ID: 922753810

View in Genome Browser
Species Human (GRCh38)
Location 1:228083117-228083139
Sequence AACGAGAAAGGCAGAGGCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 282}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922753810_922753826 23 Left 922753810 1:228083117-228083139 CCCTCGCCTCTGCCTTTCTCGTT 0: 1
1: 0
2: 0
3: 36
4: 282
Right 922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 25
922753810_922753828 25 Left 922753810 1:228083117-228083139 CCCTCGCCTCTGCCTTTCTCGTT 0: 1
1: 0
2: 0
3: 36
4: 282
Right 922753828 1:228083165-228083187 GTTGGGATTAGCGGCCGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 48
922753810_922753827 24 Left 922753810 1:228083117-228083139 CCCTCGCCTCTGCCTTTCTCGTT 0: 1
1: 0
2: 0
3: 36
4: 282
Right 922753827 1:228083164-228083186 GGTTGGGATTAGCGGCCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
922753810_922753815 -1 Left 922753810 1:228083117-228083139 CCCTCGCCTCTGCCTTTCTCGTT 0: 1
1: 0
2: 0
3: 36
4: 282
Right 922753815 1:228083139-228083161 TTCCCGAGGCCGCCCGCGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 82
922753810_922753821 8 Left 922753810 1:228083117-228083139 CCCTCGCCTCTGCCTTTCTCGTT 0: 1
1: 0
2: 0
3: 36
4: 282
Right 922753821 1:228083148-228083170 CCGCCCGCGCGTGGACGGTTGGG 0: 1
1: 0
2: 0
3: 1
4: 30
922753810_922753829 29 Left 922753810 1:228083117-228083139 CCCTCGCCTCTGCCTTTCTCGTT 0: 1
1: 0
2: 0
3: 36
4: 282
Right 922753829 1:228083169-228083191 GGATTAGCGGCCGCGGGGGCCGG 0: 1
1: 0
2: 0
3: 8
4: 126
922753810_922753824 16 Left 922753810 1:228083117-228083139 CCCTCGCCTCTGCCTTTCTCGTT 0: 1
1: 0
2: 0
3: 36
4: 282
Right 922753824 1:228083156-228083178 GCGTGGACGGTTGGGATTAGCGG 0: 1
1: 0
2: 0
3: 0
4: 48
922753810_922753818 3 Left 922753810 1:228083117-228083139 CCCTCGCCTCTGCCTTTCTCGTT 0: 1
1: 0
2: 0
3: 36
4: 282
Right 922753818 1:228083143-228083165 CGAGGCCGCCCGCGCGTGGACGG 0: 1
1: 0
2: 0
3: 6
4: 86
922753810_922753819 7 Left 922753810 1:228083117-228083139 CCCTCGCCTCTGCCTTTCTCGTT 0: 1
1: 0
2: 0
3: 36
4: 282
Right 922753819 1:228083147-228083169 GCCGCCCGCGCGTGGACGGTTGG 0: 1
1: 0
2: 1
3: 2
4: 37
922753810_922753825 22 Left 922753810 1:228083117-228083139 CCCTCGCCTCTGCCTTTCTCGTT 0: 1
1: 0
2: 0
3: 36
4: 282
Right 922753825 1:228083162-228083184 ACGGTTGGGATTAGCGGCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 24

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922753810 Original CRISPR AACGAGAAAGGCAGAGGCGA GGG (reversed) Intronic
900356800 1:2268859-2268881 AAGGGGAAAGGCAGAAGGGAGGG - Intronic
900413413 1:2523993-2524015 AGAGAGAATGGCAGAGGGGATGG - Intronic
903579156 1:24358080-24358102 AATGAGAAAGGCAGGAGTGAGGG + Exonic
903912170 1:26735653-26735675 AATGAGAAAGACACAGGGGATGG - Intronic
904311047 1:29629851-29629873 AAGAAGATAGGCAGAGGCCAGGG - Intergenic
905458229 1:38103298-38103320 AGTGAGAAAGGCAGTGGAGAAGG + Intergenic
905739114 1:40354067-40354089 AACAAGAAATCCAGAGGCAAGGG - Intronic
906461316 1:46036798-46036820 AACGATAAATGCCGAGGTGAGGG + Intergenic
906524850 1:46488129-46488151 GACAAGAAAGGCGGAGGCGGGGG - Intergenic
