ID: 922753810

View in Genome Browser
Species Human (GRCh38)
Location 1:228083117-228083139
Sequence AACGAGAAAGGCAGAGGCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 0, 3: 36, 4: 282}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922753810_922753818 3 Left 922753810 1:228083117-228083139 CCCTCGCCTCTGCCTTTCTCGTT 0: 1
1: 0
2: 0
3: 36
4: 282
Right 922753818 1:228083143-228083165 CGAGGCCGCCCGCGCGTGGACGG 0: 1
1: 0
2: 0
3: 6
4: 86
922753810_922753829 29 Left 922753810 1:228083117-228083139 CCCTCGCCTCTGCCTTTCTCGTT 0: 1
1: 0
2: 0
3: 36
4: 282
Right 922753829 1:228083169-228083191 GGATTAGCGGCCGCGGGGGCCGG 0: 1
1: 0
2: 0
3: 8
4: 126
922753810_922753828 25 Left 922753810 1:228083117-228083139 CCCTCGCCTCTGCCTTTCTCGTT 0: 1
1: 0
2: 0
3: 36
4: 282
Right 922753828 1:228083165-228083187 GTTGGGATTAGCGGCCGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 48
922753810_922753824 16 Left 922753810 1:228083117-228083139 CCCTCGCCTCTGCCTTTCTCGTT 0: 1
1: 0
2: 0
3: 36
4: 282
Right 922753824 1:228083156-228083178 GCGTGGACGGTTGGGATTAGCGG 0: 1
1: 0
2: 0
3: 0
4: 48
922753810_922753815 -1 Left 922753810 1:228083117-228083139 CCCTCGCCTCTGCCTTTCTCGTT 0: 1
1: 0
2: 0
3: 36
4: 282
Right 922753815 1:228083139-228083161 TTCCCGAGGCCGCCCGCGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 82
922753810_922753827 24 Left 922753810 1:228083117-228083139 CCCTCGCCTCTGCCTTTCTCGTT 0: 1
1: 0
2: 0
3: 36
4: 282
Right 922753827 1:228083164-228083186 GGTTGGGATTAGCGGCCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
922753810_922753821 8 Left 922753810 1:228083117-228083139 CCCTCGCCTCTGCCTTTCTCGTT 0: 1
1: 0
2: 0
3: 36
4: 282
Right 922753821 1:228083148-228083170 CCGCCCGCGCGTGGACGGTTGGG 0: 1
1: 0
2: 0
3: 1
4: 30
922753810_922753825 22 Left 922753810 1:228083117-228083139 CCCTCGCCTCTGCCTTTCTCGTT 0: 1
1: 0
2: 0
3: 36
4: 282
Right 922753825 1:228083162-228083184 ACGGTTGGGATTAGCGGCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 24
922753810_922753819 7 Left 922753810 1:228083117-228083139 CCCTCGCCTCTGCCTTTCTCGTT 0: 1
1: 0
2: 0
3: 36
4: 282
Right 922753819 1:228083147-228083169 GCCGCCCGCGCGTGGACGGTTGG 0: 1
1: 0
2: 1
3: 2
4: 37
922753810_922753826 23 Left 922753810 1:228083117-228083139 CCCTCGCCTCTGCCTTTCTCGTT 0: 1
1: 0
2: 0
3: 36
4: 282
Right 922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922753810 Original CRISPR AACGAGAAAGGCAGAGGCGA GGG (reversed) Intronic