ID: 922753644

View in Genome Browser
Species Human (GRCh38)
Location 1:228082547-228082569
Sequence CTAAGACCGCGGCCCGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 85}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922753637_922753644 -4 Left 922753637 1:228082528-228082550 CCCCTAGGGTGCGCGCGAGCTAA 0: 1
1: 0
2: 0
3: 0
4: 8
Right 922753644 1:228082547-228082569 CTAAGACCGCGGCCCGGGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 85
922753639_922753644 -6 Left 922753639 1:228082530-228082552 CCTAGGGTGCGCGCGAGCTAAGA 0: 1
1: 0
2: 0
3: 1
4: 12
Right 922753644 1:228082547-228082569 CTAAGACCGCGGCCCGGGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 85
922753638_922753644 -5 Left 922753638 1:228082529-228082551 CCCTAGGGTGCGCGCGAGCTAAG 0: 1
1: 0
2: 0
3: 0
4: 7
Right 922753644 1:228082547-228082569 CTAAGACCGCGGCCCGGGGCAGG 0: 1
1: 0
2: 0
3: 5
4: 85

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922753644 Original CRISPR CTAAGACCGCGGCCCGGGGC AGG Intergenic
900088966 1:911007-911029 CTGGGACCTCGGCCCTGGGCAGG + Intergenic
901381606 1:8878395-8878417 CTCACCCCGAGGCCCGGGGCGGG - Intronic
903233906 1:21937418-21937440 CAGAGCCCGCGGCCCGGGGGCGG - Intergenic
903926207 1:26832558-26832580 CACAGACAGTGGCCCGGGGCAGG - Exonic
907136183 1:52141914-52141936 CGTAGCCCGCGGCCCGCGGCCGG - Intergenic
912709284 1:111938221-111938243 CTCAGACCTCGGCCAGAGGCAGG - Intronic
912810964 1:112794171-112794193 CTCAGAAAGCTGCCCGGGGCGGG + Intergenic
915522654 1:156456929-156456951 CCAAGCCTGCGGCCCGCGGCCGG - Intergenic
920030583 1:203035243-203035265 CGGAGACCACAGCCCGGGGCAGG - Intronic
922753644 1:228082547-228082569 CTAAGACCGCGGCCCGGGGCAGG + Intergenic
923148131 1:231211776-231211798 CTAAGACCTCAGCCCTGAGCGGG + Intronic
923766892 1:236900856-236900878 CTAAGACAGAGGCCAGGGGATGG + Exonic
1073503906 10:103967275-103967297 CTAGGCTCGCGGCCCGAGGCGGG + Exonic
1075724358 10:124603932-124603954 CTAAGGCCCGGGCCTGGGGCTGG + Intronic
1076895460 10:133309186-133309208 CTACGACTGCGGGGCGGGGCCGG + Intronic
1083999564 11:66288848-66288870 CTGGGACCGCCGCCCAGGGCGGG - Intronic
1095584533 12:43835951-43835973 CAAAGTCCGCGGCCGCGGGCCGG - Intronic
1096800518 12:54107350-54107372 CTAAGACGGCGGGCCTTGGCTGG - Intergenic
1103905435 12:124325204-124325226 CTAAGACTCCCGCCCCGGGCTGG - Exonic
1105031413 12:132887165-132887187 CTGAGGCCGGGGCCGGGGGCCGG - Intronic
1122807577 14:104267922-104267944 CTGTGACCGCGGCCGGGTGCTGG + Intergenic
1128763525 15:70236179-70236201 CCAAGACCGGGGCCCTGGGGAGG - Intergenic
1132370684 15:101295607-101295629 CCAAGGCCCAGGCCCGGGGCGGG - Intergenic
1141869368 16:86774155-86774177 TTCAGACCTCGGCCCTGGGCTGG - Intergenic
1147168628 17:38605791-38605813 CTGGCACCGCGCCCCGGGGCTGG - Exonic
1149459976 17:56820573-56820595 CACAGACAGTGGCCCGGGGCTGG + Intronic
1151656615 17:75499199-75499221 CTTAGACCAGGGGCCGGGGCAGG - Intronic
1160826549 19:1082922-1082944 CCAAGGCGGCGTCCCGGGGCCGG + Exonic
1160863993 19:1249298-1249320 CTAGGGCCGCGGCCCCGGGGAGG - Intronic
1160869569 19:1271049-1271071 CTGGGCCCGCGGCCCTGGGCGGG + Intronic
1160935419 19:1592427-1592449 CCCAGGCCGCGGCCCGGGGCAGG + Intronic
1161075261 19:2282217-2282239 GTCAGACCGCAGCCCGGGGTGGG + Intronic
1161453618 19:4359793-4359815 CTGAGACCGAGGCACAGGGCTGG - Intronic
1162032965 19:7925248-7925270 CTGAGACCCCGGCGCAGGGCCGG + Exonic
1162722169 19:12669069-12669091 CTGAGAACGAGGCCCGGGGGCGG - Intronic
1165480382 19:36060036-36060058 CTGAGGCCTGGGCCCGGGGCAGG + Intronic
1166358095 19:42239283-42239305 CCAAGACCGAGGCCCTGGTCTGG + Intronic
1168058891 19:53879522-53879544 CTGCGCCCGCAGCCCGGGGCGGG + Intronic
