ID: 922753803

View in Genome Browser
Species Human (GRCh38)
Location 1:228083075-228083097
Sequence TGGACGCCGGGCTCTTCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 104}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922753791_922753803 4 Left 922753791 1:228083048-228083070 CCCCCGCCCGTCGCCCGGAAGTC 0: 1
1: 0
2: 0
3: 7
4: 77
Right 922753803 1:228083075-228083097 TGGACGCCGGGCTCTTCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 104
922753793_922753803 2 Left 922753793 1:228083050-228083072 CCCGCCCGTCGCCCGGAAGTCCG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 922753803 1:228083075-228083097 TGGACGCCGGGCTCTTCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 104
922753790_922753803 8 Left 922753790 1:228083044-228083066 CCTGCCCCCGCCCGTCGCCCGGA 0: 1
1: 0
2: 4
3: 43
4: 426
Right 922753803 1:228083075-228083097 TGGACGCCGGGCTCTTCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 104
922753788_922753803 9 Left 922753788 1:228083043-228083065 CCCTGCCCCCGCCCGTCGCCCGG 0: 1
1: 0
2: 5
3: 40
4: 434
Right 922753803 1:228083075-228083097 TGGACGCCGGGCTCTTCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 104
922753799_922753803 -10 Left 922753799 1:228083062-228083084 CCGGAAGTCCGCTTGGACGCCGG 0: 1
1: 0
2: 0
3: 1
4: 26
Right 922753803 1:228083075-228083097 TGGACGCCGGGCTCTTCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 104
922753796_922753803 -3 Left 922753796 1:228083055-228083077 CCGTCGCCCGGAAGTCCGCTTGG 0: 1
1: 0
2: 0
3: 2
4: 38
Right 922753803 1:228083075-228083097 TGGACGCCGGGCTCTTCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 104
922753794_922753803 1 Left 922753794 1:228083051-228083073 CCGCCCGTCGCCCGGAAGTCCGC 0: 1
1: 0
2: 0
3: 1
4: 44
Right 922753803 1:228083075-228083097 TGGACGCCGGGCTCTTCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 104
922753792_922753803 3 Left 922753792 1:228083049-228083071 CCCCGCCCGTCGCCCGGAAGTCC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 922753803 1:228083075-228083097 TGGACGCCGGGCTCTTCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 104
922753795_922753803 -2 Left 922753795 1:228083054-228083076 CCCGTCGCCCGGAAGTCCGCTTG 0: 1
1: 0
2: 0
3: 2
4: 20
Right 922753803 1:228083075-228083097 TGGACGCCGGGCTCTTCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 104
922753798_922753803 -9 Left 922753798 1:228083061-228083083 CCCGGAAGTCCGCTTGGACGCCG 0: 1
1: 0
2: 0
3: 1
4: 36
Right 922753803 1:228083075-228083097 TGGACGCCGGGCTCTTCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 104
922753786_922753803 20 Left 922753786 1:228083032-228083054 CCTCTGCCTGTCCCTGCCCCCGC 0: 1
1: 0
2: 14
3: 130
4: 1248
