ID: 922753811

View in Genome Browser
Species Human (GRCh38)
Location 1:228083118-228083140
Sequence AAACGAGAAAGGCAGAGGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 336}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922753811_922753828 24 Left 922753811 1:228083118-228083140 CCTCGCCTCTGCCTTTCTCGTTT 0: 1
1: 0
2: 2
3: 32
4: 336
Right 922753828 1:228083165-228083187 GTTGGGATTAGCGGCCGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 48
922753811_922753821 7 Left 922753811 1:228083118-228083140 CCTCGCCTCTGCCTTTCTCGTTT 0: 1
1: 0
2: 2
3: 32
4: 336
Right 922753821 1:228083148-228083170 CCGCCCGCGCGTGGACGGTTGGG 0: 1
1: 0
2: 0
3: 1
4: 30
922753811_922753826 22 Left 922753811 1:228083118-228083140 CCTCGCCTCTGCCTTTCTCGTTT 0: 1
1: 0
2: 2
3: 32
4: 336
Right 922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 25
922753811_922753819 6 Left 922753811 1:228083118-228083140 CCTCGCCTCTGCCTTTCTCGTTT 0: 1
1: 0
2: 2
3: 32
4: 336
Right 922753819 1:228083147-228083169 GCCGCCCGCGCGTGGACGGTTGG 0: 1
1: 0
2: 1
3: 2
4: 37
922753811_922753829 28 Left 922753811 1:228083118-228083140 CCTCGCCTCTGCCTTTCTCGTTT 0: 1
1: 0
2: 2
3: 32
4: 336
Right 922753829 1:228083169-228083191 GGATTAGCGGCCGCGGGGGCCGG 0: 1
1: 0
2: 0
3: 8
4: 126
922753811_922753825 21 Left 922753811 1:228083118-228083140 CCTCGCCTCTGCCTTTCTCGTTT 0: 1
1: 0
2: 2
3: 32
4: 336
Right 922753825 1:228083162-228083184 ACGGTTGGGATTAGCGGCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 24
922753811_922753815 -2 Left 922753811 1:228083118-228083140 CCTCGCCTCTGCCTTTCTCGTTT 0: 1
1: 0
2: 2
3: 32
4: 336
Right 922753815 1:228083139-228083161 TTCCCGAGGCCGCCCGCGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 82
922753811_922753824 15 Left 922753811 1:228083118-228083140 CCTCGCCTCTGCCTTTCTCGTTT 0: 1
1: 0
2: 2
3: 32
4: 336
Right 922753824 1:228083156-228083178 GCGTGGACGGTTGGGATTAGCGG 0: 1
1: 0
2: 0
3: 0
4: 48
922753811_922753827 23 Left 922753811 1:228083118-228083140 CCTCGCCTCTGCCTTTCTCGTTT 0: 1
1: 0
2: 2
3: 32
4: 336
Right 922753827 1:228083164-228083186 GGTTGGGATTAGCGGCCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
922753811_922753818 2 Left 922753811 1:228083118-228083140 CCTCGCCTCTGCCTTTCTCGTTT 0: 1
1: 0
2: 2
3: 32
4: 336
Right 922753818 1:228083143-228083165 CGAGGCCGCCCGCGCGTGGACGG 0: 1
1: 0
2: 0
3: 6
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922753811 Original CRISPR AAACGAGAAAGGCAGAGGCG AGG (reversed) Intronic
900356801 1:2268860-2268882 AAAGGGGAAAGGCAGAAGGGAGG - Intronic
902434019 1:16385514-16385536 AGGTGAGAAAGGCAGAGGAGAGG - Intronic
903579155 1:24358079-24358101 AAATGAGAAAGGCAGGAGTGAGG + Exonic
905257368 1:36693476-36693498 AAAGGAGGAAGGCAGAGACAGGG + Intergenic
905819466 1:40978903-40978925 AGATGGGAAAGGGAGAGGCGGGG - Intergenic
906513770 1:46426092-46426114 AAACGAGAAAGGCAGTACCAGGG + Intergenic
