ID: 922753793

View in Genome Browser
Species Human (GRCh38)
Location 1:228083050-228083072
Sequence CGGACTTCCGGGCGACGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 39}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922753793_922753803 2 Left 922753793 1:228083050-228083072 CCCGCCCGTCGCCCGGAAGTCCG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 922753803 1:228083075-228083097 TGGACGCCGGGCTCTTCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 104
922753793_922753801 -10 Left 922753793 1:228083050-228083072 CCCGCCCGTCGCCCGGAAGTCCG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 922753801 1:228083063-228083085 CGGAAGTCCGCTTGGACGCCGGG 0: 1
1: 0
2: 0
3: 0
4: 21
922753793_922753805 10 Left 922753793 1:228083050-228083072 CCCGCCCGTCGCCCGGAAGTCCG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 922753805 1:228083083-228083105 GGGCTCTTCTCCAGGAAACCTGG 0: 1
1: 0
2: 4
3: 25
4: 216
922753793_922753806 11 Left 922753793 1:228083050-228083072 CCCGCCCGTCGCCCGGAAGTCCG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 922753806 1:228083084-228083106 GGCTCTTCTCCAGGAAACCTGGG 0: 1
1: 0
2: 0
3: 20
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922753793 Original CRISPR CGGACTTCCGGGCGACGGGC GGG (reversed) Intronic