ID: 922753809

View in Genome Browser
Species Human (GRCh38)
Location 1:228083110-228083132
Sequence AAGGCAGAGGCGAGGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 780
Summary {0: 1, 1: 0, 2: 4, 3: 58, 4: 717}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922753809_922753824 23 Left 922753809 1:228083110-228083132 CCTGCTTCCCTCGCCTCTGCCTT 0: 1
1: 0
2: 4
3: 58
4: 717
Right 922753824 1:228083156-228083178 GCGTGGACGGTTGGGATTAGCGG 0: 1
1: 0
2: 0
3: 0
4: 48
922753809_922753825 29 Left 922753809 1:228083110-228083132 CCTGCTTCCCTCGCCTCTGCCTT 0: 1
1: 0
2: 4
3: 58
4: 717
Right 922753825 1:228083162-228083184 ACGGTTGGGATTAGCGGCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 24
922753809_922753819 14 Left 922753809 1:228083110-228083132 CCTGCTTCCCTCGCCTCTGCCTT 0: 1
1: 0
2: 4
3: 58
4: 717
Right 922753819 1:228083147-228083169 GCCGCCCGCGCGTGGACGGTTGG 0: 1
1: 0
2: 1
3: 2
4: 37
922753809_922753826 30 Left 922753809 1:228083110-228083132 CCTGCTTCCCTCGCCTCTGCCTT 0: 1
1: 0
2: 4
3: 58
4: 717
Right 922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 25
922753809_922753821 15 Left 922753809 1:228083110-228083132 CCTGCTTCCCTCGCCTCTGCCTT 0: 1
1: 0
2: 4
3: 58
4: 717
Right 922753821 1:228083148-228083170 CCGCCCGCGCGTGGACGGTTGGG 0: 1
1: 0
2: 0
3: 1
4: 30
922753809_922753813 -8 Left 922753809 1:228083110-228083132 CCTGCTTCCCTCGCCTCTGCCTT 0: 1
1: 0
2: 4
3: 58
4: 717
Right 922753813 1:228083125-228083147 TCTGCCTTTCTCGTTTCCCGAGG 0: 1
1: 0
2: 0
3: 13
4: 120
922753809_922753815 6 Left 922753809 1:228083110-228083132 CCTGCTTCCCTCGCCTCTGCCTT 0: 1
1: 0
2: 4
3: 58
4: 717
Right 922753815 1:228083139-228083161 TTCCCGAGGCCGCCCGCGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 82
922753809_922753818 10 Left 922753809 1:228083110-228083132 CCTGCTTCCCTCGCCTCTGCCTT 0: 1
1: 0
2: 4
3: 58
4: 717
Right 922753818 1:228083143-228083165 CGAGGCCGCCCGCGCGTGGACGG 0: 1
1: 0
2: 0
3: 6
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922753809 Original CRISPR AAGGCAGAGGCGAGGGAAGC AGG (reversed) Intronic
900352306 1:2241022-2241044 ATGGCAGAGGCCAGGGATGTGGG - Intronic
900356797 1:2268852-2268874 AAGGCAGAAGGGAGGGAGGGAGG - Intronic
900422434 1:2561398-2561420 GAGGGAGAGGGGAGAGAAGCGGG - Intronic
900527919 1:3138152-3138174 AAGGAAATGGCAAGGGAAGCAGG - Intronic
900719605 1:4166756-4166778 AAGGAAGAGTCCAGGGAAGCTGG - Intergenic
900932906 1:5747861-5747883 AAGGGAAAGGGGAGGGAGGCAGG + Intergenic
900957861 1:5898592-5898614 ATGGCAAAGGCCTGGGAAGCTGG + Intronic
901055986 1:6448828-6448850 AGGGCCGAGGCGCGGGCAGCCGG - Exonic
901182628 1:7352125-7352147 AAGGAGGAGGAGAAGGAAGCAGG + Intronic
901496311 1:9624398-9624420 AAGGCAGAGGACAGGGAACCTGG - Intergenic
901651570 1:10746144-10746166 AAGGCAGAGGCCTGGACAGCGGG - Intronic
901752850 1:11422123-11422145 ATGGCAGAGGGGTGGGAGGCAGG - Intergenic
901882840 1:12204160-12204182 AAGACAGAGGCCAGGGACACGGG - Intronic
902359141 1:15932562-15932584 CAGGCAGGGGAGAGGGAATCTGG + Exonic
902409952 1:16206735-16206757 GAGCGAGAGGCGAGGGGAGCCGG - Intronic
902478407 1:16699811-16699833 AGGGCCGAGGCGCGGGCAGCCGG + Intergenic
903176444 1:21584301-21584323 AAGGAAGAGGCGTGGGAGACTGG + Intergenic
903573540 1:24323424-24323446 CAGGCAGAGGACTGGGAAGCAGG + Intronic
903889906 1:26562477-26562499 AAGGCAGAGGAAATGGATGCAGG + Intronic
904016576 1:27425933-27425955 AACGCAGAGGCGAAGGCTGCAGG + Intronic
904932362 1:34099473-34099495 AAGGCAGAGGTCTGGGATGCTGG - Intronic
905215887 1:36407218-36407240 AAGGCAGAGGCGAGAGTGTCGGG - Intergenic
905885569 1:41489971-41489993 AAGGCAGATGGGAGGAAAGGTGG - Intergenic
906413214 1:45596752-45596774 GAGGCTGAGGCGAGAGAATCAGG + Intronic
906642981 1:47452584-47452606 AGGGCAGAGGCGGGAGAAGAAGG + Intergenic
906708724 1:47913673-47913695 AAGGAAGGGAAGAGGGAAGCAGG - Intronic
906911112 1:49951942-49951964 AAGGAAGAAGCGAGGGAAGGAGG + Intronic
906929643 1:50156458-50156480 AAGGGGGAGGAGAGGGAAGGTGG + Intronic
907076672 1:51585223-51585245 AAGGCAGTGGGGTGGGTAGCAGG + Intronic
907237834 1:53063486-53063508 AAGGCAGCGGCGAGGCAGGAGGG + Intronic
907444221 1:54497744-54497766 ACAGCAGAGGCCAGGGCAGCTGG - Intergenic
908320395 1:62972804-62972826 AAGGAGGAGGAGAGGGAAGGAGG + Intergenic
909925098 1:81429585-81429607 AGGGCAGAACCGAAGGAAGCAGG - Intronic
911566842 1:99472308-99472330 AAGGTAGAGGGCAGGGAGGCAGG + Intergenic
913267999 1:117063999-117064021 AGGGCAGAAGGGAGGGAAGGGGG - Intronic
913562394 1:120034905-120034927 AGGACAGAGGCCAGGGAGGCAGG + Intronic
913578482 1:120201350-120201372 AAAGCAGAGGGGCGGGAAGGAGG - Intergenic
913629690 1:120697001-120697023 AAAGCAGAGGGGCGGGAAGGAGG + Intergenic
913635730 1:120758702-120758724 AGGACAGAGGCCAGGGAGGCAGG - Intergenic
914282982 1:146194286-146194308 AGGACAGAGGCCAGGGAGGCAGG + Intronic
914334478 1:146701978-146702000 AGGGCAGAGCCGAGGGATGATGG - Intergenic
914544012 1:148645004-148645026 AGGACAGAGGCCAGGGAGGCAGG + Intronic
914560406 1:148812790-148812812 AAAGCAGAGGGGCGGGAAGGAGG - Intronic
914612427 1:149317425-149317447 AAAGCAGAGGGGCGGGAAGGAGG + Intergenic
914622612 1:149426006-149426028 AGGACAGAGGCCAGGGAGGCAGG - Intergenic
915087389 1:153397821-153397843 TGGGCCGAGGTGAGGGAAGCTGG - Intergenic
915199331 1:154215139-154215161 AAGGCTGAGGCAAGAGAGGCTGG - Intronic
915558440 1:156673109-156673131 AAGGGTGAGGGGAGGGAAGTTGG + Exonic
915970246 1:160349843-160349865 AAGGCAAAGGAAGGGGAAGCAGG - Intronic
916001538 1:160621187-160621209 CAGGCAGAGGCAATGGAGGCTGG + Intronic
917631345 1:176894159-176894181 AAGGGATCAGCGAGGGAAGCTGG + Intronic
918416776 1:184317466-184317488 AAAGGAGAGGGGAGGGAAGTAGG + Intergenic
918991395 1:191701187-191701209 AGGGCAAAGGAGAGGGAAGAGGG - Intergenic
919263271 1:195226440-195226462 AAGAAAGAAGGGAGGGAAGCAGG + Intergenic
920034280 1:203055904-203055926 AAGGAAGAGGTGAGGGCAGTGGG - Intronic
920834350 1:209494976-209494998 AAGCCAGAGGGGAGGGAAAGAGG + Intergenic
921902060 1:220461882-220461904 TATGCAGAGGTGAAGGAAGCAGG - Intergenic
922020582 1:221700170-221700192 AAGGGAGAGGGAAGGGAAGAGGG + Intergenic
922739573 1:228007548-228007570 AGGGGACAGGCGAGGGAAGAGGG + Intronic
922753809 1:228083110-228083132 AAGGCAGAGGCGAGGGAAGCAGG - Intronic
923603032 1:235420227-235420249 AGAGCAGAGGAGAGGGAACCTGG + Intronic
923849169 1:237774487-237774509 AATGCAGAGGCGAGTGAGCCTGG - Intronic
923990122 1:239426999-239427021 CAGGCAGAGGTGAGTGAAGGAGG + Intronic
924202588 1:241675128-241675150 AAGGAAGAAGGGAGGGAAGGAGG - Intronic
924603228 1:245509822-245509844 AAGGCACAGGTGAGGCAGGCTGG - Intronic
1062968107 10:1625883-1625905 CAGGCAGAGGCGTGAGAAGTGGG - Intronic
1063109231 10:3020344-3020366 AAGGCAGTGGCTAGGGGAGAGGG + Intergenic
1063391894 10:5655201-5655223 AAGGCAGAGGTGGGGGAAGGTGG - Intronic
1063487412 10:6432898-6432920 AAAGATGAGGGGAGGGAAGCAGG - Intronic
1063972193 10:11389027-11389049 GAGGCAGAGGTGGGGGAAGAGGG - Intergenic
1064571238 10:16695391-16695413 AAAGCAGAGCAGAGGGAAGGAGG + Intronic
1064694847 10:17954811-17954833 CATGCAGAGGCGAGGGAGGGAGG + Intronic
