ID: 922753805

View in Genome Browser
Species Human (GRCh38)
Location 1:228083083-228083105
Sequence GGGCTCTTCTCCAGGAAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 216}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922753791_922753805 12 Left 922753791 1:228083048-228083070 CCCCCGCCCGTCGCCCGGAAGTC 0: 1
1: 0
2: 0
3: 7
4: 77
Right 922753805 1:228083083-228083105 GGGCTCTTCTCCAGGAAACCTGG 0: 1
1: 0
2: 4
3: 25
4: 216
922753802_922753805 -10 Left 922753802 1:228083070-228083092 CCGCTTGGACGCCGGGCTCTTCT 0: 1
1: 0
2: 0
3: 7
4: 86
Right 922753805 1:228083083-228083105 GGGCTCTTCTCCAGGAAACCTGG 0: 1
1: 0
2: 4
3: 25
4: 216
922753787_922753805 22 Left 922753787 1:228083038-228083060 CCTGTCCCTGCCCCCGCCCGTCG 0: 1
1: 0
2: 0
3: 61
4: 571
Right 922753805 1:228083083-228083105 GGGCTCTTCTCCAGGAAACCTGG 0: 1
1: 0
2: 4
3: 25
4: 216
922753796_922753805 5 Left 922753796 1:228083055-228083077 CCGTCGCCCGGAAGTCCGCTTGG 0: 1
1: 0
2: 0
3: 2
4: 38
Right 922753805 1:228083083-228083105 GGGCTCTTCTCCAGGAAACCTGG 0: 1
1: 0
2: 4
3: 25
4: 216
922753798_922753805 -1 Left 922753798 1:228083061-228083083 CCCGGAAGTCCGCTTGGACGCCG 0: 1
1: 0
2: 0
3: 1
4: 36
Right 922753805 1:228083083-228083105 GGGCTCTTCTCCAGGAAACCTGG 0: 1
1: 0
2: 4
3: 25
4: 216
922753786_922753805 28 Left 922753786 1:228083032-228083054 CCTCTGCCTGTCCCTGCCCCCGC 0: 1
1: 0
2: 14
3: 130
4: 1248
Right 922753805 1:228083083-228083105 GGGCTCTTCTCCAGGAAACCTGG 0: 1
1: 0
2: 4
3: 25
4: 216
922753799_922753805 -2 Left 922753799 1:228083062-228083084 CCGGAAGTCCGCTTGGACGCCGG 0: 1
1: 0
2: 0
3: 1
4: 26
Right 922753805 1:228083083-228083105 GGGCTCTTCTCCAGGAAACCTGG 0: 1
1: 0
2: 4
3: 25
4: 216
922753793_922753805 10 Left 922753793 1:228083050-228083072 CCCGCCCGTCGCCCGGAAGTCCG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 922753805 1:228083083-228083105 GGGCTCTTCTCCAGGAAACCTGG 0: 1
1: 0
2: 4
3: 25
4: 216
922753790_922753805 16 Left 922753790 1:228083044-228083066 CCTGCCCCCGCCCGTCGCCCGGA 0: 1
1: 0
2: 4
3: 43
4: 426
Right 922753805 1:228083083-228083105 GGGCTCTTCTCCAGGAAACCTGG 0: 1
1: 0
2: 4
3: 25
4: 216
922753792_922753805 11 Left 922753792 1:228083049-228083071 CCCCGCCCGTCGCCCGGAAGTCC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 922753805 1:228083083-228083105 GGGCTCTTCTCCAGGAAACCTGG 0: 1
1: 0
2: 4
3: 25
4: 216
922753788_922753805 17 Left 922753788 1:228083043-228083065 CCCTGCCCCCGCCCGTCGCCCGG 0: 1
1: 0
2: 5
3: 40
4: 434
Right 922753805 1:228083083-228083105 GGGCTCTTCTCCAGGAAACCTGG 0: 1