Right 922753803 1:228083075-228083097 TGGACGCCGGGCTCTTCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 104
922753785_922753803 23 Left 922753785 1:228083029-228083051 CCTCCTCTGCCTGTCCCTGCCCC 0: 1
1: 2
2: 13
3: 209
4: 1883
Right 922753803 1:228083075-228083097 TGGACGCCGGGCTCTTCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 104
922753787_922753803 14 Left 922753787 1:228083038-228083060 CCTGTCCCTGCCCCCGCCCGTCG 0: 1
1: 0
2: 0
3: 61
4: 571
Right 922753803 1:228083075-228083097 TGGACGCCGGGCTCTTCTCCAGG 0: 1
1: 0
2: 0
3: 5
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922753803 Original CRISPR TGGACGCCGGGCTCTTCTCC AGG Intronic
900539858 1:3197242-3197264 GGGACCCTGGGCTCTTGTCCTGG - Intronic
901665893 1:10825975-10825997 TGGCTGCCGGGCCCTTCTCAAGG - Intergenic
902414646 1:16231616-16231638 TGGGCGTGGGGCTCTGCTCCAGG - Intergenic
903712858 1:25338636-25338658 TGGACGCCGTCGCCTTCTCCTGG - Intronic
904129075 1:28262204-28262226 TGCACGCCTGGGTCTTCTCTTGG - Intronic
904263542 1:29304856-29304878 TGGACCCCAGGCCCTTCCCCAGG - Intronic
918909304 1:190545038-190545060 TGGACTCCAGCCTCTTCTACTGG + Intergenic
920581552 1:207113075-207113097 TGGCAGCCTGGCCCTTCTCCAGG + Exonic
922753803 1:228083075-228083097 TGGACGCCGGGCTCTTCTCCAGG + Intronic
1064507387 10:16047900-16047922 TAGAGCCCAGGCTCTTCTCCAGG - Intergenic
1067777429 10:49173702-49173724 CGGAAGCTGGACTCTTCTCCTGG + Intronic
1070611305 10:77934718-77934740 TAGCCGCTGGGATCTTCTCCAGG - Intergenic
1073254028 10:102139618-102139640 TGGACCCCGGCCTGTGCTCCTGG + Exonic
1078845522 11:15115640-15115662 TGGCCTCCTGTCTCTTCTCCTGG - Intronic
1083713768 11:64564256-64564278 TGCACGCTGGGCTCTCCCCCGGG - Intronic
1085566562 11:77519973-77519995 TGGAAGCCAGGCTCCTCCCCTGG + Intronic
1089294167 11:117458110-117458132 TGGAAGCCTGGTCCTTCTCCTGG + Intronic
1091147350 11:133291362-133291384 TGGACGCAGGGCTCATCTCTCGG - Intronic
1091396789 12:158031-158053 TGGACCCAGGGCCCTGCTCCTGG - Intronic
1098819319 12:75208585-75208607 TGGAATCCGGGCTCTTCACAGGG - Intronic
1100819585 12:98418906-98418928 TGGACACCGGGCGCCTTTCCAGG + Intergenic
1106839987 13:33676782-33676804 AGGAGGCTGGGCTCTTCTCGGGG - Intergenic
1107637529 13:42407556-42407578 TGGTCTCCTGGCTCTTTTCCTGG - Intergenic
1113890536 13:113732991-113733013 TGAACCCCAGGCGCTTCTCCGGG - Exonic
1119322497 14:73740080-73740102 TGGAAGCCGGGCTCTAGTCCAGG + Exonic
1120788367 14:88557190-88557212 TAGACACCCAGCTCTTCTCCTGG + Intergenic
1122366209 14:101196212-101196234 TGTATGCCGGGTTCTTCTCTTGG + Intergenic
1124146980 15:27136955-27136977 TGGGCGTCAGGCTCTTCTCTTGG - Intronic
1131306219 15:91246146-91246168 TGGAAGCTGGCTTCTTCTCCAGG + Intronic
1132630091 16:913127-913149 TGCACGCCCTGCTCTTCCCCAGG + Intronic
1132889469 16:2196702-2196724 CGGACGCCGGGGTCCGCTCCCGG + Intergenic