1064708182 10:18094670-18094692 AAGGCACATGAGAGGGAAGATGG + Intergenic
1064823948 10:19373545-19373567 AAGGAAGAGGAAAGGGAAGAAGG + Intronic
1065044773 10:21737336-21737358 AAAGCAGAGGAAGGGGAAGCAGG + Intronic
1065108596 10:22417054-22417076 TAGGCATAGGCAAGGAAAGCTGG + Exonic
1065245128 10:23748576-23748598 AAGGAAGGGGGGAGGGAAGATGG + Intronic
1065433415 10:25682582-25682604 AGGGCAGAGGCCAGGGCAGGTGG - Intergenic
1066671464 10:37844940-37844962 AAGGAAGGGGGGAGGGAAGGGGG - Intronic
1067406647 10:46030114-46030136 AAGCAAGAGGCGAGAGAAACAGG + Intronic
1067547058 10:47200031-47200053 GATACAGAGGGGAGGGAAGCTGG - Intergenic
1068412668 10:56677743-56677765 AAGGAAGAGGAGGAGGAAGCAGG + Intergenic
1069833890 10:71296734-71296756 CTGGCAGAGGTGAGGGAAGTCGG + Exonic
1069846302 10:71374211-71374233 AAGACAGAGGAGAGGGAAATAGG - Intergenic
1070140034 10:73732213-73732235 CTGGCAGAGGCTGGGGAAGCAGG - Intergenic
1070704685 10:78629161-78629183 GAGGCAGAGGAAGGGGAAGCGGG - Intergenic
1070976418 10:80609338-80609360 AAGGCAGAGGGGAAGGAAAGAGG - Intronic
1071940890 10:90590245-90590267 AGGTCAGAGTCGAGGGAAGAGGG - Intergenic
1072539652 10:96388693-96388715 AGGGCAGGGTAGAGGGAAGCTGG - Intronic
1072790819 10:98316429-98316451 CAGGCTGAGCTGAGGGAAGCAGG + Intergenic
1073072552 10:100803743-100803765 GAAGCAGAGGAGAGGGAAGTGGG - Intronic
1073123917 10:101137956-101137978 AAGGCAGAGTTGAGGAGAGCAGG + Intergenic
1073442172 10:103558763-103558785 ACGGCAGAGGCGAGAGGAGGGGG - Intronic
1073739674 10:106392564-106392586 AAGGCAGAGGGCAGGGGAGCTGG - Intergenic
1074883956 10:117680210-117680232 AGGACAGAGGCCAGGGATGCTGG + Intergenic
1075030684 10:119022867-119022889 TAGGCAGAGGGAGGGGAAGCGGG - Intergenic
1075582621 10:123633802-123633824 AAGGCAGAGGAGGGAGAAGAGGG + Intergenic
1075721680 10:124591148-124591170 AAAGCAGGGGTGAGGCAAGCGGG + Intronic
1075901059 10:126043154-126043176 AGGGCAGAGGGGAGGGACGTGGG + Intronic
1076019198 10:127056548-127056570 AAGGAAGAAGCTAGGGAAGAAGG - Intronic
1076474473 10:130742837-130742859 GAGGCAGAGGCTGGGGATGCAGG - Intergenic
1076478261 10:130767436-130767458 AAGGCTGAGGAGAGGGAGGGGGG - Intergenic
1076489931 10:130851888-130851910 AGGGGAGAGGGGAGGGAAACGGG - Intergenic
1076534312 10:131167153-131167175 CAGGCACAGGAGAGGGATGCCGG - Intronic
1076642927 10:131931108-131931130 AGGGGAGAGGAGAGGGATGCTGG - Intronic
1076840058 10:133041414-133041436 AAGGCAGAGTCCAGGAAGGCAGG + Intergenic
1076944715 10:133638005-133638027 TGGGCAGAGGCGAAGGAACCGGG + Intergenic
1078098516 11:8314949-8314971 AAGGCAGAGAAAAGGGAAGGTGG - Intergenic
1078897509 11:15609993-15610015 GAGGCAGGGGCGAGGGAGGAGGG + Intergenic
1079189310 11:18264744-18264766 AAGGGAGAGGGGAGGGGAGAGGG + Intergenic
1079239814 11:18714473-18714495 GAAGCAGAGGCCAGGGAAGGGGG - Intronic
1079355015 11:19723547-19723569 AGGGCCGAGACCAGGGAAGCAGG - Intronic
1079612948 11:22455917-22455939 AAGGAAGAAGGGAGGGAAGGAGG - Intergenic
1079817188 11:25076541-25076563 AAGGAAGAGAGGAGGGAAGGAGG + Intronic
1081597765 11:44471031-44471053 AGGGCAGAGGGGAGGCAGGCGGG - Intergenic
1081806974 11:45896184-45896206 AAGGCAGGGCCTATGGAAGCAGG - Intronic
1083396839 11:62398349-62398371 AAGGCTGAGGTGAGGGGAGCTGG - Intergenic
1083726879 11:64633097-64633119 ACGGCAGAGGGCAGGGAAGACGG - Intronic
1083989859 11:66240339-66240361 AAGGCCGAGGTGAGGAGAGCAGG + Intronic
1084088264 11:66864660-66864682 AAGGGCGAGGAGAGGGCAGCGGG + Intronic
1084593719 11:70105081-70105103 AGGGCAGAGACGAGGGAGGTCGG - Intronic
1084908673 11:72369575-72369597 AAGGCAGAGGAGAGGCAAGCAGG - Intronic
1084953272 11:72678329-72678351 AAGGAAGAGGAGGGGGAAGTCGG - Intergenic
1085017992 11:73187978-73188000 AAGGCAGAGCAGAGGAAAGTGGG + Intergenic
1086891168 11:92259857-92259879 AAGGAAGAGGAGATGAAAGCAGG - Intergenic
1086894736 11:92298895-92298917 GAGGCAGAGGCAGTGGAAGCTGG - Intergenic
1087007561 11:93484201-93484223 GAGGCAGAGAGGAGGAAAGCAGG + Intronic
1088650079 11:111949778-111949800 AGGGCAGAGGTGATGGAAGGAGG - Intronic
1089069746 11:115690081-115690103 AAGGCAGCAGCGAGGGAGGATGG + Intergenic
1089121104 11:116136000-116136022 AAGGCAGTGGCAGGGGAAGGGGG - Intergenic
1089661887 11:119991285-119991307 CAGGCAGAGGGAAGGGAAGTTGG + Intergenic
1090176492 11:124654366-124654388 AAGGCATCGGCGAGAGATGCTGG + Intronic
1090231678 11:125111525-125111547 GGGGCAGAGGTGAGGAAAGCGGG - Exonic
1090703502 11:129316369-129316391 AGGGCAAAGGGGATGGAAGCTGG - Intergenic
1091891116 12:4055368-4055390 AAGGGAGAGCAGGGGGAAGCTGG - Intergenic
1092194043 12:6538401-6538423 GGGGCAGAGGGGAGGGAAGCTGG + Intronic
1093372384 12:18380155-18380177 AAAGCAGAGGAGAGGCAAACTGG + Intronic
1094562976 12:31573107-31573129 AAGGCAGAGGTCAGGGAACAGGG + Intronic
1094809657 12:34124828-34124850 AAGGCAGAGGCCAAGGAAGAGGG - Intergenic
1095601562 12:44019071-44019093 TGGGCAGAGGCCAGGGAAGGAGG + Intronic
1095958308 12:47819077-47819099 CCGGCAGCGGCGCGGGAAGCGGG - Intronic
1095982641 12:47981842-47981864 CAGGTAGAGGTGAGGGAGGCAGG + Intronic
1096062862 12:48716690-48716712 AAGGCAGCGGCGAAGGCTGCAGG + Exonic
1096575695 12:52551517-52551539 GAGGCTGAGCCGAGGGCAGCAGG + Intronic
1096625488 12:52892880-52892902 AAGGCAGGGTGGAGGGAAGTGGG + Intergenic
1096670983 12:53198074-53198096 GAGGAAGAGGGGAGGGAATCAGG - Intronic
1096799680 12:54101901-54101923 AAGGCAGAGGAGGAGGAAGAAGG - Intergenic
1096944214 12:55386175-55386197 AAGGTAGAGGCCATGGAAGTGGG - Intergenic
1096997440 12:55847659-55847681 GAGGCAGTGGGCAGGGAAGCTGG + Intergenic
1098971785 12:76864688-76864710 AAAGAGGAGGGGAGGGAAGCAGG + Intronic
1101532664 12:105588211-105588233 AGGGCAGAGGTGAGTGAAGCTGG + Intergenic
1102167882 12:110820801-110820823 AAGGGAGAGGGGAGAGAAGGAGG - Intergenic
1102723044 12:115034413-115034435 AAGGTAGGGGCCAGGGAGGCCGG + Intergenic
1103360051 12:120348071-120348093 GAGACAGGGGCGAGGGGAGCAGG - Intronic
1104161059 12:126181540-126181562 AGGGCAGAGATGAGGGATGCAGG - Intergenic
1104269682 12:127271991-127272013 TAGGCAGTGTTGAGGGAAGCAGG - Intergenic
1104567282 12:129896357-129896379 AAAGGAGAGGCCAGGGCAGCAGG + Intronic
1104850716 12:131872223-131872245 AGAGCAGAGGCGTGGGGAGCAGG + Intergenic
1105847788 13:24308225-24308247 GGCGCAGAGGCGCGGGAAGCGGG + Intronic
1105928710 13:25032602-25032624 AGGAGAGAGGCGAGGGGAGCAGG - Intergenic
1107837401 13:44422994-44423016 TAGCCAGAGGCGAGGGAGGAGGG - Intergenic
1108299725 13:49061610-49061632 AAGGGAGAGGGGAGGGGAGAGGG - Intronic
1108842614 13:54638781-54638803 CAGGCAGAAGAGAGTGAAGCAGG + Intergenic
1110097399 13:71545528-71545550 AAGGAAGAAGGGAGGGAAGGAGG + Intronic
1111351568 13:87037396-87037418 AAGGGAGAGGAGAGTGAAACAGG - Intergenic
1111609491 13:90584771-90584793 AAAGCAGTGGGGAGGGAGGCTGG - Intergenic
1113085755 13:106567966-106567988 AAGGCGGAGGCGAGGGGAACTGG - Exonic
1114194021 14:20461361-20461383 ACGGCAGAGGCGAAGGGAGCCGG - Exonic
1114267281 14:21080436-21080458 AAGGCAGATGAGAGGGAAGCTGG - Intronic
1114378703 14:22177367-22177389 AAGACAGTGGGGAGGGAAGAGGG + Intergenic
1115303559 14:31912193-31912215 AAAGCAGAGGCAAGGGAATGAGG - Intergenic
1117963899 14:61188259-61188281 AGGGCAGAGGGGAGGGGAGGCGG + Intronic