1: 0
2: 4
3: 25
4: 216
922753795_922753805 6 Left 922753795 1:228083054-228083076 CCCGTCGCCCGGAAGTCCGCTTG 0: 1
1: 0
2: 0
3: 2
4: 20
Right 922753805 1:228083083-228083105 GGGCTCTTCTCCAGGAAACCTGG 0: 1
1: 0
2: 4
3: 25
4: 216
922753794_922753805 9 Left 922753794 1:228083051-228083073 CCGCCCGTCGCCCGGAAGTCCGC 0: 1
1: 0
2: 0
3: 1
4: 44
Right 922753805 1:228083083-228083105 GGGCTCTTCTCCAGGAAACCTGG 0: 1
1: 0
2: 4
3: 25
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922753805 Original CRISPR GGGCTCTTCTCCAGGAAACC TGG Intronic
900138132 1:1127494-1127516 GGGCTCTTGTCCAGAGACCCAGG - Intergenic
900405007 1:2489081-2489103 GGGGTCTTCACCAGGAACCCAGG - Intronic
900430774 1:2602189-2602211 GGTCTCTTCTCCAGGGAAGGAGG + Intronic
902490112 1:16775369-16775391 GGGCTCTGCCCCAGGAATTCAGG + Intronic
902685388 1:18073392-18073414 GGGGTCTTCACCAGGAAGGCTGG - Intergenic
903030085 1:20457687-20457709 AGGCTCTGATCCAGGATACCAGG - Intergenic
903753566 1:25645354-25645376 GGGCTGTGCTGCAGGAACCCAGG + Intronic
903969363 1:27108967-27108989 GGGCTCTGCTCCTGGGAGCCAGG + Intronic
906022887 1:42646643-42646665 GGGCTCATGCCCAGGAGACCTGG - Intronic
906255284 1:44344453-44344475 GGGCTCTTCTGATGGAAACTCGG - Intronic
907953163 1:59203446-59203468 GGCCTCTTTTCCAGGATTCCAGG - Intergenic
911294953 1:96103637-96103659 GGGCTCTTCAGTTGGAAACCTGG + Intergenic
912568322 1:110604884-110604906 GGGCTCTCCTGCAGGAGACCAGG - Exonic
912700220 1:111872722-111872744 GGCCTCTTTTTCAGGAATCCCGG - Intronic
913185999 1:116371769-116371791 GGGCTCTTCTCCAGGCAGTCAGG + Intergenic
915474619 1:156146448-156146470 GGGCTTTTCCCCAGGCAGCCTGG - Intergenic
917929829 1:179815527-179815549 TGGCTCATCGCCAGGAAACTGGG - Exonic
918262210 1:182806379-182806401 GGGCTCTTCTCCAAGAAGCCAGG - Intronic
920313594 1:205062424-205062446 GGGCTCTTCTGCACAGAACCGGG + Exonic
920616330 1:207496273-207496295 GGCCTCTTCTCCAAGAAGCCCGG + Exonic
920632838 1:207669450-207669472 GGTCTCTTCTCCGAGAAGCCGGG + Intronic
920816703 1:209341154-209341176 GGGCTATGCTCCAGGAATACAGG - Intergenic
921579924 1:216884153-216884175 AGGCTCTGCTGCAGGAAACTAGG + Intronic
922683755 1:227622882-227622904 GGGCTGCATTCCAGGAAACCGGG + Intronic
922722446 1:227905823-227905845 GGGCCCTTCCCCAGGGAAGCGGG - Intergenic
922729530 1:227942480-227942502 GGGCATTTCTCCAGGACTCCTGG - Intronic
922753805 1:228083083-228083105 GGGCTCTTCTCCAGGAAACCTGG + Intronic
923530325 1:234807161-234807183 GGGCTCTGCCCCAGGAATTCAGG - Intergenic
923699051 1:236282246-236282268 GACCTCTTCTCCGGGAAACCAGG + Intergenic