1134522250 16:14924180-14924202 TGGGCACCAGGCTCTTGTCCGGG + Intronic
1134709920 16:16322831-16322853 TGGGCACCAGGCTCTTGTCCGGG + Intergenic
1134717137 16:16362850-16362872 TGGGCACCAGGCTCTTGTCCCGG + Intergenic
1134949683 16:18345814-18345836 TGGGCACCAGGCTCTTGTCCGGG - Intergenic
1134957615 16:18389309-18389331 TGGGCACCAGGCTCTTGTCCCGG - Intergenic
1136024951 16:27463200-27463222 TGGACCCCTGGCTCATCTGCAGG + Intronic
1139560820 16:67740903-67740925 TGGACATTGGGGTCTTCTCCTGG - Intronic
1141619087 16:85227335-85227357 TGCACGCAGGCCTCTTCTCACGG + Intergenic
1144228659 17:13176714-13176736 TGGACGTCTGGCTCTTCCCAGGG + Intergenic
1146296747 17:31656006-31656028 TGGAAGCCTTGCTCCTCTCCAGG - Intergenic
1151455381 17:74222636-74222658 TGGTGGCCGGGCTCATCTGCTGG + Exonic
1154036735 18:10810534-10810556 GGGACTCAGGGCTTTTCTCCAGG - Intronic
1161323678 19:3652845-3652867 TGAAGGCTGGGCTCTTCTCTGGG + Intronic
1162464770 19:10833000-10833022 TGGGCACCGGGCGCTTGTCCTGG + Exonic
1164890494 19:31819641-31819663 TGGAAGGCGGGGGCTTCTCCTGG + Intergenic
1166094605 19:40530899-40530921 TCGAGGGGGGGCTCTTCTCCGGG + Intronic
1166741968 19:45119897-45119919 GGGACCCCAGGCCCTTCTCCGGG - Intronic
1167250092 19:48394874-48394896 TGGACGCCGGGTTCCGGTCCTGG + Exonic
1168475595 19:56672779-56672801 TGCTCCCCGGGCTCCTCTCCAGG + Intergenic
927542575 2:23926537-23926559 GGGACGCCGCGCTCTTACCCTGG + Exonic
927854091 2:26517065-26517087 TGGGCCCTGGGCTCCTCTCCCGG - Intronic
931492239 2:62760768-62760790 TGGAGTCTGGGCTCTCCTCCTGG + Intronic
931810380 2:65849027-65849049 TGGGCATTGGGCTCTTCTCCTGG - Intergenic
940036135 2:149313799-149313821 AGGAAGCCTGGCTCTGCTCCAGG + Intergenic
947761363 2:232606016-232606038 AGGACGCCTGGCTCATCCCCAGG + Intergenic
948271063 2:236673666-236673688 TGGACGCCGGACACTTCCTCTGG + Intergenic
948612372 2:239178117-239178139 TGGAGGCCTGGCACTTCCCCCGG - Intronic
1168911968 20:1455492-1455514 TGGTGGCCAGGCTCCTCTCCAGG + Intronic
1169350336 20:4863389-4863411 CTGACTGCGGGCTCTTCTCCTGG + Intronic
1174851466 20:53999510-53999532 TGGAAGAGGGGCACTTCTCCAGG - Intronic
1175228710 20:57460343-57460365 TTTACCCCGGGCACTTCTCCTGG + Intergenic
1175980091 20:62734369-62734391 AGGAAGCCGAGCTCTGCTCCTGG + Intronic
1176054878 20:63139782-63139804 TGGACGCCGAGCCCTTTTGCGGG + Intergenic
1176145415 20:63563259-63563281 GGGACGCCTCGCCCTTCTCCTGG + Exonic
1181278845 22:21703997-21704019 GGGACGCCGGTGTCTGCTCCCGG - Intronic
1182453523 22:30435165-30435187 TGTAGCCTGGGCTCTTCTCCAGG + Intergenic
1183786397 22:40031398-40031420 TGGAGGCCGGTCCCTTCCCCAGG - Exonic
1183964545 22:41433695-41433717 TGCTCCCCGGGCTCCTCTCCAGG + Exonic
1185085264 22:48737511-48737533 TGCCAGCCGGGGTCTTCTCCTGG + Intronic
