ID: 922753806

View in Genome Browser
Species Human (GRCh38)
Location 1:228083084-228083106
Sequence GGCTCTTCTCCAGGAAACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 205}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922753792_922753806 12 Left 922753792 1:228083049-228083071 CCCCGCCCGTCGCCCGGAAGTCC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 922753806 1:228083084-228083106 GGCTCTTCTCCAGGAAACCTGGG 0: 1
1: 0
2: 0
3: 20
4: 205
922753795_922753806 7 Left 922753795 1:228083054-228083076 CCCGTCGCCCGGAAGTCCGCTTG 0: 1
1: 0
2: 0
3: 2
4: 20
Right 922753806 1:228083084-228083106 GGCTCTTCTCCAGGAAACCTGGG 0: 1
1: 0
2: 0
3: 20
4: 205
922753786_922753806 29 Left 922753786 1:228083032-228083054 CCTCTGCCTGTCCCTGCCCCCGC 0: 1
1: 0
2: 14
3: 130
4: 1248
Right 922753806 1:228083084-228083106 GGCTCTTCTCCAGGAAACCTGGG 0: 1
1: 0
2: 0
3: 20
4: 205
922753799_922753806 -1 Left 922753799 1:228083062-228083084 CCGGAAGTCCGCTTGGACGCCGG 0: 1
1: 0
2: 0
3: 1
4: 26
Right 922753806 1:228083084-228083106 GGCTCTTCTCCAGGAAACCTGGG 0: 1
1: 0
2: 0
3: 20
4: 205
922753798_922753806 0 Left 922753798 1:228083061-228083083 CCCGGAAGTCCGCTTGGACGCCG 0: 1
1: 0
2: 0
3: 1
4: 36
Right 922753806 1:228083084-228083106 GGCTCTTCTCCAGGAAACCTGGG 0: 1
1: 0
2: 0
3: 20
4: 205
922753790_922753806 17 Left 922753790 1:228083044-228083066 CCTGCCCCCGCCCGTCGCCCGGA 0: 1
1: 0
2: 4
3: 43
4: 426
Right 922753806 1:228083084-228083106 GGCTCTTCTCCAGGAAACCTGGG 0: 1
1: 0
2: 0
3: 20
4: 205
922753788_922753806 18 Left 922753788 1:228083043-228083065 CCCTGCCCCCGCCCGTCGCCCGG 0: 1
1: 0
2: 5
3: 40
4: 434
Right 922753806 1:228083084-228083106 GGCTCTTCTCCAGGAAACCTGGG 0: 1
1: 0
2: 0
3: 20
4: 205
922753787_922753806 23 Left 922753787 1:228083038-228083060 CCTGTCCCTGCCCCCGCCCGTCG 0: 1
1: 0
2: 0
3: 61
4: 571
Right 922753806 1:228083084-228083106 GGCTCTTCTCCAGGAAACCTGGG 0: 1
1: 0
2: 0
3: 20
4: 205
922753793_922753806 11 Left 922753793 1:228083050-228083072 CCCGCCCGTCGCCCGGAAGTCCG 0: 1
1: 0
2: 0
3: 4
4: 39
Right 922753806 1:228083084-228083106 GGCTCTTCTCCAGGAAACCTGGG 0: 1
1: 0
2: 0
3: 20
4: 205
922753791_922753806 13 Left 922753791 1:228083048-228083070 CCCCCGCCCGTCGCCCGGAAGTC 0: 1
1: 0
2: 0
3: 7
4: 77
Right 922753806 1:228083084-228083106 GGCTCTTCTCCAGGAAACCTGGG 0: 1
1: 0
2: 0
3: 20
4: 205
922753802_922753806 -9 Left 922753802 1:228083070-228083092 CCGCTTGGACGCCGGGCTCTTCT 0: 1
1: 0
2: 0
3: 7
4: 86
Right 922753806 1:228083084-228083106 GGCTCTTCTCCAGGAAACCTGGG 0: 1
1: 0
2: 0
3: 20
4: 205
922753796_922753806 6 Left 922753796 1:228083055-228083077 CCGTCGCCCGGAAGTCCGCTTGG 0: 1
1: 0
2: 0
3: 2
4: 38