1117989141 14:61416667-61416689 AAGGGACAGGAGAGAGAAGCAGG - Intronic
1118718365 14:68576218-68576240 AAGCTAGAGGCAAAGGAAGCTGG + Intronic
1118774810 14:68967128-68967150 AGGACAGGGGCCAGGGAAGCTGG - Intronic
1118900398 14:69981063-69981085 AAGGCAGAGCAGAAGGAGGCTGG + Intronic
1118915377 14:70098496-70098518 AAGGAAGAGGGCAGGGAAGCAGG + Intronic
1118982408 14:70727475-70727497 AAGGCAGAGGAAAGGGGGGCCGG + Intronic
1119104225 14:71908782-71908804 AAGCCAGAGGCGTGGTAGGCAGG - Intergenic
1119235424 14:73015362-73015384 AAGGAAGAGGGGAAGGAAGGGGG + Intronic
1119235434 14:73015386-73015408 AAGGAAGAGGGGAAGGAAGGGGG + Intronic
1119859104 14:77923882-77923904 CAGGGAGAGGGGAGGGGAGCAGG + Intronic
1119865034 14:77966298-77966320 CAGGCAAAGGGGAGGGAGGCAGG - Intergenic
1120738170 14:88078598-88078620 AGGGCAGAAGAGAGGGAAGAAGG - Intergenic
1120782845 14:88501585-88501607 AAGGCAGATGAGTGGGAAGGTGG + Intronic
1121406379 14:93721572-93721594 AAGGCAAAGGAGGGGGAGGCAGG + Intronic
1121800323 14:96769123-96769145 AAGGGAGAGGGGAGGGAAGAAGG - Intergenic
1122545544 14:102520151-102520173 AAGCCAGAGGCGTGGGGAGGGGG - Intergenic
1122580853 14:102770786-102770808 GAGGGAGAGGCCAGGGAAGGCGG - Intergenic
1122649800 14:103220280-103220302 AAGGGAGCCGCGTGGGAAGCGGG + Intergenic
1122741172 14:103872307-103872329 CAGGGAGGGGCGGGGGAAGCTGG - Intergenic
1122896214 14:104758459-104758481 AAGGTAAAGGCTAGGGAACCCGG - Intronic
1202918089 14_KI270723v1_random:3341-3363 TGGGCAGAGGCGAAGGAACCGGG + Intergenic
1202926536 14_KI270724v1_random:31245-31267 TGGGCAGAGGCGAAGGAACCGGG - Intergenic
1124869791 15:33529416-33529438 AATGCAGAGGAAAGGGAATCAGG - Intronic
1125550049 15:40538401-40538423 GAGGGAGAGGCGAGGGGTGCAGG - Intronic
1125673672 15:41491157-41491179 GAGGCTGAGGCTAGAGAAGCAGG + Intergenic
1126143396 15:45455310-45455332 AGACCAGAGGGGAGGGAAGCAGG - Intergenic
1126513616 15:49509048-49509070 AAGGAAGAGGCAAGGCAAGAAGG + Intronic
1127674666 15:61228400-61228422 AAGGAAGGGCCGAAGGAAGCGGG - Intronic
1127812132 15:62573582-62573604 CAGGGAGAGAGGAGGGAAGCTGG - Intronic
1128086979 15:64893474-64893496 AAAGGAGAGGCGAGGAAGGCTGG - Intronic
1128160590 15:65421179-65421201 CAGGGAGAGGCCAGGGAAGCTGG + Intronic
1128226614 15:66006176-66006198 AAGGAAGAGGAGAGGCAGGCTGG + Intronic
1128407179 15:67354623-67354645 AAGGAAGAGAAGAGGGAAGGAGG + Intronic
1128583588 15:68827407-68827429 AAAGAAGAAGCCAGGGAAGCTGG + Intronic
1128863176 15:71092066-71092088 AAGGCAGAGGAAAGTGAAGGTGG - Intergenic
1129158483 15:73733373-73733395 AGGGCAGAGGGGTGGGATGCTGG - Intergenic
1129301494 15:74628217-74628239 AAGGCAGAGGTCAGGGTAGCTGG + Intronic
1129463910 15:75713152-75713174 AAGGCAGAAAGGAGGGAAGTAGG - Intergenic
1129507003 15:76089731-76089753 AGGGCACAGGCGAGGGCAGAGGG + Intronic
1129559507 15:76551987-76552009 AAAGAACAGGAGAGGGAAGCTGG + Intronic
1129661291 15:77554440-77554462 AGGGCAGAGGAGAGGGACCCAGG + Intergenic
1130348149 15:83067372-83067394 AGGGCAGGGGCGTGGGGAGCTGG + Intergenic
1130537872 15:84799862-84799884 AAGGGAGGGCCGAGGAAAGCTGG - Exonic
1131123845 15:89841414-89841436 CAGGGAGAGGACAGGGAAGCTGG + Intronic
1131223819 15:90607652-90607674 AGGGCAGAGGCAGGGGACGCTGG - Intronic
1131368112 15:91856353-91856375 AAGGCAAAGACGAGGGCAGCCGG - Intronic
1131682403 15:94737653-94737675 ATGGCAGCGGCCAGAGAAGCAGG - Intergenic
1131714184 15:95090652-95090674 AAGGAAGAAGGGAGGGAAGGAGG - Intergenic
1131744711 15:95434813-95434835 AAGGAAGGGGGGAGGGAAGGAGG - Intergenic
1132247680 15:100310091-100310113 AACTCAGAGGCGAGCCAAGCAGG + Intronic
1132459338 16:42831-42853 AAGGAAGAGGCCAAGGAAGAGGG + Intergenic
1132708771 16:1257451-1257473 AAGGCAGGGGCCTGGGAATCGGG + Intronic
1132865941 16:2092794-2092816 TAGGCAGAGGGGAGGGACACAGG - Intronic
1132998738 16:2838565-2838587 AAGGCAGAGGAGTTGGAAGGAGG + Intronic
1133033507 16:3022562-3022584 AGGGCAGAGGCGCGGGATGCTGG - Intergenic
1133320205 16:4909060-4909082 CAGGCAGAGGCCAGGGAGGCAGG + Intronic
1133768366 16:8853365-8853387 AAGGCAGAGGCGGGAGAGGAGGG + Exonic
1133839540 16:9394891-9394913 GAGGGAGGGGAGAGGGAAGCAGG - Intergenic
1134058072 16:11182593-11182615 CAGGCTGGGCCGAGGGAAGCAGG + Intergenic
1134386378 16:13777327-13777349 CAGGCATAGGCTTGGGAAGCAGG - Intergenic
1134501490 16:14772398-14772420 GAGGCAGAGGCGTGGGCTGCTGG - Intronic
1134549547 16:15132555-15132577 AAGGCTGAGGCTACTGAAGCAGG + Intronic
1134610117 16:15601361-15601383 ATGGTAGAGCCGAGAGAAGCAGG - Intronic
1134718921 16:16370442-16370464 AAGGCTGAGGCTACTGAAGCAGG - Intergenic
1134835393 16:17356609-17356631 GAGGCAAAGGCCAGGGGAGCAGG + Intronic
1134955835 16:18381717-18381739 AAGGCTGAGGCTACTGAAGCAGG + Intergenic
1135130738 16:19851856-19851878 GAGGAAAAGGGGAGGGAAGCAGG - Intronic
1135202642 16:20451878-20451900 CAGGGAGAGACGAGGGCAGCTGG + Intronic
1135216461 16:20575988-20576010 CAGGGAGAGACGAGGGCAGCTGG - Intronic
1135615543 16:23908089-23908111 ATGGAAGAGGAGAGGGAAGTGGG + Intronic
1136377207 16:29872634-29872656 AAGGCAGAGGCTGGGGCAGGAGG - Intronic
1136516016 16:30768728-30768750 AAGGCCGAGGTGAGGGCAGCTGG + Exonic
1137013229 16:35344679-35344701 TGGGCAGAGGCGAAGGAACCGGG + Intergenic
1137764884 16:50970364-50970386 AAGCCAGAGGGTAAGGAAGCTGG + Intergenic
1138097891 16:54226945-54226967 AAGACAGAGACGTGGGGAGCTGG + Intergenic
1138195836 16:55051515-55051537 AAGGAAGTGGGGAGGGAAGGCGG + Intergenic
1139193832 16:64895467-64895489 GAGGCCGAGGCGAGCGAATCAGG - Intergenic
1139926936 16:70493892-70493914 AAGGCAGGGGTGAGGTAAGGAGG + Intronic
1139944181 16:70627461-70627483 AAAGAAGAGGGGAGGGAAGGGGG - Intronic
1139999143 16:71009254-71009276 AGGGCAGAGCCGAGGGATGATGG + Intronic
1140232288 16:73127284-73127306 CAGGCAGAGAAGAGGGAAGAAGG + Exonic
1140830369 16:78745298-78745320 AAGGCAGAGGTGGAGGAAGGCGG - Intronic
1141686914 16:85575464-85575486 AGGGGAGACGAGAGGGAAGCCGG - Intergenic
1141703743 16:85653751-85653773 AGGGCAGGGGCAAAGGAAGCTGG - Intronic
1141827247 16:86489181-86489203 CAGGCTGAGGCAAGGGCAGCAGG + Intergenic
1142069964 16:88086706-88086728 AAGGCAAAGGGAAGGGAAGTGGG - Intronic
1142402973 16:89870693-89870715 AAGGGAGAGCAGAGGCAAGCAGG - Exonic
1142741611 17:1934905-1934927 CAGGCAGAGGCTCGGGAGGCCGG - Exonic
1142875304 17:2848897-2848919 AAGACAGAGGAGGGGGAAGAGGG - Intronic
1142905800 17:3041016-3041038 ATGGCAGAAGCGTGGGATGCTGG - Intergenic
1143367937 17:6420577-6420599 AAGGCAGAGGGCACGGGAGCCGG + Intronic
1143587050 17:7855557-7855579 CAGGCAGAGGCGGCGGTAGCTGG - Exonic
1143672297 17:8405169-8405191 AAGGCAGAGGGGTTGGAGGCTGG + Intergenic
1143801516 17:9386534-9386556 AAGTCAGGAGGGAGGGAAGCAGG + Intronic
1143863721 17:9909154-9909176 AAGGCAGGTGCAAGGGAGGCGGG - Intergenic
1144370392 17:14584698-14584720 AAGGAAGAAGCGAGAGAAGGTGG + Intergenic
1144495402 17:15742206-15742228 AAGGCAGAGGCGCTGGGACCAGG + Intronic
1144536193 17:16094548-16094570 AGGGGAGAGGGGAGGGGAGCCGG - Intronic
1144798242 17:17907102-17907124 GAGGCAGAGGCCAGGGAGGAGGG + Intronic
1145046163 17:19618327-19618349 AAAGCGGAGGAGAGGGAAGAGGG + Intergenic
1145274105 17:21419939-21419961 AAGGCGGAGGCTGAGGAAGCCGG - Intergenic