906558931 1:46739615-46739637 AAAAAGAAAGGCAGAAGGGAGGG - Intergenic
907898897 1:58719604-58719626 AACCAGCAAGACAGAGGTGAGGG + Intergenic
909807222 1:79886479-79886501 AAGCAGAAGGGCAGAAGCGAGGG + Intergenic
910977052 1:92917802-92917824 AAGGAAAAAGGCAGAGGCTGTGG + Intronic
912548946 1:110471881-110471903 AGAGAGAAAAGCAGAGGGGAAGG - Intergenic
913045534 1:115070655-115070677 GACTAGAAAGGCTGAGGGGAAGG - Intronic
914960149 1:152197713-152197735 GAGGAGAAAGGAAGAGGAGAAGG - Intergenic
915161351 1:153922789-153922811 GTCGAAAAAGGAAGAGGCGACGG + Exonic
915583333 1:156829399-156829421 AACTAAAAAGGCAGTGGGGAGGG + Intronic
916275239 1:162987019-162987041 ATGGAGAAAGACAGAGGAGATGG - Intergenic
916565721 1:165975028-165975050 GAAAAGAAAGGGAGAGGCGAAGG - Intergenic
917479088 1:175395200-175395222 ATAGAGACAGGCAGAGGGGAAGG - Intronic
917631308 1:176893940-176893962 AAAGGGAGAGGCAGAGGCAAAGG + Intronic
917750413 1:178048263-178048285 TACTAGAAAGGCTGAGGAGAGGG + Intergenic
919799385 1:201344285-201344307 AAAGAGGGAGGCAGAGGAGAGGG + Intergenic
920104306 1:203540122-203540144 AAGGGGAAAGAAAGAGGCGAAGG + Intergenic
921027467 1:211300038-211300060 AAAGAAAAATGCAGAGGGGACGG - Intronic
921320162 1:213930961-213930983 AATGAGAAAGTCAGAGGAGCTGG - Intergenic
921338601 1:214112024-214112046 ACCGAGAAATGCAGAGGGGCAGG - Intergenic
922221194 1:223609891-223609913 AAAGAGACAGGCAGAGGGGGCGG + Intronic
922753810 1:228083117-228083139 AACGAGAAAGGCAGAGGCGAGGG - Intronic
1063892013 10:10640312-10640334 CATGAAAAAGGCAGAGGAGAAGG - Intergenic
1065639823 10:27770397-27770419 AAGGAGAAAGGGAGAAGTGAAGG - Intergenic
1065639830 10:27770428-27770450 AAGGAGAAAGGGAGAAGTGAAGG - Intergenic
1065656197 10:27953138-27953160 CACAAGAAAGGCAGAGACAAAGG - Intronic
1066451321 10:35532889-35532911 GATGAGAAAGCCAGAGGCCAAGG + Intronic
1067255790 10:44639061-44639083 AAATAGAAAGCCAGAGGAGATGG - Intergenic
1067824475 10:49560152-49560174 TACAAGAAAGGCAGAGGCGGGGG - Intergenic
1069180021 10:65347301-65347323 AAAGAGGAAGGCAGAGGAGGAGG + Intergenic
1069763825 10:70836557-70836579 AAAGGGAAAGGCAAAGGCAAAGG - Intronic
1072661404 10:97365796-97365818 AAGGAGAAAGGAAGAGGAGGGGG + Intronic
1073073543 10:100809491-100809513 ATAGACAAAGGGAGAGGCGAAGG - Intronic
1073465758 10:103693706-103693728 CCCGAGAATGGCAGAGGCCATGG + Intronic
1073523715 10:104159590-104159612 AAGCAGAAAGGCAGACGCCATGG + Intronic
1074415657 10:113264762-113264784 AAAGAGACAGGCACAGACGATGG - Intergenic
1074869256 10:117564108-117564130 ACAGAGACAGGCAGAGGTGATGG - Intergenic
1074911134 10:117910137-117910159 GAGGTGACAGGCAGAGGCGAGGG - Intergenic
1077392511 11:2306745-2306767 AAGGAGGAGGGCAGAGGAGAAGG + Intronic
1078399418 11:11010843-11010865 AAGGAGAAAAGGAGAGGGGAGGG + Intergenic
1078881449 11:15453064-15453086 TCCAAGAAAGGCAGAGGGGAAGG - Intergenic
1079115280 11:17636667-17636689 AAAGAGAAAGACAGAAGAGAAGG - Intronic
1079444335 11:20545824-20545846 AAAGAGAAAAGCAGAGGAGGAGG - Intergenic
1080709729 11:34735086-34735108 AAAGAGAAAGGCAGAAGAGTGGG + Intergenic
1082833836 11:57638429-57638451 AGCGAGATCGGCAGAGGAGAGGG + Intergenic