924599697 1:245477736-245477758 GGTCTCTTTTCCAGCCAACCTGG - Intronic
1063361909 10:5466340-5466362 GGGCTCTGCTCCAGGTAACCTGG + Intergenic
1063500185 10:6546334-6546356 GGGCACTTCTACTGTAAACCTGG - Intronic
1064101850 10:12470948-12470970 GGGCTGTGCTCCAGGAGCCCTGG + Intronic
1064812313 10:19214250-19214272 GGGCTCTTCTCCTGGAGTACTGG + Intronic
1066386874 10:34948607-34948629 CAGCCCTTCTCCAGGAACCCGGG + Intergenic
1067027750 10:42858947-42858969 GGGATCTTCTACAGGAAAGCAGG - Intergenic
1069599147 10:69692367-69692389 GGGAACTTCTCCCGGAAGCCTGG - Exonic
1069799860 10:71075378-71075400 TGGCCCTCTTCCAGGAAACCTGG + Intergenic
1070290190 10:75108863-75108885 GGGACCTTCTCCAGGACCCCCGG - Intronic
1070931437 10:80263893-80263915 GTCCCCTTCTCCAGGAAGCCTGG - Intergenic
1071055354 10:81503183-81503205 GCTCTCTGCTCCAGGACACCTGG + Intergenic
1071510093 10:86255962-86255984 GGGATCCTCTCCAGGAGCCCTGG - Intronic
1073321599 10:102619374-102619396 GGGCTGTTGCCCAGGGAACCGGG + Intronic
1074130683 10:110571234-110571256 GTGCTGTTTTCTAGGAAACCAGG - Intronic
1075505197 10:123015109-123015131 GGGCTCTTCTCCAGGACTGTGGG - Intronic
1078840392 11:15072179-15072201 GGGATCTTCTCCTGGAACCCGGG + Intronic
1084400031 11:68938168-68938190 CGGGTCTTCTCCAGGACATCCGG + Exonic
1085089929 11:73703232-73703254 GGGCAATTCTCCAAGTAACCTGG + Intronic
1089209191 11:116789195-116789217 GGGCTCTGCTTCAGGGATCCTGG - Intergenic
1090264216 11:125343958-125343980 GGGCTCCTCTCTGGGAAACCTGG + Intronic
1090387468 11:126365221-126365243 AGGCTCTTCCCAAGGAAGCCTGG - Intronic
1090390034 11:126382419-126382441 AGGCTCTTCCCAAGGAAGCCTGG - Intronic
1091821875 12:3481454-3481476 GGGCGCTTCTCCAGGAGCCTTGG + Intronic
1093406497 12:18811033-18811055 GGTCTCTTCTCCAGCAAGTCAGG + Intergenic
1094292025 12:28862249-28862271 GAGCTGTACTCCAGGAAACAGGG - Intergenic
1094596954 12:31874534-31874556 GAGCACTTCTCAAGGTAACCTGG - Intergenic
1095247830 12:39943372-39943394 GGGCTCTGTTCCAGGAAGACGGG + Intronic
1095866465 12:46978177-46978199 GGGCCCTCCTCCAGGACACCTGG + Intergenic
1096114854 12:49049913-49049935 GGGCTCTGAGCCAGGAAAACTGG + Exonic
1096220871 12:49827756-49827778 GGGCTGTTCTCTAGGAGACCCGG + Intronic
1097066589 12:56325045-56325067 GGGCTCTAATCCAGCAAACAAGG + Exonic
1101222445 12:102655516-102655538 GGGTTCTTCCTCAAGAAACCTGG - Intergenic
1101968416 12:109296170-109296192 GGCCTCTTCCCCAGAAAGCCTGG - Intronic
1104642277 12:130475132-130475154 GGGCTCTCCTCCCGGAATCCAGG - Intronic
1105439110 13:20401277-20401299 GGGCTCTTCTACAGGACACCTGG + Intergenic