1145283173 17:21483216-21483238 AAGGAAGAGGCAGGAGAAGCAGG - Intergenic
1145311967 17:21705838-21705860 AAGGCGGAGGCTGAGGAAGCCGG - Intergenic
1145808450 17:27750996-27751018 AAGGCAGAGGCAAGGGCAAGAGG - Intergenic
1145867416 17:28250123-28250145 AGGGCAGAGGTGAGAGAAGTGGG - Intergenic
1146313301 17:31787780-31787802 AAGGCAGAGGCTGGGGAAGAGGG + Intergenic
1146589139 17:34113203-34113225 AAGAGAGGGGCGAAGGAAGCTGG + Intronic
1146650413 17:34602860-34602882 AGGGCAGAAGCTGGGGAAGCAGG + Intronic
1146770932 17:35568126-35568148 GAAGCAAAGGAGAGGGAAGCTGG + Intergenic
1146978733 17:37139643-37139665 AAGGCAGAGGAGGAGAAAGCAGG + Intronic
1147685029 17:42282019-42282041 CAGGCAGAGGCCAGGGCAGCAGG + Intergenic
1148287854 17:46411632-46411654 AGGGCAGAGTGGAGGGAAACAGG + Intergenic
1148310023 17:46629212-46629234 AGGGCAGAGTGGAGGGAAACAGG + Intronic
1148338703 17:46860234-46860256 AAGGAGGAGAGGAGGGAAGCGGG + Intronic
1148684666 17:49494940-49494962 AAGCCAGAGGCGGAGGAAGATGG + Intergenic
1149145915 17:53492198-53492220 AAGGCAAAGCGGAAGGAAGCAGG + Intergenic
1149982317 17:61321170-61321192 AATGAAGAGGTAAGGGAAGCTGG - Intronic
1150984820 17:70184449-70184471 AAGGAAGAAGGGAGGGAAGGAGG - Intergenic
1151157002 17:72132050-72132072 AATGCAGAGGAGAGGGAGGAGGG + Intergenic
1151404104 17:73875800-73875822 GAGCCACAGGAGAGGGAAGCAGG - Intergenic
1151445505 17:74160950-74160972 AAGGAAGAAGGGAGTGAAGCAGG - Intergenic
1151956505 17:77382822-77382844 GAGGCAAAGGCGAGGGAGGAGGG + Intronic
1152070244 17:78130720-78130742 GAGGTAGTGGAGAGGGAAGCTGG + Intronic
1152145134 17:78563907-78563929 AAAGCGGAGGGGAGGGAGGCAGG - Intronic
1152207277 17:78980867-78980889 GGGGCAGAGCAGAGGGAAGCAGG + Intergenic
1152248379 17:79198255-79198277 AGGGCAGGGGCGAGGGCAGAGGG - Intronic
1152270061 17:79319309-79319331 AAGGAAGAGGCGAGGAAGGTAGG + Intronic
1152315621 17:79578750-79578772 AAGCCAGAGGTGTGGGTAGCTGG + Intergenic
1152468421 17:80477905-80477927 AACGCAGAGACCAGAGAAGCCGG - Intergenic
1152633124 17:81419585-81419607 AAGCCAGTGCCGAGGGAAGAGGG + Intronic
1153230301 18:2928709-2928731 AAGAGAGAGGGGAGGGAATCAGG + Intronic
1153911269 18:9708318-9708340 GGGGCAGAGGCGAGAGACGCCGG + Exonic
1153919681 18:9777236-9777258 AAGGCTGAGGCAAGAGAAGGTGG + Intronic
1155021087 18:21897635-21897657 AAAGCAGGGAGGAGGGAAGCAGG - Intergenic
1156463238 18:37333353-37333375 AAGGGAGAGGAGGGGGAAGAGGG - Intronic
1156894926 18:42235149-42235171 AAGGCAGAGGAGAGGCTGGCTGG - Intergenic
1157310181 18:46546843-46546865 GAGGCAGAGGGGAGGGGTGCTGG + Intronic
1157584428 18:48792092-48792114 AAGGCTGTGGAGAAGGAAGCAGG + Intronic
1157612713 18:48968429-48968451 AAGGGAGAGGGAAGGGAAGGAGG + Intergenic
1157914963 18:51655533-51655555 AATGCTGAGGGGAGGAAAGCAGG - Intergenic
1158416176 18:57251496-57251518 AAGCCAGAAGCCAGGGAGGCTGG - Intergenic
1158518083 18:58147313-58147335 AAGGCAGAGGCCAGGGGTGCAGG - Intronic
1159648599 18:70950427-70950449 CAGGCAGATGGGAGGGAAGGGGG - Intergenic
1159946341 18:74447092-74447114 CAGGCTGAGGGGCGGGAAGCTGG + Exonic
1160868555 19:1266768-1266790 AAGACAGACGCGCGGGGAGCAGG + Intronic
1160870696 19:1276419-1276441 GAGCCACAGGCCAGGGAAGCCGG - Intronic
1160965606 19:1745842-1745864 GAAGCAGAGGAGAGGGGAGCAGG + Intergenic
1161243266 19:3234794-3234816 AAGGCAGAGGAGAGAGAAGTGGG - Intronic
1161286541 19:3471307-3471329 AGGTCAGAGGGGAGGGAGGCTGG + Intergenic
1161328815 19:3676519-3676541 AAGGCAGAGGCGAGTGTGCCAGG - Intronic
1161464751 19:4422697-4422719 AAAGGAGAGGCGGGAGAAGCGGG + Exonic
1161499708 19:4607156-4607178 GAGGCAGGCGGGAGGGAAGCCGG - Intergenic
1161732453 19:5969703-5969725 AAGCCCGAGGCCATGGAAGCAGG - Intronic
1161975679 19:7606743-7606765 GAGGCAGAGAGGAGGGCAGCGGG - Intronic
1162091628 19:8284048-8284070 AAGGCAGAGGGGAGGGGGGCGGG + Intronic
1162093865 19:8298896-8298918 AAGGCAGAGGGGAGGGGGGCGGG + Intronic
1162307768 19:9885771-9885793 AGGGCAGGGGTGAGGGGAGCAGG - Intronic
1162494545 19:11016142-11016164 AGGGAGGAGGCGAGGGAGGCGGG + Intronic
1162905309 19:13819509-13819531 AAGGCAGTGGCAGGGGGAGCTGG + Intronic
1163365384 19:16873236-16873258 AAGGCAGACGCAACGGAAACAGG - Intronic
1163945691 19:20531266-20531288 AGGGGAGAGGGGAGGGGAGCCGG + Intergenic
1164145234 19:22508950-22508972 AAGGCAGAGGCTGGGGAAAGTGG - Intronic
1164292430 19:23880275-23880297 GAGGCAGAGGAGGGGGAAGAAGG + Intergenic
1164668924 19:30062262-30062284 AAGGGAGAGGTGAGGAAAGAGGG - Intergenic
1165099518 19:33430716-33430738 GAGGCTGGGGCGAGGGGAGCAGG - Intronic
1165430064 19:35767345-35767367 AGGGTGGAGGCCAGGGAAGCCGG - Intronic
1165612768 19:37170709-37170731 GAGGCAGAGGCGAGCGGATCAGG - Intronic
1166217961 19:41348491-41348513 TTGGCAGAGGTGAGGGGAGCTGG + Intronic
1166231609 19:41428126-41428148 AGGGCAGAGGGGAGGGACTCAGG + Intronic
1167398727 19:49250105-49250127 GAGGGAGAGGGGAGAGAAGCAGG - Intergenic
1167485887 19:49762822-49762844 AAGCCAGTGGGGAGGGAAGAAGG - Intronic
1167534287 19:50039701-50039723 TAGGCAGAGGGGAGGGCAACTGG - Intronic
1167700127 19:51038463-51038485 AGGGGAGAGGAGAGGAAAGCAGG - Intergenic
1168059253 19:53882248-53882270 AAGGCAGGGGCGCCGGCAGCCGG - Exonic
1168109068 19:54181704-54181726 AAGGAAGAAGGGAGGGAAGGAGG + Intronic
1168230783 19:55029903-55029925 AGGGAAGAGGGGAGGGAGGCAGG + Intronic
1168394506 19:56036979-56037001 AGGGCAGAGATGAAGGAAGCAGG - Intronic
1168433810 19:56302330-56302352 AAGGAAGAGGAAAGGGAAGGAGG - Intronic
1168463398 19:56581718-56581740 AAGGAGGAGGCAAGGGAAACTGG - Exonic
1202712426 1_KI270714v1_random:25642-25664 AGGGCCGAGGCGCGGGCAGCCGG + Intergenic
924981230 2:223376-223398 GAGACAGAGCTGAGGGAAGCTGG - Intronic
925199226 2:1952828-1952850 AAGGCAAAGGTAAGGGAAGGAGG - Intronic
925303748 2:2835070-2835092 CAGGCAGAAGGGAGGGCAGCTGG - Intergenic
925701046 2:6638468-6638490 AAGGGAGAGGCAAGGAAAACGGG - Intergenic
925838253 2:7966341-7966363 AAGGCAGAGGAGAGGTAAGAGGG - Intergenic
925900426 2:8505462-8505484 GAGGCAGAGGCGTGGGGATCGGG - Intergenic
926145681 2:10395996-10396018 CAGGCAGAGAAGAGGGAGGCGGG + Intronic
926289490 2:11517189-11517211 AAGGCAAAGGGCAGGGAGGCCGG - Intergenic
926320637 2:11746548-11746570 AGGGCAGGGGCGGGGCAAGCGGG - Intronic
926327889 2:11800687-11800709 GAGGCAGGGGCGGGGGAAACAGG + Intronic
926337525 2:11875382-11875404 AAGACAGAGGGGAGTGAAGAAGG - Intergenic
926571974 2:14538996-14539018 TAAGCAGAGGCAAGGAAAGCAGG + Intergenic
927704668 2:25289765-25289787 AAGACAGAGGCAAGGCAAGGAGG + Intronic
928177872 2:29047177-29047199 AAGGCAGGTGCGAGTGAGGCAGG + Intronic
928250805 2:29677209-29677231 AAGGAAGAAGGGAGGGAAGGAGG - Intronic
928402006 2:30985814-30985836 AAGGCTGAGGGGAGGGGAGGGGG - Intronic
930049740 2:47205759-47205781 AAGGCGGAGAGGAGGGAGGCTGG + Intergenic
930261814 2:49155479-49155501 AAGGCAGGGGAGAGGGAAGGAGG - Intergenic
930919856 2:56739405-56739427 AAGAGAGAAGGGAGGGAAGCAGG - Intergenic
931169832 2:59790974-59790996 AAGGGAAAGGCGAGGGAGGCTGG + Intergenic
931322252 2:61182495-61182517 AAGGAAGAAGAGAGGGAAGAAGG - Intronic
931728137 2:65130358-65130380 GAGTCAGAGGGGAGGGGAGCAGG - Intergenic
932047308 2:68362831-68362853 AGGGAAGAGGAGAGGGAATCAGG + Intergenic