935137760 2:100322237-100322259 CTGAGACCGCGGGCGGGGGCGGG + Exonic
936396995 2:112138705-112138727 GGAAGCCCGCGGCTCGGGGCAGG - Exonic
938301057 2:130213532-130213554 CTGAGCCCGGGGACCGGGGCGGG - Intergenic
938727229 2:134119873-134119895 CTGAGCGCGCGGCCGGGGGCGGG + Intergenic
948598860 2:239096894-239096916 CCACGTCCACGGCCCGGGGCTGG + Intronic
948679795 2:239626046-239626068 CTAAAAGTGAGGCCCGGGGCGGG + Intergenic
1173843594 20:46174544-46174566 CGTAGAGCGCGGCCAGGGGCCGG + Exonic
1175829122 20:61952428-61952450 CTGAGACCCTGGCCTGGGGCAGG + Intergenic
1176147622 20:63572477-63572499 GTGAGGCCGCGGCCCCGGGCCGG - Intronic
1176178662 20:63739846-63739868 CTCAGGACGCGGCCCCGGGCCGG - Exonic
1179605806 21:42514360-42514382 CTGTCACCGCGGCCCGGGCCGGG - Exonic
1183102922 22:35594846-35594868 CTAAGCCCTTAGCCCGGGGCTGG - Intergenic
1183317007 22:37142366-37142388 CTGAGATCGCAGCCCGGAGCTGG + Intronic
1184361858 22:44023903-44023925 CCAAGAGCCAGGCCCGGGGCAGG - Intronic
1185420355 22:50731366-50731388 CCGAGCCCGCGGCCCGGGGTGGG - Intergenic
954677716 3:52324938-52324960 CTGCGTCCGCGGGCCGGGGCAGG - Intronic
961081673 3:124033448-124033470 CTGGGGCCGGGGCCCGGGGCCGG - Intergenic
968302638 3:197627960-197627982 CTTAGACCCCGGCCCGGGCGTGG - Intergenic
968550091 4:1217624-1217646 CTAAAGCCGCGGGCCGGCGCCGG + Intronic
975689690 4:76950734-76950756 CTCGGTCCGCGCCCCGGGGCCGG + Intronic
980130395 4:128811688-128811710 CAAAGCCCGCGGCGCGGGGGTGG + Intronic
983940323 4:173529709-173529731 CCAGGACCGCGGCCCGGGCTTGG - Exonic
985851479 5:2391782-2391804 CTAACTCCGCCGCCCTGGGCTGG - Intergenic
986729692 5:10626094-10626116 CTAGAACCGCAGCCAGGGGCCGG + Intronic
992550169 5:77852074-77852096 CTCCTCCCGCGGCCCGGGGCGGG - Intronic
995199321 5:109409608-109409630 ATAGGAGCGCGGCCCGGGTCCGG + Intronic
1003212310 6:4079044-4079066 CGAAGCCCGCGGGCCGGCGCAGG + Exonic
1004203896 6:13574318-13574340 CGGAGACCCCGGCCCGGCGCAGG - Intergenic
1018740054 6:166721657-166721679 CTAAGACCGAGTCTCGGGGACGG + Intronic
1023822620 7:43988443-43988465 CTAAGAGAGGGGCCAGGGGCTGG - Intergenic
1025952059 7:66153058-66153080 CTGAGACAGCAGCCCAGGGCAGG + Exonic
1029750883 7:102541858-102541880 CTAAGAGAGGGGCCAGGGGCTGG - Intronic
1029768837 7:102640969-102640991 CTAAGAGAGGGGCCAGGGGCTGG - Intronic
1035169687 7:157010542-157010564 GTGCGAGCGCGGCCCGGGGCGGG - Exonic
1042246430 8:66712873-66712895 CTCCGACGGCGGCCCGGGGCGGG + Intronic
1051894611 9:21974756-21974778 CCACGGCCGCGGCCCGGGGTCGG - Exonic
1053790085 9:41680433-41680455 CTAAGACGGCGGGCCTTGGCTGG - Intergenic
1054155055 9:61634324-61634346 CTAAGACGGCGGGCCTTGGCTGG + Intergenic
1054178425 9:61892122-61892144 CTAAGACGGCGGGCCTTGGCTGG - Intergenic
1054460554 9:65460002-65460024 CTCTGACTGCGTCCCGGGGCTGG + Intergenic
1054474844 9:65565432-65565454 CTAAGACGGCGGGCCTTGGCTGG + Intergenic
1054659104 9:67688702-67688724 CTAAGACGGCGGGCCTTGGCTGG + Intergenic
1055454369 9:76459219-76459241 CCTAGAGCGCGGCGCGGGGCGGG + Intronic
1056170633 9:83980958-83980980 CACAGACCACAGCCCGGGGCGGG - Exonic
1056536577 9:87533370-87533392 CTCAGACCGCATCCAGGGGCAGG + Intronic
1057572957 9:96218227-96218249 CTAAGAACGCGGAGCAGGGCTGG + Intergenic
1061842910 9:133370079-133370101 CTTAGACCGCAGCCCATGGCTGG - Intronic
1062013797 9:134281123-134281145 CTAAGACAGGGGTCCGGGTCCGG + Intergenic
1062562537 9:137147999-137148021 CAAACACCGAGGCCCGGGGCGGG - Intronic
1195138118 X:101931558-101931580 CTAATACGGCGGGGCGGGGCGGG + Intronic
1198276272 X:135098201-135098223 CTGAGACCGCGGCCAGGGCCAGG + Intergenic
1198310234 X:135422539-135422561 CTGAGACCGCAGCCGGGGCCAGG - Intergenic
1199772643 X:150984155-150984177 CGGCGCCCGCGGCCCGGGGCGGG + Intronic