Right 922753806 1:228083084-228083106 GGCTCTTCTCCAGGAAACCTGGG 0: 1
1: 0
2: 0
3: 20
4: 205
922753794_922753806 10 Left 922753794 1:228083051-228083073 CCGCCCGTCGCCCGGAAGTCCGC 0: 1
1: 0
2: 0
3: 1
4: 44
Right 922753806 1:228083084-228083106 GGCTCTTCTCCAGGAAACCTGGG 0: 1
1: 0
2: 0
3: 20
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922753806 Original CRISPR GGCTCTTCTCCAGGAAACCT GGG Intronic
900118790 1:1039950-1039972 TGCACTTCTCCAGGGAAGCTGGG + Intronic
900374772 1:2348472-2348494 GCCGCTTCTCCAGGGAACCCCGG + Intronic
900727623 1:4228192-4228214 GGAGGTTCTCCAGGGAACCTTGG - Intergenic
902685387 1:18073391-18073413 GGGTCTTCACCAGGAAGGCTGGG - Intergenic
906022886 1:42646642-42646664 GGCTCATGCCCAGGAGACCTGGG - Intronic
906095764 1:43223004-43223026 GGCTGTTCTCCAAGAGACCTAGG + Intronic
906567984 1:46814081-46814103 GGCTCACCTCTAGGAAGCCTGGG + Intronic
906718154 1:47985636-47985658 GGCTCTTTTCCAGTAAAGCCAGG + Intronic
907224054 1:52928133-52928155 GGATCTTCTCCAGGACGCCTCGG + Intronic
907735684 1:57109440-57109462 GGCTCTCTTCCAGAAAAGCTGGG + Intronic
910273273 1:85420144-85420166 GGGTCTGTCCCAGGAAACCTAGG + Intronic
911168477 1:94745926-94745948 GGCTCATATCCAGGAGTCCTTGG - Intergenic
913186000 1:116371770-116371792 GGCTCTTCTCCAGGCAGTCAGGG + Intergenic
915666598 1:157450703-157450725 AGCTCTGCCCCAGGAAACCCTGG + Intergenic
916746335 1:167687650-167687672 GGCTCTAATGCTGGAAACCTTGG + Intronic
917649313 1:177061142-177061164 GGGTCTTGTCCAGGAAGGCTTGG + Exonic
917929828 1:179815526-179815548 GGCTCATCGCCAGGAAACTGGGG - Exonic
919956107 1:202417874-202417896 GGCTCTCCCTTAGGAAACCTGGG - Intronic
920118236 1:203636406-203636428 CTCTCTTCTCCTGGAAACCCTGG + Intronic
922753806 1:228083084-228083106 GGCTCTTCTCCAGGAAACCTGGG + Intronic
922934059 1:229410343-229410365 GCCTCTTCTCCACCAAACCCAGG + Intergenic
1064324141 10:14333136-14333158 GGCTATTTTCCAGAAAATCTGGG - Intronic
1064504524 10:16014398-16014420 GGATTTTCTCCATGAAACCAAGG + Intergenic
1064561572 10:16599470-16599492 GACTGTTCTCCAGGAATCCCTGG - Intronic
1064812314 10:19214251-19214273 GGCTCTTCTCCTGGAGTACTGGG + Intronic
1067027749 10:42858946-42858968 GGATCTTCTACAGGAAAGCAGGG - Intergenic
1068610751 10:59057432-59057454 GGATCTTCTCCCAGAATCCTTGG + Intergenic
1069811294 10:71161896-71161918 TGCTCTTCTCCAGAAATCCCAGG + Intergenic
1069840252 10:71335355-71335377 GGCTCCTTTGCCGGAAACCTTGG - Intronic
1070931436 10:80263892-80263914 TCCCCTTCTCCAGGAAGCCTGGG - Intergenic
1071291570 10:84193129-84193151 ACATCTACTCCAGGAAACCTTGG + Intergenic
1071689701 10:87803990-87804012 GACTCAGCTCCAGTAAACCTTGG + Intronic
1071901534 10:90125549-90125571 GGCTCTTTTACAGGAAACACTGG + Intergenic
1072291373 10:93968776-93968798 GGCTATTCTCCAGGAGACAGAGG + Intergenic