932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG + Intronic
932368609 2:71169329-71169351 AAGGGAAAGGCAAGGTAAGCAGG - Intergenic
932506064 2:72233372-72233394 AGGGCAGAGAGGAGTGAAGCTGG + Intronic
932549404 2:72752587-72752609 AAGGCAGGGGTGAGGGAGGGAGG - Intronic
932567124 2:72917342-72917364 AAGCCAGTGGCGAGGGGAGGAGG + Intronic
933678263 2:85076911-85076933 AAGTCAGATGGGAGGGCAGCTGG + Intergenic
933768994 2:85730880-85730902 AAGGGAGAGGGAAGGGACGCAGG + Intergenic
933811115 2:86033300-86033322 AAGGCAGAGCCAAAGGAAACCGG + Intronic
933978589 2:87531714-87531736 GAGGAAGAGGAGAAGGAAGCAGG + Intergenic
934678444 2:96265996-96266018 GAGGCAGAGGAGGAGGAAGCCGG - Intergenic
934689576 2:96347928-96347950 AGGGGAGAGGCGAGAGCAGCTGG + Intronic
935579468 2:104744250-104744272 AAAGCGGAGGGGAGGGGAGCTGG - Intergenic
935698076 2:105787025-105787047 AGGGCAGAAGAGAGGAAAGCAGG - Intronic
935999359 2:108811131-108811153 AAGGCAGAGGGAGGGGAAGAAGG - Intronic
936141990 2:109948462-109948484 AAGACAGTGGAGAGGGAGGCAGG + Intergenic
936178677 2:110246410-110246432 AAGACAGTGGAGAGGGAGGCAGG + Intergenic
936202701 2:110423022-110423044 AAGACAGTGGAGAGGGAGGCAGG - Intronic
936315243 2:111419088-111419110 GAGGAAGAGGAGAAGGAAGCAGG - Intergenic
937178914 2:119971187-119971209 AAGGCAAAGGGGAAGCAAGCAGG + Intronic
938731102 2:134148459-134148481 AAGGAAGAAGAGAGGGAAGAAGG - Intronic
939019053 2:136937293-136937315 AAGTAAGAGGTGAGGGAAGGAGG - Intronic
939928815 2:148206598-148206620 AAGGCAGTGGGGAGGGGAGATGG - Intronic
940019878 2:149145634-149145656 AAGGGAGAAGGGAGGGAGGCTGG - Intronic
940202756 2:151169078-151169100 AGGGCAGAGTGAAGGGAAGCAGG - Intergenic
940725589 2:157332298-157332320 AAGGCAGAGGCCGGGCAAGGTGG - Intergenic
941513694 2:166445367-166445389 AAGGAAGAGGGGAGGGAGGGAGG + Intronic
942447121 2:176085512-176085534 CAGGCGGAGGCGAGGGAGGACGG + Intergenic
942602576 2:177656830-177656852 TAGGCAGAGGCCAGGGAAGATGG + Intronic
943375431 2:187070981-187071003 TAGGTAGAGGCCAGGGATGCTGG - Intergenic
944036362 2:195299020-195299042 AAGGTAGAGGGGAGGGAACTGGG - Intergenic
944139584 2:196440741-196440763 AAGGCGACGGCAAGGGAAGCAGG + Intronic
944239067 2:197468201-197468223 AAGGCCGAGGCGGGGGGATCAGG + Intronic
946087302 2:217186916-217186938 AAAGCAGAGACTGGGGAAGCTGG - Intergenic
946322399 2:218961493-218961515 AAGGCAGACAGGAGGGAAGATGG - Exonic
946491474 2:220153029-220153051 AAGGAAGAAACGAGGGAAGGAGG + Intergenic
947675371 2:231974240-231974262 AAGGGACAGGGGAGGGAAGCTGG + Intronic
947744298 2:232499765-232499787 AAGGCTGAAGAGAGGGAGGCTGG - Intergenic
947745010 2:232502967-232502989 AAGGCAGAGGCGGGGGCGGGAGG + Intergenic
948797098 2:240410965-240410987 ATGGCAGGTGCGAGGGAGGCTGG + Intergenic
948797109 2:240410996-240411018 ATGGCAGGTGCGAGGGAGGCGGG + Intergenic
948797237 2:240411390-240411412 ATGGCAGGTGCGAGGGAGGCGGG + Intergenic
948855250 2:240727312-240727334 AAGGGAGAGGGGAGGGCAGGAGG + Intronic
948951558 2:241255610-241255632 AAGGGAAAGGTGTGGGAAGCGGG + Intronic
948996478 2:241582629-241582651 AGGGCACAGGGGAGGGAAGAGGG + Intergenic
1168900975 20:1364685-1364707 AAGGCAGAGGAGAATGAAGGAGG - Intronic
1168928077 20:1599088-1599110 AAGGCAGAAGCCAGGGAAAGAGG + Intronic
1169068851 20:2709526-2709548 AAGGCAGAAGCCAAGGAAGGAGG - Intronic
1169213296 20:3779213-3779235 GAGGCAGAGGCGCAGGAAGCAGG - Exonic
1170096613 20:12652266-12652288 AAGGCAGAGGCTATGTAATCTGG + Intergenic
1170215338 20:13885287-13885309 AAGGTAGTGGTGAGGGAGGCTGG - Intronic
1170696599 20:18664887-18664909 AAGGAAGAGGTGGGGGAAGATGG - Intronic
1170696963 20:18667795-18667817 GAGGCAGAGGCGTGGGGAGAAGG - Intronic
1170816617 20:19719818-19719840 AAGAGAGAGGCCAGGGAATCAGG + Intronic
1170843052 20:19939591-19939613 ATGGCAGAGGAGAGGGGTGCTGG - Intronic
1171193313 20:23177732-23177754 AAGGAAGAGGAGAGGGGAGTTGG - Intergenic
1171301522 20:24065117-24065139 AAGGAAGAAGTGAGGGAAGAAGG - Intergenic
1171349672 20:24492766-24492788 AAGGCAAAGGGGAAGGAAGATGG - Intronic
1171782053 20:29428001-29428023 TGGGCAGAGGCGAAGGAAGCGGG + Intergenic
1172645552 20:36467068-36467090 AAGGCAGGGCCGAGAGAAGGGGG - Intronic
1172720297 20:36994870-36994892 AAAGCAGCCGGGAGGGAAGCTGG + Intergenic
1173685842 20:44922860-44922882 AGGGTAGAGGCCAGGGATGCTGG + Intronic
1173841492 20:46160368-46160390 AAGGCAGAGATGAGGGCACCTGG - Intergenic
1173858647 20:46267900-46267922 GTGGCAGGGGTGAGGGAAGCAGG + Intronic
1175186967 20:57185158-57185180 AGGGCAGTGGGGAGGGAGGCTGG + Intronic
1175290038 20:57869604-57869626 AAGGCAGAGGGGAGGGAGAGGGG - Intergenic
1175362232 20:58421704-58421726 AAGAAAGAGAGGAGGGAAGCAGG + Intronic
1175370341 20:58483944-58483966 GAGGCAGAGGCCAGGGGAGGGGG + Intronic
1175531157 20:59674876-59674898 AAGGCAGAGACAGGAGAAGCGGG - Intronic
1175663560 20:60838636-60838658 TGGGCAGAGGCCAGGGATGCTGG - Intergenic
1175905983 20:62379697-62379719 AAGGCAGAGACCTGGGAATCAGG - Intergenic
1176213667 20:63938534-63938556 AAGGCATAGCCGGGGGGAGCGGG - Intergenic
1176227170 20:64007372-64007394 GAGGCAGAGGGGAGGGGAGGCGG - Intronic
1176624743 21:9083402-9083424 ACCGCAGAGGCGAGGGACTCTGG - Intergenic
1177507295 21:22035388-22035410 ATTGGAGGGGCGAGGGAAGCAGG - Intergenic
1178239508 21:30882552-30882574 GAGGCAGAGCTGGGGGAAGCAGG + Intergenic
1178719749 21:34998016-34998038 AAGGCAGAGGCAAGGGAGATGGG - Intronic
1179189039 21:39107805-39107827 AAGGCAGTGGGAAGGCAAGCAGG + Intergenic
1179411741 21:41168044-41168066 AAGGCGGAGGCCGGGGAGGCGGG - Exonic
1179509423 21:41862503-41862525 AAGAGAGGGGCGAGGGAAGCTGG + Intronic
1179640617 21:42745247-42745269 AAGGCCGAGCGGAAGGAAGCAGG + Intronic
1179887142 21:44319015-44319037 AAGGCAGAGGCGAGGGGGCCGGG + Intronic
1180742813 22:18065491-18065513 CAGGCAGAGGCGGGGGCAGGAGG + Intergenic
1181165022 22:20978631-20978653 AAGGCAGAGGAAAGGGGAGATGG - Intronic
1181965922 22:26656796-26656818 AAGGCTGAGGCGGGGGCAGGAGG + Intergenic
1182045507 22:27270996-27271018 AAGGCAGCAGCGGGGGAGGCAGG - Intergenic
1182522875 22:30894030-30894052 CAGGCAAAGGAGAGGGAAGGAGG + Intronic
1182526770 22:30925486-30925508 GAAGCAGAGGTGAGGGATGCAGG - Intronic
1182548280 22:31087887-31087909 TAGGCAGAGCCGTGGGCAGCTGG + Intronic
1182549508 22:31093333-31093355 AGGGCAAAGGCAAGGGCAGCGGG - Intronic
1183384366 22:37506430-37506452 AAGTCATAGGCCAGGAAAGCTGG - Intronic
1183390909 22:37545401-37545423 AAGGCACAGGTGAGGGAAGGAGG - Intergenic
1183438223 22:37807724-37807746 ATGGCAGAGGGGAGGGAAGGGGG - Intergenic
1183498076 22:38161797-38161819 CAGGCTGAGGGGAGGGAAGGAGG + Intronic
1183549050 22:38470549-38470571 AAGTCAGAGGTGATGGAGGCAGG + Intronic
1183663962 22:39236735-39236757 AAGAAAGAGGCGAGGGCAGATGG + Intronic
1184522482 22:45003259-45003281 AAGGCAGAGGGGAGCTCAGCAGG + Intronic
1184533219 22:45070222-45070244 AGGGCAGAGGCCAGGGCAGAGGG - Intergenic
1184835698 22:47019778-47019800 AAGGCAGAGGGGAAGGATGGAGG - Intronic
1185082506 22:48717810-48717832 AGGGCATAGGCAAGGGAAGAGGG + Intronic
1203296104 22_KI270736v1_random:44434-44456 CAGGCAGAGGGGAATGAAGCAGG - Intergenic
950011545 3:9727653-9727675 AAAGCAGAAGCTAGGGTAGCAGG + Intronic
