ID: 922753798

View in Genome Browser
Species Human (GRCh38)
Location 1:228083061-228083083
Sequence CGGCGTCCAAGCGGACTTCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 38
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 36}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922753798_922753805 -1 Left 922753798 1:228083061-228083083 CCCGGAAGTCCGCTTGGACGCCG 0: 1
1: 0
2: 0
3: 1
4: 36
Right 922753805 1:228083083-228083105 GGGCTCTTCTCCAGGAAACCTGG 0: 1
1: 0
2: 4
3: 25
4: 216
922753798_922753806 0 Left 922753798 1:228083061-228083083 CCCGGAAGTCCGCTTGGACGCCG 0: 1
1: 0
2: 0
3: 1
4: 36
Right 922753806 1:228083084-228083106 GGCTCTTCTCCAGGAAACCTGGG 0: 1
1: 0
2: 0
3: 20
4: 205
922753798_922753803 -9 Left 922753798 1:228083061-228083083 CCCGGAAGTCCGCTTGGACGCCG 0: 1
1: 0
2: 0
3: 1
4: 36
Right 922753803 1:228083075-228083097 TGGACGCCGGGCTCTTCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922753798 Original CRISPR CGGCGTCCAAGCGGACTTCC GGG (reversed) Intronic