1082985242 11:59163292-59163314 AAGGAGAAAGGGAGAGGTGGGGG + Intergenic
1083718716 11:64593470-64593492 CACGGGGAAGGCAGGGGCGAAGG - Exonic
1086987122 11:93262565-93262587 AAAGAGAGAGGGAGAGGCAAAGG + Intergenic
1087358226 11:97122458-97122480 AACGAGGAAGGCAGAAGAGTGGG - Intergenic
1088688279 11:112303516-112303538 AAGGAGAAAAGGAGAGGAGAGGG + Intergenic
1089019971 11:115203351-115203373 AAAGAGGAAGGCAGAGGGGAGGG + Intronic
1091384402 12:83622-83644 AAAGAGACAGGGAGAGGAGATGG + Intronic
1091839166 12:3607098-3607120 AACTGGAAAGGCTGAGGCCATGG - Intronic
1092875721 12:12845883-12845905 AAAGAAAAAGGCTGAGGCCAGGG - Intergenic
1093762119 12:22922234-22922256 AAGGAGAAGGGCAGAGGCAAGGG + Intergenic
1094041146 12:26122739-26122761 CGCGAGAAAGGCAAAGGCGCGGG - Exonic
1094079386 12:26516153-26516175 AAAGAGAAGGGGAGAGGAGAGGG + Intronic
1095429649 12:42119439-42119461 AAAGAGAAAGGGAAAGGCAAAGG + Intronic
1096069439 12:48766780-48766802 GACTAGAGAGGCAGAGGAGAAGG - Exonic
1097318741 12:58202130-58202152 AAAGGGAAAAGCAGAGGCAAAGG - Intergenic
1097727208 12:63088689-63088711 ACCTAGAAAGGCAGAAGGGAGGG + Intergenic
1097756941 12:63417018-63417040 AAAGAGAGAGGGAGAGGCAAAGG + Intergenic
1098080988 12:66785514-66785536 AAAGAAAAAGGTTGAGGCGATGG + Intronic
1098982058 12:76967087-76967109 AATAAGAATGGCTGAGGCGAGGG - Intergenic
1100484521 12:95012027-95012049 AACGAGAAGTGCAGAGGGAAAGG + Intergenic
1100588306 12:95999737-95999759 GACTAGAGAGGCAGAGGTGAGGG + Intergenic
1106299405 13:28450499-28450521 AAAGAGAAAGGGAGAAGGGAAGG + Intronic
1106345768 13:28876082-28876104 AAGAAGAAAGGCAGAGGCAAAGG - Intronic
1106519185 13:30482245-30482267 AAAGAGAAAGGGAGAGGAGGAGG - Intronic
1106897311 13:34317527-34317549 AGAGAGAATGGCAGAGGAGATGG + Intergenic
1107980251 13:45728148-45728170 AACTGGTAAGGCAGAGGTGAGGG + Intergenic
1109376402 13:61500140-61500162 AACGAGAAATGGAGAGATGATGG - Intergenic
1109444919 13:62423411-62423433 AATGAGAGAGGAAGAGGAGAGGG + Intergenic
1110216474 13:73029939-73029961 AAAGAGAAAAGAAGAGGAGAAGG + Intergenic
1113554061 13:111216882-111216904 AAAGAGGAAGGCAGAGGGGCTGG - Intronic
1115248528 14:31321091-31321113 AAAGAGAAAGGAAGAGAGGAAGG - Intronic
1118900396 14:69981056-69981078 GAGGAGAAAGGCAGAGCAGAAGG + Intronic
1119009088 14:70965132-70965154 AGGGAGAAAGGCAGAGGTGAAGG - Intronic
1119654101 14:76404601-76404623 AACAATAAAGGAAGAGGAGACGG - Intronic
1119996837 14:79262464-79262486 AAGGAGAAAGGAGGAGGAGAAGG + Intronic
1120121669 14:80687582-80687604 AAGGAGAAAGGAAGGGGAGAAGG + Intronic
1122552377 14:102556954-102556976 AACAAAAAAGGCAGAGGAGTGGG + Intergenic
1122979173 14:105183700-105183722 ATCAAGAAAGGCAAAGGCAAAGG + Intergenic
1123102142 14:105811475-105811497 AGCCAGAATGGCAGAGGGGAAGG - Intergenic
1127231593 15:57001840-57001862 AAGGAGAAAGCCACAGGAGAAGG + Intronic
1132287298 15:100672727-100672749 AAAGGGAAAGGGAGAGGGGAAGG - Intergenic
1134756428 16:16671586-16671608 AAAGAGAAAGGGAGAAGTGAAGG + Intergenic
1134989641 16:18687577-18687599 AAAGAGAAAGGGAGAAGTGAAGG - Intergenic