1073681086 10:105704101-105704123 GGTACTTCTCCAGGTACCCTAGG - Intergenic
1076128183 10:127992526-127992548 GCCTCTTCACCAGGGAAGCTCGG - Intronic
1077391579 11:2302912-2302934 GGTTCTTCTCCAGGGACGCTCGG - Exonic
1078483751 11:11703344-11703366 GCATCTTTTCCAGGAAATCTGGG - Intergenic
1079153564 11:17923431-17923453 GGAAATGCTCCAGGAAACCTAGG + Intronic
1084939019 11:72602434-72602456 GGTGCTACTCCAGGAAACCCTGG - Intronic
1085744340 11:79101827-79101849 GATTCTGTTCCAGGAAACCTTGG - Intronic
1087113049 11:94492833-94492855 GGTTCTTCTCCAAGAACCCCTGG + Exonic
1087234114 11:95699098-95699120 AGCTATTCTGCAGGAAAGCTGGG + Intergenic
1091823765 12:3494185-3494207 GGCTCTGTACCAGGAAAGCTAGG + Intronic
1091857303 12:3750240-3750262 GGCTATTTTACAGGAAACCCTGG + Intronic
1093773533 12:23045821-23045843 TGCTTTTCTCAAGGTAACCTTGG + Intergenic
1094449769 12:30572252-30572274 GCCAGTGCTCCAGGAAACCTGGG - Intergenic
1096665388 12:53160762-53160784 ACTTCTTCTCCAGGATACCTCGG - Exonic
1097295140 12:57954787-57954809 CTCTCTTCTCCAGAAAACCAAGG - Intronic
1099936981 12:89138019-89138041 GAATGTTCTGCAGGAAACCTAGG + Intergenic
1102858499 12:116315338-116315360 GTGTCTTCTCCAGGAATCCTTGG + Intergenic
1104134680 12:125925875-125925897 GGCTCTTGTCTCTGAAACCTAGG + Intergenic
1104642276 12:130475131-130475153 GGCTCTCCTCCCGGAATCCAGGG - Intronic
1104955660 12:132464731-132464753 GGCGGTTCTCCAGGAGCCCTAGG - Intergenic
1107655851 13:42591475-42591497 GGCTCTGCTCTACGGAACCTAGG + Intronic
1113592788 13:111512716-111512738 GGCTGCTGTCCAGGAATCCTGGG + Intergenic
1113626796 13:111853726-111853748 GTCTCTTCTCCAGTAATCCTGGG - Intergenic
1114410973 14:22500275-22500297 TGCTCTGCTCCAGGAAAACTAGG + Intergenic
1115137357 14:30127097-30127119 GGATATTATCCAGGAAATCTTGG - Intronic
1116779549 14:49221552-49221574 GGCTCTCTTCCATGAAAACTTGG + Intergenic
1121352225 14:93183204-93183226 GGCCCTTCTCCAGGCAATATTGG - Exonic
1122191133 14:100044668-100044690 TGGTCTTCTCCAAGAACCCTGGG - Intronic
1122878571 14:104679771-104679793 GGCTCTTCTCTAGGGGATCTTGG + Intergenic
1123056243 14:105572034-105572056 GCCCCTTCTCCAGGAGCCCTGGG - Intergenic
1123057690 14:105579773-105579795 GCCCCTTCTCCAGGAGCCCTGGG + Intergenic
1123080672 14:105692162-105692184 GCCCCTTCTCCAGGAGCCCTGGG - Intergenic
1123081969 14:105699706-105699728 GCCCCTTCTCCAGGAGCCCTGGG + Intergenic
1123427397 15:20183775-20183797 GGATCTTCTACAGGAAAGCAGGG - Intergenic
1123536633 15:21190325-21190347 GGATCTTCTACAGGAAAGCAGGG - Intergenic
1127059986 15:55172520-55172542 GGCTCATCTCCAGAAAAGCTGGG - Intergenic
1127500503 15:59549986-59550008 GGCTCATCTACATAAAACCTAGG - Intergenic