950037780 3:9899537-9899559 AAGGCAGCAGGGAGGGAAGGAGG - Intergenic
950268223 3:11591511-11591533 AAGGCAGAAGCGAGGCCTGCTGG + Intronic
950556883 3:13701357-13701379 AGGGCAGAGTGGAGGGAAGGAGG - Intergenic
950796504 3:15514697-15514719 AAGGCAGAGGCCAAGCCAGCAGG + Intronic
951418736 3:22458024-22458046 AAGGAAGAAGGGAGGGAAGAAGG + Intergenic
951522247 3:23620825-23620847 AAGGCAAAGGGCAGGGGAGCTGG + Intergenic
951886245 3:27527505-27527527 GAGACAGAGGCGAGAGAATCTGG - Intergenic
951955911 3:28253238-28253260 AAGGCAGAGCCCCGGGAAGAAGG - Intronic
952388473 3:32860131-32860153 AGGGGAGAGGGGAGGGAAGAGGG - Intronic
952561123 3:34594756-34594778 GAGGCAGAGGAGAGGGAAGCAGG - Intergenic
952662306 3:35866385-35866407 AGGGCAGAGGGGAGGGAAAATGG + Intergenic
953055906 3:39387028-39387050 AAGGGAGAGGCCAGAGAAGTGGG + Intronic
953105073 3:39869913-39869935 AAGGTGGAGGGGTGGGAAGCAGG + Intronic
953457493 3:43054556-43054578 GAGGCAGAGAGAAGGGAAGCTGG + Intronic
954132044 3:48565848-48565870 AAGGCAGAGGAGAGGGAAGTTGG + Intronic
954386777 3:50248286-50248308 GAGGCAGGTGCGAGGGGAGCTGG + Intronic
954414248 3:50385182-50385204 AAGGGGGAGGGGAGGGAAGATGG + Intronic
955931936 3:64066206-64066228 AAGGCAGAGCTGTGGGAAGAAGG + Intergenic
956659141 3:71582298-71582320 GAGGCGGGGGCGAGGGAAGGCGG + Intronic
956660884 3:71596202-71596224 AAGGAGGAGGAGAGGAAAGCAGG - Intergenic
957083437 3:75658398-75658420 TGGGCAGAGGCGAAGGAACCGGG - Intergenic
959183364 3:103009721-103009743 AAGGCTGGGGCCAGGCAAGCAGG - Intergenic
959880616 3:111440759-111440781 AAGGTAGAGGTGAGGGAACCTGG - Intronic
960043114 3:113170310-113170332 AGGGCAGACAGGAGGGAAGCTGG - Intergenic
960913555 3:122674504-122674526 AAGGCAAAGGGGAAGCAAGCAGG + Intergenic
961330570 3:126135724-126135746 CAGGAGGAGGCCAGGGAAGCAGG - Intronic
962672433 3:137722682-137722704 AAGGCAGAAGCTAGGGATGCAGG - Intergenic
963222452 3:142826877-142826899 AAAGCAGTGGCGAGGGAGGAGGG - Intronic
963326526 3:143869170-143869192 AAAGCAGAGGGAAGCGAAGCCGG - Intergenic
963617425 3:147559415-147559437 GAGGAAGAGGAGAGAGAAGCGGG - Intergenic
963733194 3:148991888-148991910 AAGGACGAGGAGACGGAAGCAGG - Intronic
963832018 3:150018264-150018286 AAGGCAAAGGAGAGAGAAGAGGG + Intronic
963905524 3:150770718-150770740 AAGGCAGAGGGGAGAGAGTCCGG + Intergenic
965768746 3:172158855-172158877 GAGGAAGAGGGGAGGGAAGGAGG - Intronic
965883118 3:173411360-173411382 ATGGCAGTGGTGAAGGAAGCTGG - Intronic
965895665 3:173572431-173572453 AGGGCAGAGGCCAGTGAGGCTGG + Intronic
966588214 3:181650991-181651013 AAGGGAGGGGAGAGGGAAGGAGG + Intergenic
966914348 3:184576727-184576749 AAAGCAGAGGCAAGGCAAGGAGG + Intronic
966961348 3:184942568-184942590 AAGGCAGAGCTAAGGTAAGCTGG - Intronic
967079068 3:186032434-186032456 AAAGAAGAGGCAAGGGATGCTGG - Intergenic
967963217 3:194941631-194941653 AAGCCAGACGCGAGGGCAGCAGG + Intergenic
967990950 3:195130383-195130405 AAGGCAGAGATGAGTGAAGATGG + Intronic
968078861 3:195833173-195833195 AAGGCAGTGGGGAGGAAGGCTGG + Intergenic
968589028 4:1448611-1448633 AAAGCAGAGGTGAGAGAGGCAGG - Intergenic
969143528 4:5100578-5100600 AAGGAAGAAGGGAGGGAGGCAGG - Intronic
969483935 4:7461307-7461329 AAGGCAGAGGGGAAGGAGGGCGG - Intronic
969594816 4:8142989-8143011 CCTGCAGAGGGGAGGGAAGCTGG - Intronic
969873403 4:10118287-10118309 AAGGCAAAGGCGTGGGGAGAGGG + Intergenic
972127727 4:35790161-35790183 AAGGGAGAAGGGAGGGAAGGGGG + Intergenic
972296909 4:37747902-37747924 AAGGCAAAGGGGAAGGAAGCAGG + Intergenic
972396137 4:38661421-38661443 CAGGCAGAGGCCAGGCCAGCAGG + Intergenic
972762363 4:42119438-42119460 CAGGCAGAGGGGTGGGAAGGAGG - Intronic
972833681 4:42843070-42843092 CAGGCAGTGGTGTGGGAAGCTGG + Intergenic
972889458 4:43538376-43538398 AAGGGAGAGGCTAGTGAAGAGGG + Intergenic
973319434 4:48794982-48795004 ATGGGAGAGGGGAAGGAAGCAGG - Intergenic
973342175 4:49016746-49016768 AAGCTAGATGCAAGGGAAGCTGG - Intronic
975160738 4:71121206-71121228 AGGGGAGGGGGGAGGGAAGCGGG - Intergenic
981817098 4:148843097-148843119 CAGGAAGAGGAGAAGGAAGCAGG - Intergenic
982024061 4:151234468-151234490 AGGGGAGCGGCAAGGGAAGCTGG + Intronic
982186223 4:152803450-152803472 AAGGCAGAGGCCAGAGATGCTGG - Intronic
983155051 4:164336990-164337012 AAGGAAGAGAGGAGGGAAGGAGG + Intronic
983790569 4:171792771-171792793 CAGGAAGAGGTGAGGGAAGGAGG + Intergenic
983910340 4:173232059-173232081 AAGGAAGAGAGGAGGAAAGCAGG + Intronic
984070343 4:175103405-175103427 AAGGGAGAGGGGAGGGAGGAGGG + Intergenic
984070364 4:175103458-175103480 AAGGGAGAGGGGAGGGAGGAGGG + Intergenic
984159843 4:176238423-176238445 AAGGCAGAGGAAAGGGTAGTTGG + Intronic
984543251 4:181067596-181067618 TAGGGAGAGGTGAGGGAAGCAGG + Intergenic
984906916 4:184636912-184636934 AAGGCAGAGGCTGTGAAAGCCGG + Intronic
984922526 4:184778266-184778288 AAGGCACAGCCGGGGGAAGGGGG + Intronic
985151049 4:186947135-186947157 AAGGGAGAGGTGAAGGCAGCTGG - Intergenic
985524408 5:394781-394803 AGGGCAGAGGGGAGGGCAGGTGG + Intronic
985581259 5:696280-696302 AAGACAGAGGCACGGGGAGCGGG + Intergenic
985796003 5:1962545-1962567 AAGGAAAAGGCGAGGGAAGGAGG - Intergenic
985896378 5:2751845-2751867 AGGGCGGAGGCGACGGAGGCGGG + Intergenic
986387521 5:7249041-7249063 AAGGCAGAGGAGAAGGCGGCTGG + Intergenic
986674754 5:10173892-10173914 AAAGAAGAGGCAAGGGCAGCAGG + Intergenic
987090146 5:14503153-14503175 GAGGCAGAGCCAAGAGAAGCCGG - Intronic
987776315 5:22372305-22372327 AAAGCAAAGGAGAGGGAACCAGG + Intronic
989007678 5:36833407-36833429 AAGGCAGAGAAGAGGGTACCTGG + Intergenic
989229812 5:39073895-39073917 AGGGCTCGGGCGAGGGAAGCGGG + Intronic
990450529 5:55928451-55928473 AAAGCAAAGCCCAGGGAAGCTGG + Intergenic
990482756 5:56227947-56227969 AAGTAAGAGGTGGGGGAAGCGGG - Intronic
990822450 5:59857902-59857924 AAGGAAGGGGGGAGGGAAGGGGG + Intronic
991036765 5:62135207-62135229 AAGGGTGAAGCCAGGGAAGCGGG + Intergenic
992488530 5:77218568-77218590 CAGGCAGAGGGAAGGGGAGCAGG + Intronic
992883869 5:81138289-81138311 AATGCAGCAGCCAGGGAAGCAGG - Intronic
993360135 5:86964747-86964769 AGGGAAGAGGGGAGGGAAGGTGG + Intergenic
993603561 5:89958790-89958812 AAGGCTGAGGCCAGGGAGGCAGG - Intergenic
993905002 5:93612614-93612636 AAGGAAGGGGAGAGGGAAGGGGG + Intergenic
995063687 5:107838096-107838118 AAGGCAGAGTAGCGTGAAGCTGG - Intergenic
995851136 5:116546835-116546857 AAGTGAGAGGAGAGGGAATCAGG - Intronic
996798354 5:127375620-127375642 AGGGAAGAGGGGAGGGAAGAAGG - Intronic
996821978 5:127639608-127639630 AAGAGAGAGGAGAGGGAAGAAGG - Intergenic
996948102 5:129094496-129094518 AACGCAGCGGCCCGGGAAGCTGG + Intergenic
997200695 5:132008427-132008449 AAGGCAGAGGCCAGGGGTGGGGG + Intronic
997203963 5:132030579-132030601 AAGGTAGAGGTGAGGTGAGCAGG + Intergenic
997283373 5:132662255-132662277 CAGGGAGAGGCGACGGAAGAAGG + Intergenic
998220449 5:140273830-140273852 GAGACAGAGGGGAAGGAAGCTGG + Intronic
998444366 5:142187174-142187196 AAGACAGAGGCAAGGCAAACAGG - Intergenic
998501505 5:142636831-142636853 AAGGCTGTGGCTGGGGAAGCTGG + Intronic
998505408 5:142668147-142668169 CAGGCAGAGGCCATGGTAGCTGG + Intronic
998557251 5:143137552-143137574 AAGGTAGAGGAGAGGTATGCGGG - Intronic
