ID: 922753798

View in Genome Browser
Species Human (GRCh38)
Location 1:228083061-228083083
Sequence CGGCGTCCAAGCGGACTTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 36}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922753798_922753806 0 Left 922753798 1:228083061-228083083 CCCGGAAGTCCGCTTGGACGCCG 0: 1
1: 0
2: 0
3: 1
4: 36
Right 922753806 1:228083084-228083106 GGCTCTTCTCCAGGAAACCTGGG 0: 1
1: 0
2: 0
3: 20
4: 205
922753798_922753805 -1 Left 922753798 1:228083061-228083083 CCCGGAAGTCCGCTTGGACGCCG 0: 1
1: 0
2: 0
3: 1
4: 36
Right 922753805 1:228083083-228083105 GGGCTCTTCTCCAGGAAACCTGG 0: 1
1: 0
2: 4
3: 25
4: 216
922753798_922753803 -9 Left 922753798 1:228083061-228083083 CCCGGAAGTCCGCTTGGACGCCG 0: 1
1: 0
2: 0
3: 1
4: 36
Right 922753803 1:228083075-228083097 TGGACGCCGGGCTCTTCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922753798 Original CRISPR CGGCGTCCAAGCGGACTTCC GGG (reversed) Intronic
900935853 1:5766087-5766109 AGGCGTCCATGTGGACTGCCAGG + Intergenic
918064412 1:181089577-181089599 CGGCGGCCCAGCGGGCTGCCCGG + Exonic
920380356 1:205531492-205531514 GGGCTGCCAAGCGGTCTTCCAGG - Exonic
922753798 1:228083061-228083083 CGGCGTCCAAGCGGACTTCCGGG - Intronic
1062812068 10:474484-474506 GGGGCTCCAAGAGGACTTCCAGG - Intronic
1066232986 10:33455804-33455826 CGGAGTCAAAGCCGACTCCCAGG + Intergenic
1076728902 10:132428684-132428706 AGGGCTCCAAGCGGACTTCGAGG + Intergenic
1082681681 11:56180741-56180763 CTGCCTCCAAGTAGACTTCCAGG - Intergenic
1088588386 11:111379627-111379649 CGGCGCCCATGCAGGCTTCCAGG + Exonic
1089655891 11:119946698-119946720 AGGAGTCCAGGAGGACTTCCAGG + Intergenic
1098268338 12:68746172-68746194 CGGCGTCCTAGCTGGCTTACAGG + Exonic
1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG + Intronic
1142523047 17:518546-518568 CGTCTTCCAAGTGAACTTCCTGG + Exonic
1146942215 17:36851176-36851198 CTGCGTCCAGGCTGTCTTCCGGG - Intergenic
1151605294 17:75131650-75131672 CGGCGTCCTGGCCGACTTCGAGG - Exonic
1152673813 17:81626220-81626242 CGGGGTTCAAGCGGTTTTCCTGG - Intronic
1152676523 17:81644290-81644312 CAGCCTCCAGGCGGTCTTCCTGG + Intronic
1154059791 18:11048338-11048360 CTGGGGCCAAGCGGACTGCCTGG + Intronic
1160402391 18:78620528-78620550 CTGTCTCCAAGCTGACTTCCAGG - Intergenic
1161687753 19:5711788-5711810 CGTTGTCCACGAGGACTTCCAGG - Exonic
1163507896 19:17719296-17719318 CGGCTCCCAAGCGGACACCCAGG + Intronic
1165459599 19:35936677-35936699 CGGCGTCCCGGCTGGCTTCCTGG - Intronic
934925702 2:98380533-98380555 CGGAGTCCAAGAGGCCTTGCAGG + Intronic
1181440397 22:22932597-22932619 CAGCTGCCAAGAGGACTTCCGGG + Intergenic
1182991897 22:34776233-34776255 GGGATTCCAAGAGGACTTCCTGG + Intergenic
1185146547 22:49140098-49140120 GGGCATCCAGGGGGACTTCCTGG - Intergenic
953518736 3:43621798-43621820 CGGCGACCAGGCGGAGCTCCTGG + Intronic
991198342 5:63961167-63961189 CGGGGTCCGAGCGGTCTTCCGGG + Exonic
1000793533 5:165635811-165635833 CGGAGTCAAAGCTGACCTCCTGG - Intergenic
1005522745 6:26614472-26614494 CGGCGTGGTAGCGGCCTTCCAGG + Intergenic
1026787150 7:73308835-73308857 CGGCGCCCGCCCGGACTTCCGGG + Intronic
1034497730 7:151432318-151432340 CGGAGTCCCGGGGGACTTCCTGG - Intronic
1035171245 7:157018489-157018511 AAGCGTCCACGCGGAGTTCCAGG + Intergenic
1041201431 8:55454287-55454309 CGGGGTCAATGCGGCCTTCCAGG - Intronic
1051587621 9:18743622-18743644 CAGCGTGCAGGCAGACTTCCAGG + Intronic
1060330999 9:122670196-122670218 GGGTGTCCAAGTGGATTTCCAGG - Intergenic
1062485235 9:136771206-136771228 GGGCGTCCAACAGGACTTTCCGG + Intergenic
1062592569 9:137280837-137280859 AGGCGTCCAGGAGGGCTTCCGGG - Exonic