ID: 922753792

View in Genome Browser
Species Human (GRCh38)
Location 1:228083049-228083071
Sequence GGACTTCCGGGCGACGGGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 74}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922753792_922753805 11 Left 922753792 1:228083049-228083071 CCCCGCCCGTCGCCCGGAAGTCC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 922753805 1:228083083-228083105 GGGCTCTTCTCCAGGAAACCTGG 0: 1
1: 0
2: 4
3: 25
4: 216
922753792_922753803 3 Left 922753792 1:228083049-228083071 CCCCGCCCGTCGCCCGGAAGTCC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 922753803 1:228083075-228083097 TGGACGCCGGGCTCTTCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 104
922753792_922753800 -10 Left 922753792 1:228083049-228083071 CCCCGCCCGTCGCCCGGAAGTCC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 922753800 1:228083062-228083084 CCGGAAGTCCGCTTGGACGCCGG 0: 1
1: 0
2: 0
3: 1
4: 30
922753792_922753801 -9 Left 922753792 1:228083049-228083071 CCCCGCCCGTCGCCCGGAAGTCC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 922753801 1:228083063-228083085 CGGAAGTCCGCTTGGACGCCGGG 0: 1
1: 0
2: 0
3: 0
4: 21
922753792_922753806 12 Left 922753792 1:228083049-228083071 CCCCGCCCGTCGCCCGGAAGTCC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 922753806 1:228083084-228083106 GGCTCTTCTCCAGGAAACCTGGG 0: 1
1: 0
2: 0
3: 20
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922753792 Original CRISPR GGACTTCCGGGCGACGGGCG GGG (reversed) Intronic