998813683 5:145991473-145991495 AAAGCAGGGCAGAGGGAAGCAGG - Intronic
999303967 5:150508061-150508083 AAGGCAGAAGCAAGGGAGGGAGG - Intronic
999692758 5:154162935-154162957 AAGGCTCAGGGGAGGGAAGCGGG - Intronic
1000064507 5:157683314-157683336 AAGGCAGATTCCAGGGAATCAGG - Intergenic
1000286031 5:159826836-159826858 AAGGCAGAGGAGAGAAGAGCAGG + Intergenic
1000561231 5:162791945-162791967 AAGGCAAAGGGGACGCAAGCTGG + Intergenic
1001380617 5:171304255-171304277 AGGTTAGAGGAGAGGGAAGCAGG - Intergenic
1001427771 5:171635308-171635330 AAGGCAGATGCCATGGGAGCCGG - Intergenic
1001710024 5:173771168-173771190 AAGGGGGAGGGGAGGGAGGCGGG - Intergenic
1001803536 5:174564145-174564167 AATGCAGAGGCGAGATCAGCAGG - Intergenic
1001949716 5:175807803-175807825 AAGGAAGAGGGGAGGGAAGTGGG + Intronic
1002176668 5:177404708-177404730 AAAGCAGATGAGAGGGAGGCAGG - Intronic
1002305975 5:178283225-178283247 AAGACAGAGGCGAGGGCTGGGGG - Intronic
1002453524 5:179332694-179332716 AGGGCAGAGGGGAGGGAGGGAGG + Intronic
1002852670 6:1010510-1010532 AAGGGAGAGGGGAGGGAGGGAGG - Intergenic
1002899548 6:1399463-1399485 GAGGAGGAGGAGAGGGAAGCAGG + Intergenic
1003119011 6:3304883-3304905 CAGGGAGAGGAGAGGGATGCAGG + Intronic
1003452764 6:6251485-6251507 AAGACACTGGCCAGGGAAGCTGG - Intronic
1003643060 6:7891752-7891774 AAGGCAGAGACGGGGGAAAGAGG + Intronic
1004396258 6:15248545-15248567 CAGGCAGGGCCGCGGGAAGCCGG - Intronic
1004423254 6:15489871-15489893 AAGGAGGAGGAGAGGGAAGAGGG - Intronic
1004558875 6:16728271-16728293 AGGGCAGTGGGGAGGGAAGTTGG + Intronic
1005387953 6:25304513-25304535 ACTGCACATGCGAGGGAAGCAGG - Intronic
1005882046 6:30069378-30069400 CAGGCAGAAGAGAGGGAAGGAGG - Exonic
1005960702 6:30690928-30690950 ATGAAAGAGGCGAGGGCAGCAGG + Exonic
1006189539 6:32199110-32199132 ACAGCACAGGCCAGGGAAGCTGG + Exonic
1006672499 6:35738164-35738186 GAGGCTGAGGTAAGGGAAGCAGG + Exonic
1006831203 6:36969333-36969355 AGGACAGATGGGAGGGAAGCAGG - Intronic
1006933463 6:37701290-37701312 AAGCCAGGGGCCAGGGAACCAGG + Intergenic
1007177200 6:39905102-39905124 AGGGCAGAGGGGAGGCAGGCAGG + Exonic
1007249883 6:40488365-40488387 AAGGCAGAGGGAATGGAAGATGG - Intronic
1007352124 6:41281668-41281690 AAGACAGAGGAAAGGGAAGCAGG - Intronic
1007448152 6:41922845-41922867 AAGGCAATGGTGAGAGAAGCAGG - Intronic
1007482016 6:42156528-42156550 AAGGGAGTGGTTAGGGAAGCCGG - Intronic
1007500995 6:42296734-42296756 GAGGCAGAGGGAAGGGAAGAAGG + Intronic
1007635747 6:43298649-43298671 AAGGCAGAGCCGTGGGGAGCTGG + Exonic
1009470056 6:64021413-64021435 TAGGCAGAGGTCAGGGATGCTGG + Intronic
1010070592 6:71739736-71739758 AACATAGAGGAGAGGGAAGCCGG + Intergenic
1011112447 6:83853541-83853563 GAGGGAGAGACGGGGGAAGCTGG - Intronic
1011403093 6:86985690-86985712 AAGGCAGATCTGAGTGAAGCTGG - Intronic
1011843346 6:91529306-91529328 AAGAAAGAGGAGAGGGAGGCAGG + Intergenic
1012150235 6:95741066-95741088 AAGGCAAAGGGGAAGCAAGCTGG + Intergenic
1013192470 6:107815275-107815297 AGGGCAGAGACCAGGGATGCTGG + Intronic
1013345291 6:109254229-109254251 GAGGAAGAGGGGATGGAAGCAGG + Intergenic
1013586986 6:111588248-111588270 AAGGCAGAGGGGAGAGAATGGGG - Intronic
1013587158 6:111589681-111589703 AGGGCAGGGGCTGGGGAAGCAGG - Intronic
1014250011 6:119105464-119105486 AAGGCAAAGGGGAAGCAAGCAGG - Intronic
1014472453 6:121833479-121833501 AAGGCAGATGCGAGGGAGGGAGG + Intergenic
1014780089 6:125555408-125555430 AAGGCAGAGGTGGGGCACGCAGG + Intergenic
1015631523 6:135236541-135236563 AAGGAAGAAGGGAGGGAAGGAGG - Intergenic
1015666873 6:135640776-135640798 AAGGCAGAGAAGAGGTTAGCAGG - Intergenic
1016535012 6:145100069-145100091 AAGGAAGAGGGAAGGGAAGGAGG + Intergenic
1017391229 6:153941723-153941745 AAGACAGAGTCCAGGGAAGGTGG + Intergenic
1018210796 6:161479835-161479857 AAAGCAGAGGCTAGGGAAGTTGG - Intronic
1018378095 6:163232478-163232500 AAGGAAGAGGAGAAGGAAGAAGG + Intronic
1018867987 6:167760177-167760199 AAGCCCGAGGCGAGGCAGGCTGG - Intergenic
1019186725 6:170224780-170224802 AATGCAGGGCAGAGGGAAGCGGG - Intergenic
1019476975 7:1249000-1249022 GAGGCTTAGGGGAGGGAAGCAGG - Intergenic
1019494199 7:1329985-1330007 AAGGCAGAGGCCAGGAGGGCAGG - Intergenic
1019506476 7:1393917-1393939 AAGGCAGAGGGCAGGGGTGCAGG + Intergenic
1019748781 7:2715776-2715798 AAGGCAGAGGAGAGAGAATGAGG + Exonic
1019872167 7:3774663-3774685 ATGGCAGAGGAGAGAGAACCAGG - Intronic
1020079946 7:5281969-5281991 AAGGCTGAGGGGTGGGCAGCGGG + Intronic
1020173393 7:5863416-5863438 ATGGCACAGGAGAGGGAAGAGGG + Intergenic
1022243582 7:28535403-28535425 AAGGAAGAAGAGAGGGAGGCAGG + Intronic
1022339190 7:29452514-29452536 CACGCAGAGGCAAAGGAAGCAGG - Intronic
1022510712 7:30933390-30933412 AAGGCAGCGGCAGGGGCAGCAGG - Intergenic
1022792348 7:33701630-33701652 AAGGCAGGGGGCAGGGAAGCAGG - Intergenic
1022955167 7:35374067-35374089 AAGACAGAGGAGAAGGAAGAGGG - Intergenic
1023000298 7:35801374-35801396 GAGGCAGCGGCGAGGGGAGCCGG + Intronic
1024200504 7:47101651-47101673 GAGGCAGAGCCCATGGAAGCAGG + Intergenic
1024270138 7:47635767-47635789 GAGAGAGAGGAGAGGGAAGCAGG + Intergenic
1025110379 7:56211501-56211523 CAGGGAGAGGTGAGGGGAGCAGG + Intergenic
1025198967 7:56950247-56950269 AAGGCTGAGGGGTGGGCAGCGGG - Intergenic
1025672979 7:63626686-63626708 AAGGCTGAGGGGTGGGCAGCGGG + Intergenic
1026111608 7:67462927-67462949 AGGGCAGAGCGGAGGGCAGCAGG + Intergenic
1026320685 7:69265148-69265170 AAGGCACAGGTGTGGGAAGAGGG + Intergenic
1026393660 7:69928664-69928686 CAGGGAGAGGCCAGAGAAGCAGG + Intronic
1027239476 7:76317992-76318014 AAGACGGAGGAGAGAGAAGCGGG + Intergenic
1027270350 7:76515359-76515381 AAGGCAGAGGAGAGGCAGGGGGG - Exonic
1028466663 7:91160224-91160246 AAGGCAGAGCCGAGGGCACAGGG - Intronic
1028769077 7:94594945-94594967 GAGGCAGTGGACAGGGAAGCTGG - Intronic
1029506872 7:100968141-100968163 AAGGCAGAGGGGAGGCAAGAAGG - Exonic
1029540237 7:101178488-101178510 TAGGCAGAGGCGGAGGCAGCTGG + Intronic
1030230436 7:107203138-107203160 AAGGCAGGGTTGGGGGAAGCAGG + Exonic
1031584724 7:123520697-123520719 AAGGTAGGGGAGTGGGAAGCTGG + Intronic
1032017247 7:128388089-128388111 AAGAAAGAGGACAGGGAAGCAGG + Intergenic
1033862955 7:145651664-145651686 AAGGAAGAGGGGAAGGAAGGAGG - Intergenic
1033899368 7:146116583-146116605 AAGGCAAAGGAGGGGGAAGAGGG - Exonic
1034464400 7:151218005-151218027 AAGGAAGAGGGGAGTGATGCAGG - Intronic
1034822177 7:154226171-154226193 AAGGAAGATGAGAGGGAAGGTGG + Intronic
1034957419 7:155343730-155343752 CGGGCAGAGGCCAGGGATGCAGG - Intergenic
1035037326 7:155903790-155903812 AAGGCGGAGGGGCGGGAGGCTGG - Intergenic
1035057030 7:156042514-156042536 AAGGCAGGGGCCAGGGAAGGGGG + Intergenic
1035280779 7:157776696-157776718 GAGGCGGAGGAGAGGGAGGCAGG - Intronic
1035420471 7:158725373-158725395 AAGGCAGAGCAGAGGGATGAGGG - Intergenic
1035426977 7:158784453-158784475 AAGGGAGAGGCCAAGGATGCAGG + Intronic
1035992758 8:4510752-4510774 AAGGAAGAGAGGAGGGAAGGAGG - Intronic
1036405156 8:8448159-8448181 AAGGCAGAGGGTAGGGAGGGAGG + Intergenic
1036510783 8:9398232-9398254 AAGGCAAAGGCGAGGCCACCTGG + Intergenic
1037106142 8:15111107-15111129 AAGGCAAACACCAGGGAAGCGGG + Intronic
