ID: 922753805

View in Genome Browser
Species Human (GRCh38)
Location 1:228083083-228083105
Sequence GGGCTCTTCTCCAGGAAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 216}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922753787_922753805 22 Left 922753787 1:228083038-228083060 CCTGTCCCTGCCCCCGCCCGTCG 0: 1
1: 0
2: 0
3: 61
4: 571
Right 922753805 1:228083083-228083105 GGGCTCTTCTCCAGGAAACCTGG 0: 1
1: 0
2: 4
3: 25
4: 216
922753798_922753805 -1 Left 922753798 1:228083061-228083083 CCCGGAAGTCCGCTTGGACGCCG 0: 1
1: 0
2: 0
3: 1
4: 36
Right 922753805 1:228083083-228083105 GGGCTCTTCTCCAGGAAACCTGG 0: 1
1: 0
2: 4
3: 25
4: 216
922753792_922753805 11 Left 922753792 1:228083049-228083071 CCCCGCCCGTCGCCCGGAAGTCC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 922753805 1:228083083-228083105 GGGCTCTTCTCCAGGAAACCTGG 0: 1
1: 0
2: 4
3: 25
4: 216
922753795_922753805 6 Left 922753795 1:228083054-228083076 CCCGTCGCCCGGAAGTCCGCTTG 0: 1
1: 0
2: 0
3: 2
4: 20
Right 922753805 1:228083083-228083105 GGGCTCTTCTCCAGGAAACCTGG 0: 1
1: 0
2: 4
3: 25
4: 216
922753790_922753805 16 Left 922753790 1:228083044-228083066 CCTGCCCCCGCCCGTCGCCCGGA 0: 1
1: 0
2: 4
3: 43
4: 426
Right 922753805 1:228083083-228083105 GGGCTCTTCTCCAGGAAACCTGG 0: 1
1: 0
2: 4
3: 25
4: 216
922753796_922753805 5 Left 922753796 1:228083055-228083077 CCGTCGCCCGGAAGTCCGCTTGG 0: 1
1: 0
2: 0
3: 2
4: 38
Right 922753805 1:228083083-228083105 GGGCTCTTCTCCAGGAAACCTGG 0: 1
1: 0
2: 4
3: 25
4: 216
922753793_922753805 10 Left 922753793 1:228083050-228083072 CCCGCCCGTCGCCCGGAAGTCCG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 922753805 1:228083083-228083105 GGGCTCTTCTCCAGGAAACCTGG 0: 1
1: 0
2: 4
3: 25
4: 216
922753791_922753805 12 Left 922753791 1:228083048-228083070 CCCCCGCCCGTCGCCCGGAAGTC 0: 1
1: 0
2: 0
3: 7
4: 77
Right 922753805 1:228083083-228083105 GGGCTCTTCTCCAGGAAACCTGG 0: 1
1: 0
2: 4
3: 25
4: 216
922753788_922753805 17 Left 922753788 1:228083043-228083065 CCCTGCCCCCGCCCGTCGCCCGG 0: 1
1: 0
2: 5
3: 40
4: 434
Right 922753805 1:228083083-228083105 GGGCTCTTCTCCAGGAAACCTGG 0: 1
1: 0
2: 4
3: 25
4: 216
922753786_922753805 28 Left 922753786 1:228083032-228083054 CCTCTGCCTGTCCCTGCCCCCGC 0: 1
1: 0
2: 14
3: 130
4: 1248
Right 922753805 1:228083083-228083105 GGGCTCTTCTCCAGGAAACCTGG 0: 1
1: 0
2: 4
3: 25
4: 216
922753802_922753805 -10 Left 922753802 1:228083070-228083092 CCGCTTGGACGCCGGGCTCTTCT 0: 1
1: 0
2: 0
3: 7
4: 86
Right 922753805 1:228083083-228083105 GGGCTCTTCTCCAGGAAACCTGG 0: 1
1: 0
2: 4
3: 25
4: 216
922753799_922753805 -2 Left 922753799 1:228083062-228083084 CCGGAAGTCCGCTTGGACGCCGG 0: 1
1: 0
2: 0
3: 1
4: 26
Right 922753805 1:228083083-228083105 GGGCTCTTCTCCAGGAAACCTGG 0: 1
1: 0
2: 4
3: 25
4: 216
922753794_922753805 9 Left 922753794 1:228083051-228083073 CCGCCCGTCGCCCGGAAGTCCGC 0: 1
1: 0
2: 0
3: 1
4: 44
Right 922753805 1:228083083-228083105 GGGCTCTTCTCCAGGAAACCTGG 0: 1
1: 0
2: 4
3: 25
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922753805 Original CRISPR GGGCTCTTCTCCAGGAAACC TGG Intronic