1135063497 16:19290318-19290340 AGGGAGAGAGGCAGAGGGGAGGG - Intronic
1135331579 16:21564541-21564563 AGAGAGAAAGGAAGAGGGGAAGG + Intergenic
1135423941 16:22323053-22323075 GAGGAGAAAGGCAGAGGCCAGGG - Intronic
1135630166 16:24030286-24030308 AAAGAGAAATGCAGAGCCAAAGG + Intronic
1137893703 16:52188288-52188310 AACAAGAAAGTCATAGGCTAAGG - Intergenic
1138203360 16:55106353-55106375 AGAGAGAAAGACAGAGGTGAAGG - Intergenic
1139314798 16:66059095-66059117 AAGGAGGAAGGCAGTGGAGAGGG - Intergenic
1139457725 16:67095768-67095790 AACCAGAAAGGCAGAGGTTGTGG - Intronic
1139640823 16:68290325-68290347 AAGGAGAAAGGAAGAGGAGATGG - Intronic
1140769167 16:78187860-78187882 AAGGAGAAAGGTAGATGCGGTGG + Intronic
1141025042 16:80538748-80538770 AAAAAGAAAGGCCGAGGGGATGG + Intergenic
1141220801 16:82067903-82067925 AAAGAGAAAGGCATGGGGGAAGG - Intronic
1141908474 16:87042807-87042829 ATCCAGACAGGCAGAGGCCAGGG + Intergenic
1143020926 17:3916854-3916876 AGCGAGCAAGGCAGAGAGGAAGG + Intergenic
1144878103 17:18412879-18412901 ACCGAGAAAGGGAGAAGAGATGG + Intergenic
1145154127 17:20531546-20531568 ACCGAGAAAGGGAGAAGAGATGG - Intergenic
1145288027 17:21521040-21521062 AAAAAGAAAGCCAGAGGAGAGGG - Intergenic
1145389616 17:22445404-22445426 AAAAAGAAAGCCAGAGGAGAGGG + Intergenic
1145808452 17:27751003-27751025 AAGCCGAAAGGCAGAGGCAAGGG - Intergenic
1146626634 17:34440087-34440109 CAGGAGAAAGGCAGTGGGGAGGG - Intergenic
1147518308 17:41143071-41143093 AAGGAGAAGTGCAGAGGAGAAGG + Intergenic
1147774870 17:42893553-42893575 CACTAGAGAGGCAGAGGCAAGGG - Intergenic
1148187087 17:45652033-45652055 AACGGGAAGGGCAGATGGGAAGG + Intergenic
1148882982 17:50745826-50745848 AAAGAGAAAGGAAAAGACGAAGG + Exonic
1149189627 17:54044304-54044326 AACGAGAAAGACAGAAGAGAAGG - Intergenic
1150009055 17:61488033-61488055 AACGGGAAAGGAAAAGACGAGGG + Intergenic
1156403547 18:36761621-36761643 AACGGGACAGGCAGAGGAGCGGG - Intronic
1156854343 18:41764792-41764814 AACGAGAAAGGCAGTGGCTGGGG - Intergenic
1157915871 18:51663224-51663246 CACGAGGAAGGCAGAGGAGTAGG + Intergenic
1158372331 18:56822612-56822634 AATGAGAAAGGCAGAGGGTGCGG - Intronic
1159221265 18:65466180-65466202 AACGAGAAAGAGAGAGGGAAGGG + Intergenic
1159360854 18:67400924-67400946 AATGAGAAAGGCAGATGCAGAGG + Intergenic
1161403753 19:4080827-4080849 AAGGGGAAAGGGAGAGGGGATGG + Intergenic
1161498469 19:4599926-4599948 AACCTGAAAGGCAGAGGTTACGG + Intergenic
1161777872 19:6273623-6273645 AGCGAAAAAGGCAGAGGCGCAGG - Intronic
1162091623 19:8284041-8284063 AAAAAAAAAGGCAGAGGGGAGGG + Intronic
1162093860 19:8298889-8298911 AAAAAAAAAGGCAGAGGGGAGGG + Intronic
1162632469 19:11940007-11940029 AACCTGAAAGGCAGAGGCTGCGG - Intronic
1163281628 19:16321894-16321916 AGAGAGACAGGCAGAGACGACGG + Intergenic
1163490448 19:17614590-17614612 AAGGGGAAAGTCAGAGGTGAGGG + Intronic
1164292512 19:23880701-23880723 AAAGAGAAAGGAAGAGGAGAAGG + Intergenic
1166045017 19:40224846-40224868 CAGGAGAAAGGCAGAGGCACAGG - Intronic
1166182033 19:41116047-41116069 AAGGAGACAGGGAGAGGCCAGGG - Intronic
1166618828 19:44276453-44276475 AACCAGAAGGGCAGAGGTGAGGG - Intronic
1166657156 19:44620701-44620723 ACTGAGAATGGCATAGGCGAAGG - Intronic