1105596785 13:21846688-21846710 GAGCTGTGCTCCAGGAAACGGGG - Intergenic
1108234216 13:48385535-48385557 GGTCTCTTCACCAGGAAAACTGG + Intronic
1111487384 13:88921505-88921527 GACCTCTACTCCAGGAAACCTGG + Intergenic
1111915081 13:94352259-94352281 GGGCTCTCTTCCAGGATCCCAGG + Intronic
1112230750 13:97587113-97587135 GGGCTCTAATCCAGGAAGTCTGG - Intergenic
1113626797 13:111853727-111853749 TGTCTCTTCTCCAGTAATCCTGG - Intergenic
1114678666 14:24463762-24463784 GGGCTATGCTCCATGAAGCCTGG - Intergenic
1120007754 14:79379425-79379447 GGGCACAACCCCAGGAAACCAGG - Intronic
1121974905 14:98393851-98393873 GGCCTCTGCTCCAGGAAACCTGG + Intergenic
1121978614 14:98431508-98431530 AGGTTCATCTCCAGGAAGCCTGG - Intergenic
1122134572 14:99625455-99625477 GGGCTGTTCTCCAGGCAGGCAGG + Intergenic
1123056244 14:105572035-105572057 GGCCCCTTCTCCAGGAGCCCTGG - Intergenic
1123057689 14:105579772-105579794 GGCCCCTTCTCCAGGAGCCCTGG + Intergenic
1123080673 14:105692163-105692185 GGCCCCTTCTCCAGGAGCCCTGG - Intergenic
1123081968 14:105699705-105699727 GGCCCCTTCTCCAGGAGCCCTGG + Intergenic
1123427398 15:20183776-20183798 GGGATCTTCTACAGGAAAGCAGG - Intergenic
1123457500 15:20439280-20439302 CGGCTCTTCACCAGGACACAGGG + Intergenic
1123457527 15:20439404-20439426 CGGCTCTTCACCAGGACACAGGG + Intergenic
1123536634 15:21190326-21190348 GGGATCTTCTACAGGAAAGCAGG - Intergenic
1123660571 15:22561141-22561163 CGGCTCTTCACCAGGACACAGGG - Intergenic
1123809087 15:23905316-23905338 GGGCTCTTCTCCAACTACCCCGG + Intergenic
1124955171 15:34355667-34355689 GGTTTCTTCTTCAGGAAAACGGG + Exonic
1125965159 15:43869001-43869023 GGGGAGTTCTCCAGGAAAACAGG + Intergenic
1127059987 15:55172521-55172543 AGGCTCATCTCCAGAAAAGCTGG - Intergenic
1128889596 15:71318779-71318801 TGACTCTTCTTCAGGTAACCTGG - Intronic
1129092016 15:73161060-73161082 GGGCTCTGTGTCAGGAAACCAGG + Intronic
1130928719 15:88404870-88404892 GCTCTCTCCTCCAGGAAACCCGG - Intergenic
1131383845 15:91986267-91986289 GTCCTCTTCCCCAGGAAGCCAGG - Intronic
1131802395 15:96084530-96084552 GGCTTCTTCTCCATGAAACTTGG - Intergenic
1131934867 15:97492182-97492204 TGGATCTTCTCCAGGAAATCTGG - Intergenic
1132726070 16:1338888-1338910 GGCTCTTTCTCCAGGAAACCCGG + Exonic
1133030043 16:3006262-3006284 GGGCTCTTCTCCAGCAGCCTAGG + Intergenic
1133141412 16:3747444-3747466 GTCATCTTGTCCAGGAAACCAGG + Intronic
1134104966 16:11478677-11478699 GGGCTCTCCCCCAGGTGACCCGG - Exonic
1134863006 16:17577751-17577773 GACCCCTTCTCCAGGAGACCTGG + Intergenic
