ID: 922753786

View in Genome Browser
Species Human (GRCh38)
Location 1:228083032-228083054
Sequence GCGGGGGCAGGGACAGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1393
Summary {0: 1, 1: 0, 2: 14, 3: 130, 4: 1248}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922753786_922753806 29 Left 922753786 1:228083032-228083054 CCTCTGCCTGTCCCTGCCCCCGC 0: 1
1: 0
2: 14
3: 130
4: 1248
Right 922753806 1:228083084-228083106 GGCTCTTCTCCAGGAAACCTGGG 0: 1
1: 0
2: 0
3: 20
4: 205
922753786_922753801 8 Left 922753786 1:228083032-228083054 CCTCTGCCTGTCCCTGCCCCCGC 0: 1
1: 0
2: 14
3: 130
4: 1248
Right 922753801 1:228083063-228083085 CGGAAGTCCGCTTGGACGCCGGG 0: 1
1: 0
2: 0
3: 0
4: 21
922753786_922753800 7 Left 922753786 1:228083032-228083054 CCTCTGCCTGTCCCTGCCCCCGC 0: 1
1: 0
2: 14
3: 130
4: 1248
Right 922753800 1:228083062-228083084 CCGGAAGTCCGCTTGGACGCCGG 0: 1
1: 0
2: 0
3: 1
4: 30
922753786_922753805 28 Left 922753786 1:228083032-228083054 CCTCTGCCTGTCCCTGCCCCCGC 0: 1
1: 0
2: 14
3: 130
4: 1248
Right 922753805 1:228083083-228083105 GGGCTCTTCTCCAGGAAACCTGG 0: 1
1: 0
2: 4
3: 25
4: 216
922753786_922753803 20 Left 922753786 1:228083032-228083054 CCTCTGCCTGTCCCTGCCCCCGC 0: 1
1: 0
2: 14
3: 130
4: 1248
Right 922753803 1:228083075-228083097 TGGACGCCGGGCTCTTCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 104
922753786_922753797 0 Left 922753786 1:228083032-228083054 CCTCTGCCTGTCCCTGCCCCCGC 0: 1
1: 0
2: 14
3: 130
4: 1248
Right 922753797 1:228083055-228083077 CCGTCGCCCGGAAGTCCGCTTGG 0: 1
1: 0
2: 1
3: 3
4: 16

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922753786 Original CRISPR GCGGGGGCAGGGACAGGCAG AGG (reversed) Intronic