1128886092 15:71289487-71289509 GGCTCTGCTTCAGGGAACCCAGG + Intronic
1128889595 15:71318778-71318800 GACTCTTCTTCAGGTAACCTGGG - Intronic
1129064618 15:72890380-72890402 GGCCCTTCTGCAGGAGTCCTTGG + Intergenic
1129190331 15:73933800-73933822 TGCTCTTCTGCAGGAATGCTGGG - Intronic
1129877987 15:78989322-78989344 AGTTCTTCCCCAGGAAAGCTGGG + Intronic
1130928718 15:88404869-88404891 CTCTCTCCTCCAGGAAACCCGGG - Intergenic
1131295146 15:91141353-91141375 TGCTCTTCTTCAGGAAGACTTGG + Intronic
1132409099 15:101563020-101563042 TGTTCTTCTCCAGGAGACCATGG + Intergenic
1134519159 16:14910907-14910929 CTCTCTTAGCCAGGAAACCTGGG + Intronic
1134554769 16:15155319-15155341 CTCTCTTAGCCAGGAAACCTGGG - Intergenic
1134706829 16:16309562-16309584 CTCTCTTAGCCAGGAAACCTGGG + Intergenic
1134863007 16:17577752-17577774 ACCCCTTCTCCAGGAGACCTGGG + Intergenic
1134960711 16:18402562-18402584 CTCTCTTAGCCAGGAAACCTGGG - Intergenic
1136856892 16:33666034-33666056 GGATCTTCTACAGGAAAGCAGGG + Intergenic
1137255665 16:46773327-46773349 TGCTCTTCATCAGGAAACCTGGG - Intronic
1137491287 16:48935171-48935193 GGCTTTTCTAAAGGAAAACTTGG - Intergenic
1137710555 16:50563840-50563862 GGGTCTTCTCCATGAATCCAGGG - Intronic
1138373188 16:56543506-56543528 GGCTGGTCTCCAAGAAATCTTGG + Intergenic
1141572085 16:84940455-84940477 CCCTCTTCTCCAGGAGGCCTTGG - Intergenic
1203118467 16_KI270728v1_random:1514509-1514531 GGATCTTCTACAGGAAAGCAGGG + Intergenic
1143338666 17:6192267-6192289 GGCTCTGCTTTAGGAAGCCTCGG + Intergenic
1143610575 17:8015556-8015578 GCCTCCTCTACAGGAAATCTGGG - Intronic
1144773275 17:17771144-17771166 GGCCCTTCTTCATGACACCTGGG - Intronic
1144810002 17:17992964-17992986 GCCCCTTTTCCAAGAAACCTGGG - Intronic
1148220886 17:45860978-45861000 CCCTCTTCTCCAGGAACCCATGG + Intergenic
1150076123 17:62193550-62193572 AATTCTTCTACAGGAAACCTCGG + Intergenic
1151315431 17:73318988-73319010 GGCTGTTCTCCAGCAGAGCTGGG - Intergenic
1151425302 17:74027242-74027264 GGCTCTTCTCCAGGAACAGGGGG + Intergenic
1151564616 17:74890930-74890952 TCCTCTTCTCCAGCAAGCCTGGG + Intronic
1153438840 18:5094876-5094898 CTTTCTTCTCCAGGAAACCTTGG - Intergenic
1153730490 18:8006590-8006612 GCCCTTTCTCCAGGAAACCATGG + Intronic
1154036731 18:10810525-10810547 GGCTTTTCTCCAGGAAATGGGGG - Intronic
1156602908 18:38631128-38631150 GGCACTTCTCAAGGAAAGCTGGG - Intergenic
1157280645 18:46344577-46344599 GGCCCTTCCCCAGGGGACCTTGG + Intronic
1158194260 18:54866794-54866816 GGGTTTTCTCCAGGACACCGAGG - Intronic
1160220863 18:76976688-76976710 GGCTCTTATCCAGTAAGACTGGG + Intergenic
1163287330 19:16357008-16357030 GGCTCTTCCCCAGGCACCCTTGG + Intronic
1164920838 19:32087495-32087517 GCCTCTTCTTCAGGAATTCTGGG + Intergenic
1166090215 19:40503652-40503674 GGCTGGTCTCCAGGTTACCTGGG + Intronic