1136057639 16:27702224-27702246 GGGGTATTCTACTGGAAACCTGG - Intronic
1136856891 16:33666033-33666055 GGGATCTTCTACAGGAAAGCAGG + Intergenic
1137255666 16:46773328-46773350 CTGCTCTTCATCAGGAAACCTGG - Intronic
1137710556 16:50563841-50563863 AGGGTCTTCTCCATGAATCCAGG - Intronic
1138388477 16:56652645-56652667 GGGATCATCTCCAGGAATCTGGG + Intronic
1141002831 16:80324257-80324279 GTGGTCTTCTCCAGGACTCCGGG - Intergenic
1141681158 16:85544787-85544809 AGGCCCTGCTCCAGGAAAACAGG - Intergenic
1141782294 16:86171160-86171182 GGGCTCGTCTTCAGGATTCCTGG + Intergenic
1141858353 16:86700403-86700425 GGGCTCTTCTCCAGGACCAAGGG - Intergenic
1203118466 16_KI270728v1_random:1514508-1514530 GGGATCTTCTACAGGAAAGCAGG + Intergenic
1142572406 17:883582-883604 GGTCTCCTCTCCATGAAGCCAGG + Intronic
1142698407 17:1645772-1645794 GGGCTTTTCCTGAGGAAACCAGG + Intergenic
1144773276 17:17771145-17771167 GGGCCCTTCTTCATGACACCTGG - Intronic
1145047975 17:19634057-19634079 GGGCTCCTCTCCTGGGAATCTGG - Intergenic
1146276273 17:31517687-31517709 GAGCTCATCCCCAGGGAACCCGG + Exonic
1148853070 17:50564087-50564109 GATCTCCTCTCTAGGAAACCTGG - Intronic
1148974590 17:51515940-51515962 GGGCTATACTCCAGTAACCCTGG + Intergenic
1151425301 17:74027241-74027263 TGGCTCTTCTCCAGGAACAGGGG + Intergenic
1151564615 17:74890929-74890951 GTCCTCTTCTCCAGCAAGCCTGG + Intronic
1152258175 17:79252343-79252365 AGGGTCTTCTCCCAGAAACCTGG + Intronic
1152914130 17:83024195-83024217 GGGCTCTTCTGCAGACGACCAGG - Intronic
1154036732 18:10810526-10810548 GGGCTTTTCTCCAGGAAATGGGG - Intronic
1156602909 18:38631129-38631151 AGGCACTTCTCAAGGAAAGCTGG - Intergenic
1156793841 18:41015511-41015533 GGGCTCTTCTCTAAGATTCCAGG - Intergenic
1158351820 18:56572030-56572052 GCTCTCTTCTCCAGGTATCCGGG - Intergenic
1158498220 18:57975767-57975789 AGGCTTTTCTCCATGAAGCCTGG + Intergenic
1160012426 18:75116266-75116288 GGGCTCATGTCCAGAAGACCTGG - Intergenic
1160220862 18:76976687-76976709 GGGCTCTTATCCAGTAAGACTGG + Intergenic
1163017190 19:14463756-14463778 GGCCTCTCCCCCAGGAAGCCTGG - Intronic
1163127500 19:15252119-15252141 GGGCACTCGTTCAGGAAACCAGG + Intronic
1164780799 19:30890406-30890428 TAGCTTTTCTCCTGGAAACCTGG - Intergenic
1164899214 19:31904051-31904073 GGGATCCTCTCCAGGGAAGCTGG - Intergenic
1166090167 19:40503498-40503520 GGGCTGGTCTCCAGGACAACAGG + Intronic
1166090214 19:40503651-40503673 GGGCTGGTCTCCAGGTTACCTGG + Intronic
1166094608 19:40530907-40530929 GGGCTCTTCTCCGGGTAATGGGG + Intronic
1166734973 19:45078884-45078906 CCGCTCCTCTACAGGAAACCTGG - Intergenic
