ID: 922753799

View in Genome Browser
Species Human (GRCh38)
Location 1:228083062-228083084
Sequence CCGGCGTCCAAGCGGACTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 28
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 26}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922753799_922753803 -10 Left 922753799 1:228083062-228083084 CCGGAAGTCCGCTTGGACGCCGG 0: 1
1: 0
2: 0
3: 1
4: 26
Right 922753803 1:228083075-228083097 TGGACGCCGGGCTCTTCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 104
922753799_922753806 -1 Left 922753799 1:228083062-228083084 CCGGAAGTCCGCTTGGACGCCGG 0: 1
1: 0
2: 0
3: 1
4: 26
Right 922753806 1:228083084-228083106 GGCTCTTCTCCAGGAAACCTGGG 0: 1
1: 0
2: 0
3: 20
4: 205
922753799_922753805 -2 Left 922753799 1:228083062-228083084 CCGGAAGTCCGCTTGGACGCCGG 0: 1
1: 0
2: 0
3: 1
4: 26
Right 922753805 1:228083083-228083105 GGGCTCTTCTCCAGGAAACCTGG 0: 1
1: 0
2: 4
3: 25
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922753799 Original CRISPR CCGGCGTCCAAGCGGACTTC CGG (reversed) Intronic