1166090225 19:40503691-40503713 GGCTGGTCTCCAGGATAACTAGG + Intronic
1167313585 19:48751450-48751472 GGCTCTCATCCCTGAAACCTAGG - Intronic
1168577803 19:57527687-57527709 GCCTCTTCTCCAGGACAGCGAGG + Intronic
925368697 2:3328334-3328356 GGCTCTGATCCAGGGAACCCAGG - Intronic
925531808 2:4871773-4871795 TGTTCTTCTCCAGGAAACTCTGG - Intergenic
925589551 2:5495834-5495856 GGCTCTTCTCCGCGCTACCTGGG + Intergenic
928376463 2:30778656-30778678 GCATCTCTTCCAGGAAACCTGGG - Intronic
930225653 2:48789953-48789975 CCCTCTTCTACAGGAAAGCTGGG - Intergenic
930319066 2:49831603-49831625 GTCTATTTTCTAGGAAACCTGGG - Intergenic
931682202 2:64760342-64760364 GGCAATTCTCCAGCAAACTTTGG + Intergenic
932126442 2:69149312-69149334 GGCTTTTCTCCAGCCAAGCTTGG - Intronic
933208107 2:79533007-79533029 GGCTCTTCTTCAGGGCACCTTGG + Intronic
933770380 2:85740332-85740354 GGCAATTCTCCAAGAAGCCTTGG - Intergenic
934578077 2:95415649-95415671 GGCTCTTCCCCAGCTTACCTGGG - Exonic
938238373 2:129724134-129724156 TGCTCTGCTCCAGGCAAGCTGGG + Intergenic
940027518 2:149224242-149224264 GCCTCTGCTCCAGGAAACTGTGG + Intergenic
943050665 2:182909678-182909700 ATATCTTCTCAAGGAAACCTTGG - Intronic
946014812 2:216595320-216595342 GGCTCTGCTGGAGTAAACCTAGG - Intergenic
947332752 2:229047261-229047283 GGATCATCTCAAGGGAACCTGGG - Intronic
948826915 2:240577379-240577401 GCCCCATCTCCAGGGAACCTGGG - Intronic
1174756404 20:53162702-53162724 GGCTATGCTCCAGGAAAAGTGGG + Intronic
1175486513 20:59350738-59350760 GACTCTGGTCCAGGAAGCCTTGG + Intergenic
1176072122 20:63232737-63232759 TGCTCTACTCCATGAAGCCTGGG - Intergenic
1177937132 21:27362809-27362831 GCCTCTTCTCCACAATACCTAGG - Intergenic
1178277500 21:31252243-31252265 GGCTCTTCTCCACGTGACCCTGG - Intronic
1179419188 21:41222430-41222452 GGCTCTTCCCCAGGATACCCAGG - Intronic
1181117591 22:20642731-20642753 TGCTCCTCTCCAAAAAACCTGGG - Intergenic
1182489662 22:30662957-30662979 GGCAGTGCTCCAGGAATCCTGGG - Exonic
1182609295 22:31533149-31533171 AGTTATTCTTCAGGAAACCTGGG - Intronic
1184773655 22:46612586-46612608 AGCCCATCTCCAGGGAACCTGGG - Intronic
951454953 3:22880733-22880755 GACATTTCTCCAAGAAACCTTGG - Intergenic
954637845 3:52081092-52081114 GGCCCTTCTCAAGAAAGCCTTGG + Intronic
954856714 3:53650090-53650112 TGCACTTTCCCAGGAAACCTAGG - Intronic
956146438 3:66195361-66195383 TGCTGTTCTCCAGGAACCCGCGG + Intronic
959487116 3:106939631-106939653 GGCTCTTCTGCTGGAGTCCTAGG - Intergenic
962456365 3:135568809-135568831 GGCCTTTCTCCAGTTAACCTAGG - Intergenic
962807406 3:138937294-138937316 GGCTCTTCGCCAGGCTTCCTGGG - Intergenic
964819960 3:160757556-160757578 GCCTAACCTCCAGGAAACCTGGG - Intronic