1167452747 19:49581633-49581655 TACGAGAGAGGCAGAGGCAGGGG - Intronic
925459688 2:4049771-4049793 AACTAGAAGGTCAGAGGCAAAGG - Intergenic
925807093 2:7661194-7661216 GATGAGAAAGGGAGAGGGGAAGG + Intergenic
925874740 2:8302186-8302208 AGAGAGAGAGGCAGAGGCGCAGG - Intergenic
926297243 2:11577748-11577770 AACAAGAAAAGCAGAGAGGAAGG - Intronic
926570570 2:14525344-14525366 AAAGAGGAAGGAAGAGGAGAAGG + Intergenic
926610460 2:14941539-14941561 AAGGAGGAAGGCAGAGCAGATGG + Intergenic
928059167 2:28092737-28092759 AGAGAGAGAGGCAGAGACGAAGG - Intronic
929197669 2:39202817-39202839 AATGAGAAAGGCAAAGGAGGGGG - Intronic
930012947 2:46951544-46951566 AAAGAGAGAGACAGAGGGGAAGG - Intronic
930573365 2:53114373-53114395 AGAGAGAAAGGCAGATGCAAAGG + Intergenic
930711484 2:54554921-54554943 AACGAGAAAGGAGGAGGAGGAGG - Intronic
931760952 2:65416559-65416581 AACAAGAAAAGCAGAGGGGAGGG + Intronic
933429071 2:82151454-82151476 AAAGACAAAGGCAGGGGCCAAGG + Intergenic
934983635 2:98868804-98868826 AAAGAGAAAGGGAGAGGGAAAGG - Intronic
936090196 2:109496896-109496918 GAAGAGAGAGGCAGAGGAGAAGG + Intronic
936381218 2:111988199-111988221 AAGGAGACAGGAAGAGGCGGTGG - Intronic
936595198 2:113840846-113840868 ACCTGGAAAGGCAGAGGAGAGGG - Intergenic
936866581 2:117081710-117081732 AAATAGAAAGGTAGAGGCAAAGG - Intergenic
937322838 2:120971301-120971323 AACGACAATGCCAGAGGTGAAGG + Intronic
937440056 2:121907891-121907913 ACAGAGAGAGGCAGAGGCGAAGG + Intergenic
937577741 2:123444577-123444599 AACCAGAAAGGCACAGAAGAGGG - Intergenic
938175878 2:129128358-129128380 AAGGAGAAAGGAAGAGGAGTTGG - Intergenic
938905693 2:135833888-135833910 AAGGAGAATGGCAGAGGCCAGGG - Intronic
941213028 2:162666896-162666918 AACAAGAAAGTCAGAGGACATGG - Intronic
941500771 2:166273023-166273045 CATGAGAGAGACAGAGGCGAGGG + Intronic
942677404 2:178442436-178442458 AATAAGAAAGGCACAGGGGATGG + Intronic
943675809 2:190715597-190715619 TTCCAGAAAGGCAGAGGCCAGGG + Intergenic
944670341 2:201989239-201989261 AACGGCAAGGGCAGAGGCGCTGG + Intergenic
946309610 2:218876018-218876040 AACAATAGATGCAGAGGCGAGGG - Intergenic
946816246 2:223581800-223581822 AAGGAGGAAAGCAGAGGAGATGG - Intergenic
948493047 2:238326276-238326298 AAGGAGAAAGCCAGAGGGCATGG - Intronic
1169000093 20:2162290-2162312 AGCAAGGAAGACAGAGGCGAGGG - Intronic
1169806883 20:9568579-9568601 AAAGAAAAAGGCAGAGATGATGG + Intronic
1170545697 20:17434108-17434130 AGAGAGAAAGGGAGAGGAGAAGG - Intronic
1170876961 20:20258993-20259015 AACAAGAAAGGGAAAGGAGAGGG - Intronic
1172806963 20:37619018-37619040 AAGGAGAAAGGGAGAGGAGAGGG - Intergenic
1173153556 20:40588420-40588442 GACAGGAAAGGCAGAGGCAATGG - Intergenic
1173338210 20:42130441-42130463 AAGGAGAAAGGGAGAAGCCAGGG - Intronic
1173838672 20:46142009-46142031 AAGGGGAGAGGCAGAGGCGTGGG - Intergenic
1173868406 20:46327524-46327546 AAGGAGAAAGGCAGGGCCGATGG + Intergenic
1174816603 20:53692505-53692527 AATGAGAGAGTCAGAGGCTACGG - Intergenic
1175413352 20:58785731-58785753 AAAGAGAGAGACAGAGGGGAAGG + Intergenic
1175653422 20:60748708-60748730 ACAGAGAATGGCAGAGGTGATGG + Intergenic