1037286997 8:17311928-17311950 AACTCAGAGGGGAGGGAAGAGGG - Intronic
1037804475 8:22051324-22051346 GAGGCAGAGGGGAGCCAAGCAGG + Intronic
1038311977 8:26451626-26451648 AAGGGAGGGAAGAGGGAAGCTGG + Intronic
1038340315 8:26680493-26680515 AAGGAAGAGGGGAGGGAGGGAGG - Intergenic
1038340360 8:26680699-26680721 AAGGAAGAGGGGAGGGAGGGAGG - Intergenic
1039099373 8:33924487-33924509 AGGGCAAAGGAGAGGGAAGAAGG - Intergenic
1039408136 8:37330051-37330073 AAGGCAGGGTGTAGGGAAGCGGG - Intergenic
1039552338 8:38452031-38452053 GAGGGAGAGGGGAGGGAGGCTGG + Intronic
1041095311 8:54343673-54343695 AAGGCTGGGGCCAGGGGAGCAGG - Intergenic
1042190838 8:66185588-66185610 TAGGCAGAGAAGATGGAAGCAGG - Intergenic
1042967330 8:74368834-74368856 GAGGTAGAGGCCAAGGAAGCTGG - Intronic
1044605656 8:94045193-94045215 AAGGAAGAGGCAGGGGAGGCAGG - Intergenic
1044706174 8:95010866-95010888 AAGACAAAGGGGAAGGAAGCAGG + Intronic
1044891752 8:96843330-96843352 AAGGAGGAAGGGAGGGAAGCAGG + Intronic
1044895255 8:96885003-96885025 TAGGCAGAGGGGAGGAAAGTGGG + Intronic
1045231990 8:100314678-100314700 CAGGCAGAGGAGAGGGGAGGGGG - Intronic
1045755128 8:105533757-105533779 AAGGAAGAAGGGAGGGAAGGAGG - Intronic
1045755174 8:105533904-105533926 AAGGAAGAAGGGAGGGAAGGAGG - Intronic
1046979083 8:120316798-120316820 GAGGTAGAGGCAAGGGAAGGTGG + Intronic
1047061799 8:121235636-121235658 AAGGAGGAGGGGAGGGAAGGAGG - Intergenic
1047061806 8:121235652-121235674 AAGGAGGAGGGGAGGGAAGGAGG - Intergenic
1047061813 8:121235668-121235690 AAGGAGGAGGGGAGGGAAGGAGG - Intergenic
1047091659 8:121582182-121582204 TAGGAAGAGGTGAGGGACGCAGG - Intergenic
1047349669 8:124061756-124061778 AAGGCAGAGACAAGGGAGACTGG + Intronic
1047356693 8:124129035-124129057 AGAGCAGAGAGGAGGGAAGCTGG + Intergenic
1047527248 8:125644088-125644110 ATGGCAGGGGCCAGGGGAGCTGG + Intergenic
1048345459 8:133571789-133571811 AAGGAAGAGGCGATGTGAGCTGG - Exonic
1048538852 8:135324091-135324113 GAGGCAGAGGTGAAGTAAGCTGG - Intergenic
1048962883 8:139594862-139594884 AAGGCAGAGTTAAGGGAACCAGG + Intergenic
1049139426 8:140939026-140939048 ATGGAAGAGGGGAGGAAAGCAGG - Intronic
1049164781 8:141119098-141119120 AAGCCTGAGGCCAGGGGAGCAGG + Intronic
1049208945 8:141376499-141376521 AGGGAAGAGGTGAGGGAGGCTGG + Intergenic
1049236713 8:141515763-141515785 AGGGCACAGGCAAGGGTAGCAGG - Intronic
1049284889 8:141769227-141769249 CAGGCAGAGGCGAGGTTGGCAGG + Intergenic
1049415573 8:142493347-142493369 TAGGCAGGGGCGGGGGCAGCAGG + Intronic
1050328176 9:4517833-4517855 AGGGCAGAAGTGAGGGAAGCAGG - Intronic
1050753639 9:8972502-8972524 AGGGAAGAGGAGAGGGAAGGAGG + Intronic
1051017611 9:12499596-12499618 AAAGCAGAGGAGAAGGAGGCAGG + Intergenic
1051450630 9:17193614-17193636 AAGGCAGCTGGGAGGGAGGCTGG - Intronic
1051681403 9:19611413-19611435 AGGGCAGAGAAGAGGGAAGGAGG + Intronic
1051692656 9:19732796-19732818 CAGGCAGATGGGAGGGCAGCTGG - Intronic
1052861822 9:33442251-33442273 AGGGCAGAGGAGAGGCAGGCTGG + Intronic
1052899053 9:33774518-33774540 AGGGCAGGGAGGAGGGAAGCCGG + Intronic
1053329348 9:37188899-37188921 AAGGGAGGGGCGAGGGGAGAAGG - Intronic
1053614084 9:39745316-39745338 ATGGCAGAGGCTCAGGAAGCGGG - Intergenic
1054155875 9:61639788-61639810 AAGGCAGAGGAGGAGGAAGAAGG + Intergenic
1054239433 9:62597077-62597099 ATGGCAGAGGCTCAGGAAGCGGG + Intergenic
1054553564 9:66631604-66631626 ATGGCAGAGGCTCAGGAAGCGGG + Intergenic
1055354718 9:75426242-75426264 AAGGAAGAAGCGAGGGAGGTAGG - Intergenic
1055627377 9:78188000-78188022 AAGGCAGAAGGGAGGGAAGTTGG - Intergenic
1056137743 9:83646571-83646593 AAGGAAGAGGGGAGGGGAGGAGG + Intergenic
1056461885 9:86816660-86816682 AAGGCAGGGGCCAGGAAAGAGGG + Intergenic
1057309056 9:93930281-93930303 GAGGAAGAGGCCAGGGAGGCTGG + Intergenic
1057420760 9:94910382-94910404 AAGCCAGAGGACAAGGAAGCTGG - Intronic
1057962550 9:99470576-99470598 AAGGTAGATGTGAGGGCAGCTGG + Intergenic
1058058803 9:100474092-100474114 AAGGCTGAGGGGAGGGAGGGCGG + Intronic
1058553234 9:106138184-106138206 AAAGCAGAGGAGAAGGAAGAGGG - Intergenic
1058811017 9:108639601-108639623 AAGGGAGAGGAGAGGGAGGGAGG - Intergenic
1059340518 9:113595071-113595093 ACGGCCGAGGAGAGGGAAGGCGG - Intronic
1059354229 9:113687081-113687103 AAGGCAGAGAAGAGGAAAGGAGG + Intergenic
1059354279 9:113687234-113687256 AAGGCAGAGAAGAGGGAGGAGGG + Intergenic
1059354288 9:113687278-113687300 TAGGCAGAGAGGAGGGAAGAGGG + Intergenic
1059411480 9:114135072-114135094 AAGCCAGAGGCAGGGGCAGCTGG + Intergenic
1059691535 9:116689594-116689616 AAGGAAGAAGCAAGGAAAGCGGG - Intronic
1059720933 9:116959528-116959550 AAGGCAGGGGTTAGGGAGGCAGG + Intronic
1059800090 9:117741480-117741502 GAGGCAAAGGCAAGGCAAGCCGG - Intergenic
1060210712 9:121708564-121708586 GGGGCAGAGGCAAGGGGAGCTGG + Intronic
1060277627 9:122193874-122193896 AGGGAAGCGGGGAGGGAAGCAGG + Intronic
1060519602 9:124286928-124286950 AAGGAAGAGGGGAGTGAAGTAGG - Intronic
1060815704 9:126634049-126634071 AAGGCAGGAGGGAGGGAAGAAGG + Intronic
1060869851 9:127030766-127030788 AAGGCAGAGGGGTGGGATGGGGG + Intronic
1061257987 9:129463886-129463908 ATGGCAGTGAAGAGGGAAGCTGG - Intergenic
1061947120 9:133914676-133914698 AAGGGATGGGGGAGGGAAGCGGG + Intronic
1062019885 9:134314244-134314266 AAGGCACAGGCCGGGGAGGCCGG + Intergenic
1062153990 9:135036015-135036037 AAGGGAGGTGCAAGGGAAGCAGG + Intergenic
1062303225 9:135887574-135887596 GAGGCGGAGGGGAGGGATGCAGG + Intronic
1062305175 9:135901951-135901973 AGAGCAGAGGGGAGGGCAGCTGG - Intronic
1185581381 X:1213262-1213284 AAGGGGGAGGGGAGGGAAGGGGG - Intergenic
1185593042 X:1291330-1291352 AAGGAAGAAGGGAGGGAAGGAGG - Intronic
1185616952 X:1427834-1427856 AAGGCCGAGGCGGGAGAGGCGGG - Exonic
1185660007 X:1720017-1720039 AAGGAAGAAGGGAGGGAAGGAGG - Intergenic
1186473957 X:9842823-9842845 AAGCAAGAGGGGAGGGAAGGAGG - Intronic
1186863202 X:13693464-13693486 TAGGCAGAGGGGAGGGAGGTCGG + Intronic
1188221882 X:27550673-27550695 AGGGGAGAGGGGAGGGAAGATGG - Intergenic
1189212434 X:39295313-39295335 AAGGCAGGGGAGATGGAATCTGG + Intergenic
1189230895 X:39451521-39451543 AAGGGATAGGGGAGGGAAGGTGG - Intergenic
1189282045 X:39825818-39825840 AAGGGAGAGGGGAAGGAAGGAGG - Intergenic
1189787380 X:44571580-44571602 AAGGCAGAGCTGGGGGAAGAGGG + Intergenic
1192428262 X:71096026-71096048 AGGGAAGAGGCGGGGGAAGGGGG + Intergenic
1192459492 X:71304765-71304787 AAGGAAGAGGGGAGGGAAAGAGG - Intronic
1192735041 X:73842807-73842829 AGGGCAGAGGGAAGGGAAGAGGG + Intergenic
1193861274 X:86671582-86671604 AAGGCAAAGGGGAAGGAAGCAGG - Intronic
1195067660 X:101252316-101252338 AAGGGAGACAGGAGGGAAGCAGG - Intronic
1195282446 X:103348995-103349017 AAGGAAGAGTGGAGGGATGCTGG - Intergenic
1195610854 X:106864331-106864353 AGAGCAGAGAGGAGGGAAGCTGG - Intronic
1195934621 X:110113027-110113049 AAGGCAGAGGGGAGGGAGGGAGG - Intronic
1197674703 X:129316617-129316639 AAGCCAGAGTTGAAGGAAGCTGG - Intergenic
1198305572 X:135379402-135379424 AAGGTGGAGACTAGGGAAGCTGG - Intergenic
1199691017 X:150309055-150309077 ATGCCAGAGGCTAGGGAGGCAGG - Intergenic
1201755606 Y:17482823-17482845 GAGGCAGAGGCCAAGGAAGAGGG - Intergenic
1201845946 Y:18423162-18423184 GAGGCAGAGGCCAAGGAAGAGGG + Intergenic