ID: 922753790

View in Genome Browser
Species Human (GRCh38)
Location 1:228083044-228083066
Sequence TCCGGGCGACGGGCGGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 474
Summary {0: 1, 1: 0, 2: 4, 3: 43, 4: 426}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922753790_922753806 17 Left 922753790 1:228083044-228083066 CCTGCCCCCGCCCGTCGCCCGGA 0: 1
1: 0
2: 4
3: 43
4: 426
Right 922753806 1:228083084-228083106 GGCTCTTCTCCAGGAAACCTGGG 0: 1
1: 0
2: 0
3: 20
4: 205
922753790_922753803 8 Left 922753790 1:228083044-228083066 CCTGCCCCCGCCCGTCGCCCGGA 0: 1
1: 0
2: 4
3: 43
4: 426
Right 922753803 1:228083075-228083097 TGGACGCCGGGCTCTTCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 104
922753790_922753805 16 Left 922753790 1:228083044-228083066 CCTGCCCCCGCCCGTCGCCCGGA 0: 1
1: 0
2: 4
3: 43
4: 426
Right 922753805 1:228083083-228083105 GGGCTCTTCTCCAGGAAACCTGG 0: 1
1: 0
2: 4
3: 25
4: 216
922753790_922753800 -5 Left 922753790 1:228083044-228083066 CCTGCCCCCGCCCGTCGCCCGGA 0: 1
1: 0
2: 4
3: 43
4: 426
Right 922753800 1:228083062-228083084 CCGGAAGTCCGCTTGGACGCCGG 0: 1
1: 0
2: 0
3: 1
4: 30
922753790_922753801 -4 Left 922753790 1:228083044-228083066 CCTGCCCCCGCCCGTCGCCCGGA 0: 1
1: 0
2: 4
3: 43
4: 426
Right 922753801 1:228083063-228083085 CGGAAGTCCGCTTGGACGCCGGG 0: 1
1: 0
2: 0
3: 0
4: 21

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922753790 Original CRISPR TCCGGGCGACGGGCGGGGGC AGG (reversed) Intronic