1175731890 20:61359674-61359696 AGCAAGAAAGGCAGAGAGGAAGG + Intronic
1176017108 20:62939894-62939916 AAAGAGAAAGACAGAGTGGACGG + Intronic
1176222475 20:63976368-63976390 AAGGAGAGAGGCAGAGGGAAAGG + Intronic
1178545840 21:33492175-33492197 AAAGAAAAAGGCAGAGGCTTGGG + Intergenic
1178754060 21:35331191-35331213 AAAGAGAGAGGCAGAGGAAATGG - Intronic
1179887138 21:44319008-44319030 TACGGGGAAGGCAGAGGCGAGGG + Intronic
1180787774 22:18556612-18556634 AACGGGGATGGCAGAGGCCAGGG + Intergenic
1181233963 22:21438694-21438716 AACGGGGATGGCAGAGGCCAGGG - Intronic
1181244685 22:21496137-21496159 AACGGGGATGGCAGAGGCCAGGG + Intergenic
1181876831 22:25946077-25946099 AATGAGAAGGGAAGAGGGGAAGG - Intronic
1182005608 22:26956984-26957006 AGAGAGAAAGGCAGAGGAGAAGG - Intergenic
1182073437 22:27478850-27478872 ACCCAGGAAGGCAGAGGGGAGGG + Intergenic
1183662600 22:39230395-39230417 TACGAGAAGGGCAGAGGTCAAGG - Intronic
1184380678 22:44143341-44143363 AAGGAGAAAGGCAGGGGCTGTGG - Intronic
1184762406 22:46551957-46551979 AAGAAGAAAGGCAGGGGCTAAGG - Intergenic
950556885 3:13701364-13701386 AGCGAGAAGGGCAGAGTGGAGGG - Intergenic
950598958 3:14014178-14014200 AACTAGAAAAGTAGAGGAGATGG - Intronic
952684165 3:36130525-36130547 AATGAGAAAGGGAGAGACCAAGG + Intergenic
957239819 3:77643987-77644009 AACGTGAAAGACAGAGGGGATGG + Intronic
957470114 3:80648511-80648533 AGAGAGAAAGGGAGAGGAGAGGG + Intergenic
957881289 3:86216505-86216527 AAAGAGAAAAGGAGAGGAGAAGG + Intergenic
958079322 3:88725664-88725686 AATGAGAAAGGCAGAAGCAAGGG - Intergenic
958896407 3:99834674-99834696 AATGAGAAAGACACAGGAGAGGG - Intronic
962672434 3:137722689-137722711 AAGGACAAAGGCAGAAGCTAGGG - Intergenic
962685410 3:137842939-137842961 AAGGAGAATGGCAGAGGTGATGG - Intergenic
964537108 3:157735072-157735094 CATGAGAAAGGCAGAGACAAAGG + Intergenic
965943603 3:174212936-174212958 AAAGAGAAAGGCAGAAGAGAAGG - Intronic
969046337 4:4339300-4339322 GCCGAGAAAGGTAGAGGGGATGG - Intergenic
969212249 4:5696668-5696690 AAGGAGAAAGGCAGAGCCGTAGG + Intronic
969246115 4:5933920-5933942 GACGAGACAGGAAGAGGAGAGGG + Intronic
969483938 4:7461314-7461336 GAAGATAAAGGCAGAGGGGAAGG - Intronic
969698427 4:8749067-8749089 GCCGAGAAAGGGAGAGGAGAAGG + Intergenic
969819717 4:9710632-9710654 AGCGAGAAGGGGAGAGGCCAGGG + Intergenic
970369855 4:15395647-15395669 ATAGAGAAAGGCAGGGCCGAGGG + Intronic
970690342 4:18612656-18612678 AAGGAGAAAGGCAGAGAGGGAGG + Intergenic
971402366 4:26287725-26287747 AACGAGAAAGGGAGGGAGGAAGG + Intronic
974417916 4:61634982-61635004 CATGAGAAAGACTGAGGCGAGGG + Intronic
975749129 4:77504997-77505019 AAGGAGAAGGCCAGAGGGGAAGG + Intergenic
976053257 4:81032075-81032097 AAGGAGAAAAGGAGAGGGGAAGG - Intronic
976153854 4:82121260-82121282 AAAGAGAAAGGAAAGGGCGAAGG + Intergenic
976605520 4:86979085-86979107 AAAAAGAGAGGCAGAGGCAAAGG - Intronic
976637797 4:87304693-87304715 AATGAAAAAGGAAGAGGCTAGGG + Exonic
976685080 4:87804820-87804842 AGGGAGAAAGCCAGAGGTGAAGG + Intronic
978422196 4:108544537-108544559 AACAAGAACTGCAGAGGAGAAGG + Intergenic
981330187 4:143499508-143499530 AAAGAGAAGGGAAGAGGAGAAGG - Intergenic