1185146933 22:49142490-49142512 TGGTCTCCGGGCTTGTCTCCGGG + Intergenic
954417028 3:50398245-50398267 TGGGCTCTGGGCTCTGCTCCTGG + Intronic
956732696 3:72211211-72211233 TGGACACCAGTCTCTCCTCCTGG + Intergenic
968745923 4:2360007-2360029 TAGACGCCGTGCGCTTGTCCGGG - Intronic
969484554 4:7464918-7464940 TGGAGGCCGGGCTGTGCTGCCGG - Intronic
981693890 4:147539680-147539702 TGTAAGCCAGGCTGTTCTCCTGG + Intronic
984992580 4:185396074-185396096 TCCACGCCGGGCTCTCCTCCCGG - Intronic
985581050 5:695317-695339 GGGACTCCAGGCTCTTCACCTGG + Intergenic
985595675 5:786649-786671 GGGACTCCAGGCTCTTCACCTGG + Intergenic
990597676 5:57327744-57327766 TGAAAGCAGTGCTCTTCTCCTGG - Intergenic
995806486 5:116058045-116058067 TGGACTCTGGGCTCTCCTCTGGG + Intronic
997292562 5:132748014-132748036 TGGAGGCCGGGCCCTTCCCCAGG + Intronic
997359341 5:133284669-133284691 TGGATGCCTGAATCTTCTCCAGG - Intronic
1001226404 5:169948072-169948094 TGGTGGCCTGGCTCTTCTCTCGG - Intronic
1017759801 6:157559345-157559367 TGGCTGACGCGCTCTTCTCCAGG + Intronic
1019215479 6:170440218-170440240 CGGAGGCCAGGCTCTGCTCCAGG + Intergenic
1019781527 7:2943073-2943095 TGGCCCCCAGGCTCTTTTCCAGG - Intronic
1029705610 7:102274261-102274283 TGGGCTCTGGGATCTTCTCCAGG - Intronic
1033557309 7:142500070-142500092 TGGGCCCCGGGCTCCTCTGCTGG + Intergenic
1033559743 7:142520091-142520113 TGGGCCCCGGGCTCCTCTGCTGG + Intergenic
1034993188 7:155560871-155560893 TGGTCACCCTGCTCTTCTCCAGG - Intergenic
1035577515 8:717222-717244 GAGACCCCGGGCTCTTCACCAGG + Intronic
1038008814 8:23457627-23457649 TGGAGGCCGCGCTCCTTTCCTGG + Exonic
1038745315 8:30249660-30249682 AGGACGATGGGCTCTTCTCTGGG - Intergenic
1040110041 8:43563175-43563197 AGGAGGCTGGGCTCTTCCCCCGG - Intergenic
1047693114 8:127376894-127376916 TGGAAGCTGGGCTCTGCTCAGGG - Intergenic
1048580459 8:135726069-135726091 TGCAAGCCTGGCTGTTCTCCAGG + Intergenic
1053358420 9:37465948-37465970 GTGACCCAGGGCTCTTCTCCGGG + Intergenic
1055700979 9:78945673-78945695 TGGACTCCTTGCTATTCTCCAGG + Intergenic
1061019696 9:128006140-128006162 TGGCAGCTGGGCTCTTCCCCAGG - Intergenic
1061713078 9:132500888-132500910 GGGACGCATGGCTCTTCTCTTGG - Intronic
1062176554 9:135166497-135166519 TGGAAGCCGGGCTCGGTTCCTGG - Intergenic
1062276751 9:135734993-135735015 ATGAGGCTGGGCTCTTCTCCTGG - Intronic
1062373516 9:136252143-136252165 TGGGCGGCCGGCTCTTCCCCTGG - Intergenic
1062464219 9:136674038-136674060 CCGAGGCCGGGCTCTTCCCCTGG + Intronic
1062675912 9:137743738-137743760 TGTCTGCCGGGCTCTTCTCCAGG + Intronic
1193399096 X:81021101-81021123 CTGACGCCCTGCTCTTCTCCAGG - Intergenic
1197941555 X:131795589-131795611 AGGACGCCATGCTCCTCTCCTGG + Intergenic
1198051519 X:132956915-132956937 GGGAAACCTGGCTCTTCTCCAGG - Exonic
1201273808 Y:12280814-12280836 TGGCCACAGGGCTCTTCTACAGG + Intergenic