)
Location 1:228079593-228079615
Sequence CAACCATGTTGGAGACAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922752973_922752980 13 Left 922752973 1:228079557-228079579 CCACCTAGAGTCTCCCAACAGAG No data
Right 922752980 1:228079593-228079615 CAACCATGTTGGAGACAGAGTGG No data
922752978_922752980 -1 Left 922752978 1:228079571-228079593 CCAACAGAGAGAGCGGGCAGAGC No data
Right 922752980 1:228079593-228079615 CAACCATGTTGGAGACAGAGTGG No data
922752971_922752980 24 Left 922752971 1:228079546-228079568 CCAGCTTTAGCCCACCTAGAGTC No data
Right 922752980 1:228079593-228079615 CAACCATGTTGGAGACAGAGTGG No data
922752974_922752980 10 Left 922752974 1:228079560-228079582 CCTAGAGTCTCCCAACAGAGAGA No data
Right 922752980 1:228079593-228079615 CAACCATGTTGGAGACAGAGTGG No data
922752972_922752980 14 Left 922752972 1:228079556-228079578 CCCACCTAGAGTCTCCCAACAGA No data
Right 922752980 1:228079593-228079615 CAACCATGTTGGAGACAGAGTGG No data
922752977_922752980 0 Left 922752977 1:228079570-228079592 CCCAACAGAGAGAGCGGGCAGAG No data
Right 922752980 1:228079593-228079615 CAACCATGTTGGAGACAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922752980 Original CRISPR CAACCATGTTGGAGACAGAG TGG Intergenic
No off target data available for this crispr