1166805647 19:45485501-45485523 AGGCTCTGCTCCAGGAGTCCAGG - Exonic
1167045843 19:47048313-47048335 GGGGGCTTCTGCAGGAAACGGGG - Intronic
1167906919 19:52668799-52668821 GGGCTGTCCTCCAGTAGACCAGG + Intronic
1167925962 19:52821219-52821241 GCGCTGTGCTCCAGGAACCCAGG + Intronic
1167930148 19:52857205-52857227 GCGCTGTGCTCCAGGAACCCAGG + Intronic
925589550 2:5495833-5495855 GGGCTCTTCTCCGCGCTACCTGG + Intergenic
925924255 2:8659164-8659186 GGGCACTGCTCCTGGAGACCAGG + Intergenic
926839698 2:17065892-17065914 TGGCTCATTACCAGGAAACCAGG + Intergenic
927202214 2:20584819-20584841 GGGCTCTTCTCAAGGATAAGAGG + Intronic
928115264 2:28541693-28541715 GCTCCCTTCTCCAGGAAGCCTGG + Exonic
929571585 2:43026464-43026486 GGGCTCTTCAGCAGGAATGCGGG - Intergenic
929776037 2:44931545-44931567 TGCCTCTTCTGCAGGAAACCGGG + Intergenic
933559906 2:83876274-83876296 AGGTTCTTCTCGAGGAAAGCTGG - Intergenic
936389415 2:112057795-112057817 GGTCTCTCCTCCAGGAAGCAGGG - Intronic
938238372 2:129724133-129724155 GTGCTCTGCTCCAGGCAAGCTGG + Intergenic
944299139 2:198102593-198102615 GAGCTCAGCTCCAGGAAACTGGG + Intronic
944599586 2:201289836-201289858 GGTCTCTTCTCCAGGGCACCTGG + Exonic
946156305 2:217808993-217809015 GGGCTCTGCTCCTAGAAAGCAGG + Intronic
947302657 2:228705695-228705717 GGGCTGCTCTGCAGGAAAGCTGG - Intergenic
948127518 2:235575646-235575668 GGGCTCTACTCCTGGAACCTGGG + Intronic
948417166 2:237817819-237817841 AAGCAATTCTCCAGGAAACCAGG + Exonic
948826916 2:240577380-240577402 GGCCCCATCTCCAGGGAACCTGG - Intronic
1171154810 20:22862172-22862194 GGCGGCTGCTCCAGGAAACCCGG - Intergenic
1171387935 20:24782814-24782836 AGCCTCTTCTCCAGGAACCCTGG - Intergenic
1172512028 20:35507533-35507555 GGGCTCTTCTCAAGGATATGCGG - Intronic
1172625747 20:36345716-36345738 GGGCTTTTCTTCAGGACATCAGG + Intronic
1174095890 20:48089195-48089217 GGGCTCTGCTCCAGCAGCCCTGG - Intergenic
1174756403 20:53162701-53162723 GGGCTATGCTCCAGGAAAAGTGG + Intronic
1174845956 20:53943292-53943314 AGGCTCTGCTCCAAGCAACCTGG + Intronic
1175194268 20:57231554-57231576 GTGCTTTTCTCCAGGGGACCAGG + Intronic
1181117592 22:20642732-20642754 GTGCTCCTCTCCAAAAAACCTGG - Intergenic
1181169513 22:21000351-21000373 GGCCTCTTCCACAGGAAAGCAGG + Exonic
1181381489 22:22508364-22508386 GGCCCCTTCTCCAGGAGGCCCGG + Intronic
1181487001 22:23237829-23237851 GGGCTCCACTTCAGGAAATCTGG - Intronic
1182444475 22:30382055-30382077 GGGCTGTACACCAGGAGACCGGG + Intronic
1182638363 22:31747436-31747458 GGTCTCTTCATCAGGAAGCCAGG + Intronic
1183883547 22:40857095-40857117 GGCCGCGTCGCCAGGAAACCGGG - Exonic