965797991 3:172461391-172461413 GGATGTTCTCCAACAAACCTAGG - Intergenic
967368442 3:188714977-188714999 AGCTCATCTACAGGAAGCCTTGG + Intronic
969279396 4:6159946-6159968 GGCTTTTCTCCATGAAAAATGGG - Intronic
969497049 4:7532152-7532174 GGCTCTTCTCACGGAACCCACGG - Intronic
970661282 4:18288353-18288375 CACCCTTCTGCAGGAAACCTTGG - Intergenic
970671080 4:18397442-18397464 GGCTTGTCATCAGGAAACCTGGG - Intergenic
972227678 4:37032690-37032712 GGCTCTGCTCCATGAAATCTTGG + Intergenic
972539636 4:40028150-40028172 GGGTCTTCTCCAACAAAGCTTGG + Intergenic
973113496 4:46425443-46425465 GCATGTTCTTCAGGAAACCTAGG - Intronic
978377101 4:108085939-108085961 GGCTCCTCTGCAGAAAACCATGG - Intronic
984715689 4:182922753-182922775 GGCTCGGCTCCAGGAGCCCTTGG - Intergenic
984875357 4:184363103-184363125 GGCTCTTCTCCATGATGTCTGGG + Intergenic
985141390 4:186843623-186843645 GGCTATTCTGCAGCAACCCTGGG - Intergenic
987320182 5:16761510-16761532 TGTTCTTCTCCAAGATACCTCGG + Exonic
987475201 5:18383238-18383260 GGCTCTTCTCCAGGCAAACGGGG + Intergenic
988400816 5:30757868-30757890 GACTGTTCTCCTGGGAACCTGGG + Intergenic
990308430 5:54516468-54516490 GACCCTTTTCAAGGAAACCTGGG - Intergenic
990597674 5:57327735-57327757 TGCTCTTCTCCTGGGAACCTAGG - Intergenic
992122508 5:73609136-73609158 GGCCCTTCTGCAGGAAAATTTGG - Intergenic
992320494 5:75608792-75608814 GGCTCTCCACCAGGAAACAGTGG + Intergenic
992601119 5:78401167-78401189 GGATTTTCTCCAGGTATCCTAGG - Intronic
992857751 5:80880592-80880614 GCCTCTTCTCCACGAAATCATGG + Intergenic
994580632 5:101637416-101637438 GACTGTTCTCCAGGTAGCCTTGG + Intergenic
998306028 5:141078084-141078106 GGAGCTACTCCAGGAATCCTGGG - Intergenic
998395667 5:141816392-141816414 GTCTGTTCACCAGGTAACCTTGG - Intergenic
999148649 5:149412385-149412407 GGCTCTTCTGCAAGAACCCCCGG + Intergenic
1003425568 6:5996284-5996306 GGTTCTTCTCTAGGAACCCCTGG - Intergenic
1003812459 6:9800116-9800138 CGCTATTTTCCTGGAAACCTGGG + Intronic
1003984341 6:11419993-11420015 GGGTCTGCTCCAGCAAACCCAGG + Intergenic
1006380875 6:33696396-33696418 AACTCTTCCCCAGGAAGCCTGGG - Exonic
1006864132 6:37194837-37194859 ACCACTTCTCCAAGAAACCTTGG + Intergenic
1008968835 6:57343066-57343088 GGCTTTTCTCCAGTTAACATTGG + Intronic
1011247222 6:85332139-85332161 GGCTCTTCTCCAAGCAGCCTGGG + Intergenic
1011808157 6:91096974-91096996 GGCTGTTCCCCAGGAAACACAGG - Intergenic
1014265318 6:119270165-119270187 GTCTCTTCTCCAAGAAGCCCTGG + Intronic
1015633904 6:135257230-135257252 GCCTCTCCTCCAGAAAAGCTAGG - Intergenic
1016743986 6:147558639-147558661 GGCTCTTCTGCAGGTAGCTTTGG + Intronic
1018062111 6:160098284-160098306 GAAGATTCTCCAGGAAACCTCGG + Intronic
1019909477 7:4090668-4090690 GCCATTTCTCCAGGGAACCTTGG + Intronic