982497584 4:156110107-156110129 AATGAGCAAGGCAGATGCTATGG + Intergenic
984345844 4:178524163-178524185 AAAAAGAAGGGCAGAGGAGATGG - Intergenic
985587894 5:750429-750451 AAGGAGAGACGCAGAGGGGAGGG - Intronic
985888114 5:2695895-2695917 AAGAAAAAAGGCAGAGGAGAGGG - Intergenic
986209169 5:5654086-5654108 AAAGAGAGAGGCAGAGGCAAGGG - Intergenic
986444192 5:7807301-7807323 AAAGATAAAGGCAGTGGCTATGG - Intronic
988931344 5:36038556-36038578 AACTGGAAATACAGAGGCGAAGG - Intronic
989139966 5:38192420-38192442 AACAAGAGTGGCAGAGGCCAGGG - Intergenic
989573045 5:42962917-42962939 AACCAGAAAGTAAGAGGCAAGGG - Intergenic
990131496 5:52591348-52591370 AAGGTGAAAGGCAGAGGCCAAGG + Intergenic
990197336 5:53333567-53333589 AACTAGAAAGTGAGAGGGGATGG + Intergenic
990343405 5:54847870-54847892 AACGAACAAGGCAGAGGCGCAGG + Intergenic
991620391 5:68539234-68539256 AAGGAGAGAGGGAGAGGCTATGG + Intergenic
992127940 5:73661688-73661710 AAGGAGAGAGGCAGAGAAGAGGG + Intronic
992889537 5:81191215-81191237 AACAAGCAAGGCAGAGCCGTGGG - Intronic
993645860 5:90460845-90460867 AACAAGAAAAACAGAGGCAAGGG + Exonic
995060162 5:107804921-107804943 AAAGAAAAAGGCAGAAGAGAAGG - Intergenic
995377550 5:111493028-111493050 AAAATGAAAGGCAGAGGTGAAGG + Exonic
995586555 5:113654531-113654553 AAGAAGAAAGGCAGAGTAGATGG + Intergenic
996114918 5:119607540-119607562 AGCGAGAAAGGCAGACCCAAAGG + Intronic
996351613 5:122548994-122549016 ACCTAGAAAAGCAGAGGGGAAGG + Intergenic
997203241 5:132025629-132025651 AACGACAAATGCAGAGTCCATGG + Intergenic
997242000 5:132314494-132314516 AATGAGAGAAGCAGAGGTGAGGG + Intronic
998395019 5:141812665-141812687 AAAGAGAAAGGAAGAGGAGGAGG + Intergenic
999232234 5:150068494-150068516 CCCGAGAAAGGCAGAGAGGACGG + Intronic
1003334748 6:5159901-5159923 AATGAGAAAGGCATAGACAAGGG - Intronic
1004310456 6:14540608-14540630 AAAGAGAAAGGCAGAAGGGAAGG - Intergenic
1005146813 6:22701046-22701068 AAAGAGAGAGGCAGAAGAGAAGG - Intergenic
1005561076 6:27041368-27041390 AGAGAGAAAGGGAGAGGGGAAGG + Intergenic
1006382055 6:33704683-33704705 CAGGAGAGAGGCAGAGGCTATGG - Intronic
1007192530 6:40031747-40031769 AAGGAGCAAGGCAGATGCCAAGG - Intergenic
1007249884 6:40488372-40488394 AAGGAGCAAGGCAGAGGGAATGG - Intronic
1007291497 6:40790750-40790772 AAGGAGAAAGGGAGAGAGGATGG + Intergenic
1008427736 6:51379346-51379368 AGGGAGAAAGGAAGAGGGGAGGG + Intergenic
1009390777 6:63140633-63140655 AAAGAGAAGGGAAGAGGGGAAGG + Intergenic
1013826135 6:114213461-114213483 ACCGAGAAAGGCAGAGTCCCTGG - Intronic
1014737976 6:125117266-125117288 AACAAGAATGGCAGAGGTGGAGG - Intergenic
1015236166 6:130973743-130973765 ATCTAGAAAGGCAGTGGGGAGGG - Intronic
1019410778 7:905726-905748 AAGGAGAAAGGGAAAGGAGAAGG + Intronic
1019508599 7:1405763-1405785 AATGAGAAAGGCAGGTGAGAGGG - Intergenic
1020041266 7:5003827-5003849 AAAAAGAAAGCCAGAGGCGAAGG - Intronic
1022003061 7:26244300-26244322 AACGAAAATGGCAGCGGTGACGG + Intergenic
1022076701 7:26978413-26978435 AAAGAGAAGAGCAGAGGCCAAGG - Intronic
1023042725 7:36186243-36186265 ACCGAGAAAGGCAGAAGGAAGGG - Intronic
1023682308 7:42699923-42699945 AGTGAGAAATGCAGAGACGATGG + Intergenic