1184081679 22:42225790-42225812 GACCTCTACTTCAGGAAACCTGG + Intronic
1184773656 22:46612587-46612609 GAGCCCATCTCCAGGGAACCTGG - Intronic
1185320839 22:50199715-50199737 TGTCTCTTCTGCTGGAAACCAGG - Intergenic
949919172 3:8987857-8987879 CGGCTCGGCTCCAGGAAAGCCGG - Intronic
952298792 3:32085696-32085718 GGGCTCTCCTCCAGCTACCCTGG + Intergenic
952608452 3:35178957-35178979 GTGCACATCTCAAGGAAACCAGG - Intergenic
953333272 3:42072174-42072196 AGGGGCTTCTCCAGCAAACCAGG - Intronic
955326115 3:58010217-58010239 GGTCTCTTCCTGAGGAAACCAGG + Intronic
955374818 3:58386099-58386121 TGGCTCTTCTGGAGAAAACCTGG - Intronic
957121270 3:76096991-76097013 GTTCTGTTCTCCTGGAAACCTGG + Intronic
961573428 3:127816632-127816654 GGCCTCTCCTCCAGGTAAACTGG + Intronic
968531029 4:1091755-1091777 GGGCCCTCCTCCAGGACAGCAGG + Intronic
968875769 4:3267085-3267107 GAGCTCTTCTAGAGGAAACGTGG + Intronic
969279397 4:6159947-6159969 GGGCTTTTCTCCATGAAAAATGG - Intronic
969455099 4:7295975-7295997 GGGCTCTGCTCCACGACTCCTGG - Intronic
970671081 4:18397443-18397465 GGGCTTGTCATCAGGAAACCTGG - Intergenic
985141391 4:186843624-186843646 GGGCTATTCTGCAGCAACCCTGG - Intergenic
985513589 5:325516-325538 GTGCACTTCTCCCAGAAACCAGG - Intronic
985713921 5:1445453-1445475 GGGCTCTTATCCAGTAGACAGGG + Intergenic
987475200 5:18383237-18383259 TGGCTCTTCTCCAGGCAAACGGG + Intergenic
988400815 5:30757867-30757889 GGACTGTTCTCCTGGGAACCTGG + Intergenic
989455406 5:41637963-41637985 GGTCTCCTCTCCTGGAAACTAGG + Intergenic
998175466 5:139899192-139899214 GGGCTCTGCTCCAGGAGGCTGGG + Intronic
1002054331 5:176590077-176590099 GGGCTCTTACCCAGGCAACCAGG + Exonic
1006576920 6:35053293-35053315 GCCCCCTTCCCCAGGAAACCTGG - Intronic
1009456080 6:63858043-63858065 GGCCTCTTCCCCAGGCACCCTGG - Intronic
1011195757 6:84777592-84777614 GAGCTCATCTCCATAAAACCTGG - Intergenic
1011247221 6:85332138-85332160 AGGCTCTTCTCCAAGCAGCCTGG + Intergenic
1012701172 6:102459058-102459080 GGGCGTTTCTGCAGAAAACCCGG + Intergenic
1014510507 6:122315839-122315861 GGGCTCTTATCTAGGAGATCTGG - Intergenic
1015836084 6:137421448-137421470 GGCCTCGCCTCTAGGAAACCTGG + Intergenic
1016866868 6:148776235-148776257 GTGCTCCTCTTCTGGAAACCAGG - Intronic
1018931417 6:168242531-168242553 GGGCAGTTCTGCAGGAAGCCTGG + Intergenic
1018948904 6:168365590-168365612 GGGCTCTGCTCCAAGCACCCCGG + Intergenic
1018954128 6:168396598-168396620 GGGCTTTTCTCCTGGTGACCGGG - Intergenic
1019340955 7:508734-508756 GGGCTCTTCTCCCTGGAAACTGG - Intronic
1020015466 7:4829038-4829060 GGGCTCTGTTCCAGGACAGCTGG - Intronic