1022014277 7:26335583-26335605 GGCTCTTCCCCAGCAGATCTGGG + Intronic
1022287363 7:28966666-28966688 AGCCCTTCTCCAGGCCACCTGGG + Intergenic
1023362322 7:39429592-39429614 GGCTGCTCTGCAGGAATCCTCGG + Intronic
1026649991 7:72208858-72208880 GGCTGCTCTCCAGGAAGGCTGGG + Intronic
1027180841 7:75938258-75938280 GAATGTTCTCCAGGATACCTTGG + Intronic
1032075889 7:128836019-128836041 GGCTCTTCTCTGGGAGACCCTGG + Intronic
1033726341 7:144122703-144122725 GGCTCTCCTCTAGGGAAACTAGG + Intergenic
1034348698 7:150402963-150402985 TGCTGTTCTCCAGGACGCCTTGG + Intronic
1035950207 8:4011518-4011540 GGGCCTTCTGCAGGAAACCCAGG - Intronic
1037322424 8:17656608-17656630 GGATCTTCTCTTAGAAACCTGGG - Intronic
1039921634 8:41897314-41897336 GGCTCTTCCCCAGGGAGCCCCGG - Intergenic
1042404108 8:68383799-68383821 GGCTATTCTCCTGGACACATTGG - Intronic
1043533459 8:81175226-81175248 GTCTCTTGTCCAGGATAACTTGG + Intergenic
1047632672 8:126725462-126725484 GCCTCTTCTCCAGACAACTTAGG + Intergenic
1048300583 8:133248402-133248424 GGCTTTGCTCCATGAAGCCTAGG - Intronic
1048954926 8:139527859-139527881 GCCTCATCTCCAGTAAACCAAGG - Intergenic
1049191457 8:141290270-141290292 GGCTCCTCTCCAGGACTCCTCGG + Intronic
1050947064 9:11537760-11537782 GGGTCTTCTCCAAGAAACTTTGG - Intergenic
1052795959 9:32923698-32923720 GGCTCTTAGCCAGGATGCCTGGG + Intergenic
1053100677 9:35369774-35369796 GGCTTTTCTTCAGGAGGCCTAGG + Intronic
1053434381 9:38065874-38065896 GGTTCTTCTCCAGCCAACCATGG + Intronic
1054675577 9:67853682-67853704 GGCTCTTCTGTTAGAAACCTGGG + Intergenic
1058163621 9:101595820-101595842 GGCTATTCTGCAGAATACCTTGG + Intronic
1059421105 9:114192966-114192988 GGCTCCTTGCCTGGAAACCTGGG + Intronic
1061137131 9:128741414-128741436 TGCCCTTCTCCAGGAAGCATGGG + Intronic
1061515897 9:131090342-131090364 GCCCCTTCTCCAGGAGCCCTAGG + Intronic
1062617355 9:137403826-137403848 GGCTCTTCACCAGGAAATGAAGG + Intronic
1185451295 X:281717-281739 GTCTCTTCTCCAGGAGGCCGGGG + Intronic
1185794296 X:2951563-2951585 GGCTGGTCTCCAGCAATCCTGGG - Intronic
1188615143 X:32149165-32149187 GGCTCGTCACGAGAAAACCTTGG - Intronic
1189143430 X:38630773-38630795 GGATCTTCTCAAGGCAACTTGGG - Intronic
1190844993 X:54183159-54183181 AGCGCTTCTCCAGGAACTCTTGG + Exonic
1190933989 X:54977736-54977758 GCCTCTTCTCCAAGAAACCATGG - Intronic
1193085892 X:77447764-77447786 GGCGCTCGTTCAGGAAACCTGGG - Exonic
1195366849 X:104134919-104134941 GGCTCTTATGCAAGGAACCTTGG - Intronic
1199240262 X:145539969-145539991 CCTTCTTCTCCAGGAAACATTGG - Intergenic
1199895690 X:152125624-152125646 ATTCCTTCTCCAGGAAACCTCGG - Intergenic
1200233261 X:154456373-154456395 TCTGCTTCTCCAGGAAACCTCGG + Intergenic
1202578495 Y:26353309-26353331 GGCTCTCCCTTAGGAAACCTGGG + Intergenic