1025934507 7:66024217-66024239 AACCTGAAAGGCAGAGGCTGCGG - Intergenic
1026285829 7:68962055-68962077 AACCAGGAAGGCAGAGGCTGCGG + Intergenic
1029895805 7:103982552-103982574 AAGGAGAAAGGAAGAGGAGAGGG + Intronic
1030021432 7:105278773-105278795 AAGGAGAAAGGGGAAGGCGAAGG + Intronic
1032122084 7:129163946-129163968 AAAGAGAAAGGGAGAGGGGAGGG + Intronic
1032740048 7:134729736-134729758 AAGAAGAAAGGCAGAGGACAGGG + Intergenic
1032760223 7:134933690-134933712 AAGGAGAGAGGCAGAAGAGAGGG + Exonic
1032948711 7:136882415-136882437 GAGGAGAAAGGAAGAGGAGAAGG - Intronic
1033327546 7:140392100-140392122 AAAGAGAAAGGGAGGGGAGAGGG - Intronic
1035175345 7:157046165-157046187 AAGGAGAAAGGCAGGGGCTGGGG + Intergenic
1036235921 8:7039404-7039426 CAGGAGAAAGGCAGAGAGGAGGG + Intergenic
1036583421 8:10099975-10099997 CAGGACAAAGGCAGAGGGGATGG + Intronic
1036756495 8:11474796-11474818 AAGGAGAAAGGGAGAGGAAAAGG + Intergenic
1040522740 8:48192524-48192546 AACTAGAAAGGTAGAAGAGAAGG + Intergenic
1043490969 8:80748781-80748803 AACGAGGAAGGGAGAGAAGAAGG + Intronic
1045231996 8:100314685-100314707 AATGAGCCAGGCAGAGGAGAGGG - Intronic
1045502541 8:102754337-102754359 AGCGAGAAGGCCAGAGGCGTGGG - Intergenic
1047831693 8:128639025-128639047 AACAATGAAGGCAGAGGTGATGG + Intergenic
1049124990 8:140778694-140778716 AACGAGTAGGGCAGAGATGATGG + Intronic
1050260266 9:3834262-3834284 AACTAGAAAGGGAGTGGGGAAGG + Intronic
1052842680 9:33306522-33306544 AGAGAGAAAAGCAGAGGCCATGG + Intronic
1053061593 9:35036253-35036275 GAAGGGAAAGGCAGAGGGGAGGG + Intergenic
1055074583 9:72200396-72200418 GACGAGAAAGGAGGAGGAGAAGG - Intronic
1055524813 9:77121264-77121286 AAGGAGAACTGCAGAGGAGAAGG + Intergenic
1056800915 9:89690869-89690891 AACGAGAGGGACAGAGGGGAGGG - Intergenic
1057130532 9:92651400-92651422 GAGGAGAAAGGGAGAGGCGAAGG + Intronic
1059354264 9:113687191-113687213 AAAGAGGAAGGCAGAGAGGAGGG + Intergenic
1060389390 9:123266732-123266754 AACTAGAAAGGCATAGGTGATGG - Intronic
1061370714 9:130195950-130195972 ACCGAGGGAGGCAGAGGCGGAGG + Intronic
1185887073 X:3792488-3792510 CAAGAGAAAGGAAGAGGGGAAGG + Intergenic
1186171233 X:6879203-6879225 AAGGAAAAAGGCAGAGGCCAAGG + Intergenic
1186591452 X:10934237-10934259 AACAAGAAAGGAAGAGGAGAAGG - Intergenic
1188782044 X:34297254-34297276 AACAAGACTGGCAGTGGCGAAGG - Intergenic
1189204776 X:39228306-39228328 AAAGAGAAAGACAGAGGGAAGGG + Intergenic
1191836650 X:65470379-65470401 AACCAGAAAGGGAGAGGAGATGG + Intronic
1192206875 X:69102176-69102198 AAAGTGAAAGGCAGAGGGTAGGG - Intergenic
1193724956 X:85027208-85027230 AAGGAGAAAGGGAGAAGGGAAGG + Intronic
1195170037 X:102258450-102258472 ACAGAGAAAGGAAGAGGCAAGGG - Intergenic
1195188820 X:102428650-102428672 ACAGAGAAAGGAAGAGGCAAGGG + Intronic
1198024342 X:132690518-132690540 AAGGAGAAAGGAAGAGGTTAAGG - Intronic
1199143007 X:144334127-144334149 AGAAAGGAAGGCAGAGGCGAGGG - Intergenic
1199601988 X:149546509-149546531 CTCCAGAAAGGCAGAGGAGAGGG - Intronic
1199648400 X:149932975-149932997 CTCCAGAAAGGCAGAGGAGAGGG + Intronic
1201297450 Y:12476330-12476352 AAAGAGAGAGGGAGAGGCAAAGG - Intergenic