1020236483 7:6359724-6359746 TAGCTCTTCTCCATGAAGCCTGG - Intergenic
1025806255 7:64837061-64837083 AGGTTCTTCTCGAGGAAAGCTGG - Intergenic
1026528200 7:71174174-71174196 GGGCTCTGCTCCAGGTGCCCGGG + Intronic
1027245915 7:76367289-76367311 GGGCTCTTCTCTAGAGAACATGG - Intergenic
1034733779 7:153411052-153411074 AGGTTCTTCTCGAGGAAAGCTGG - Intergenic
1035061796 7:156074918-156074940 GGGGCCTTCTCCAGGCAACGTGG + Intergenic
1035321555 7:158032846-158032868 GAGCTCCTCTCCTGAAAACCTGG - Intronic
1037322425 8:17656609-17656631 GGGATCTTCTCTTAGAAACCTGG - Intronic
1037663954 8:20951650-20951672 GGGCCCTTCTCCAGTAATTCAGG + Intergenic
1037950688 8:23017238-23017260 GCTCTCTGCTCCAGAAAACCAGG + Exonic
1040510004 8:48085017-48085039 GGGCTCCTCACCAGGACCCCGGG - Intergenic
1041182628 8:55264533-55264555 TGGCTCTTCTCCAGATAAACTGG + Intronic
1047420554 8:124704589-124704611 GGGCTCTTCCCCAGGACAGGTGG + Intronic
1049493155 8:142915573-142915595 GGGCTTTTCTCCAAGAAAGGAGG + Intronic
1049691924 8:143965291-143965313 GGACTCTTCTGCAGCTAACCAGG + Intronic
1051590130 9:18769258-18769280 GGGCACTCCTCCAGCAAAGCAGG + Intronic
1057334370 9:94144205-94144227 GGGCTCTGCTCCTGGGATCCGGG + Intergenic
1057495293 9:95555581-95555603 GTGCTCTTCCCCAGGTATCCGGG + Intergenic
1057560065 9:96120465-96120487 GGGTTCTTCTCCATCAACCCTGG - Intergenic
1060105543 9:120870516-120870538 GGGCTCCTCTCCTGGAACACCGG + Exonic
1060481022 9:124016952-124016974 GGGCTCGGCTCCAGGGCACCTGG + Intronic
1061381781 9:130263130-130263152 GGGCTTTGCTCCAGGTAGCCAGG + Intergenic
1061505065 9:131027133-131027155 GGGCTCTGCCCCAGGAGGCCAGG - Intronic
1062151403 9:135021087-135021109 GGGCTCCTCTGCAGGATAACAGG - Intergenic
1062233821 9:135498605-135498627 GGGCTCTGCTCCCGTAAGCCTGG + Exonic
1062675916 9:137743746-137743768 GGGCTCTTCTCCAGGTGGCAGGG + Intronic
1062689413 9:137833703-137833725 GGGCTCCTCTCCAAGGCACCAGG + Intronic
1185451294 X:281716-281738 TGTCTCTTCTCCAGGAGGCCGGG + Intronic
1189143431 X:38630774-38630796 GGGATCTTCTCAAGGCAACTTGG - Intronic
1190881401 X:54495207-54495229 GGGCGCTGCTCCAGGCCACCGGG - Exonic
1191599372 X:62985949-62985971 GGGCTCTGTTCTAGGATACCTGG - Intergenic
1192350778 X:70354791-70354813 AGGACCTTCACCAGGAAACCAGG + Intronic
1193464008 X:81825126-81825148 AGGCGCTTCTCCTGGAAAACTGG + Intergenic
1196746303 X:119073860-119073882 GGGCTCTTCTGCAGGCTCCCTGG - Intergenic
1199711590 X:150473477-150473499 TGGTTATGCTCCAGGAAACCTGG - Intronic
1199851301 X:151726449-151726471 GGGCTCCTTTCCAAGAAGCCAGG - Intergenic