906524851 1:46488130-46488152 GGACAAGAAAGGCGGAGGCGGGG - Intergenic
909807221 1:79886478-79886500 AAAGCAGAAGGGCAGAAGCGAGG + Intergenic
910102681 1:83595475-83595497 TAAAGAGAGAGGCAGAGCCGGGG - Intergenic
910955363 1:92697460-92697482 AAAGTAAAAAGGCAGAGGAGAGG + Intronic
911506646 1:98761369-98761391 AGAAGAGGAAGACAGAGGCGTGG - Intergenic
912510770 1:110188836-110188858 AAAAGAGAGAGGCAGAGGGGAGG - Intronic
916797244 1:168178795-168178817 AAAGGAGAAAGTCAGAGGGGCGG - Intergenic
917384090 1:174449536-174449558 AAATGAGAAAGACAGAGGCAGGG - Intronic
919234846 1:194827633-194827655 AAACAAAAAAGGCAGAGGAAAGG - Intergenic
919920820 1:202165563-202165585 AACCAAGAAGGGGAGAGGCGGGG - Intergenic
920727554 1:208450352-208450374 AGATGAGAAAGGGAGAGGGGAGG + Intergenic
922753811 1:228083118-228083140 AAACGAGAAAGGCAGAGGCGAGG - Intronic
924603230 1:245509830-245509852 AAGGGAGAAAGGCACAGGTGAGG - Intronic
1062827559 10:583954-583976 AAATGTGAAAGAGAGAGGCGCGG + Intronic
1065446170 10:25803397-25803419 AAACGGGAAAGTCAGAGTCCTGG + Intergenic
1065483088 10:26213834-26213856 AAAAGAGAATGGCAAAGGCTTGG + Intergenic
1065829591 10:29602688-29602710 AAAAAAGAAAGGGAGAGGCCGGG + Intronic
1066374161 10:34842432-34842454 AAAAGAAAAAGGAAGAGGTGGGG + Intergenic
1067824476 10:49560153-49560175 TTACAAGAAAGGCAGAGGCGGGG - Intergenic
1069843654 10:71355781-71355803 AAACAGGAAAGGCAGAGGACTGG + Intronic
1071965941 10:90852851-90852873 AAACTAGAAAAGGAGAGGAGGGG + Intronic
1072484264 10:95839756-95839778 AAAGGAGAATGACACAGGCGTGG + Exonic
1072503630 10:96043508-96043530 AGACGAGATTGGCAGCGGCGGGG + Intronic
1072661403 10:97365795-97365817 AAAGGAGAAAGGAAGAGGAGGGG + Intronic
1072884376 10:99260793-99260815 TAAAGAGAAAGGCAGAGACACGG - Intergenic
1073542817 10:104326807-104326829 AAAAGAGAGAGACAGAGGAGAGG + Intronic
1074911135 10:117910138-117910160 AGAGGTGACAGGCAGAGGCGAGG - Intergenic
1075083638 10:119399965-119399987 AAGCGAGAAAGACAGAGTAGGGG - Intronic
1075663234 10:124212800-124212822 AGAAGAGAAAGGCAGAGGAAGGG - Intergenic
1079841256 11:25402513-25402535 CAAAGAGAAAGACAGAGGTGGGG - Intergenic
1080709728 11:34735085-34735107 AAAAGAGAAAGGCAGAAGAGTGG + Intergenic
1080897566 11:36459154-36459176 ACCTGAGAGAGGCAGAGGCGTGG - Intronic
1081584526 11:44375395-44375417 AAATGAGAAAGGGAGAGAAGGGG + Intergenic
1081736211 11:45406189-45406211 ACAGGAGAAAGGCTGAGGAGAGG - Intergenic
1081782611 11:45723613-45723635 AAAGGAGAGAGGAGGAGGCGTGG - Intergenic
1082985241 11:59163291-59163313 GAAGGAGAAAGGGAGAGGTGGGG + Intergenic
1083810499 11:65102767-65102789 AAACAATAAAAGCAGAGCCGAGG - Intronic
1084697783 11:70766234-70766256 CAGCAAGAAAGGCAGAGGCCAGG + Intronic
1086029418 11:82336054-82336076 AAACGAGCAATGCAGAAGTGGGG + Intergenic
1086811156 11:91311856-91311878 AAACAAAAAAGGCAGAGGCAGGG - Intergenic
1086921426 11:92592079-92592101 AAACGAGAAACGATGAGGTGGGG + Intronic
1087118736 11:94550652-94550674 ATAGAAGAAAGGCAGAGGCTAGG + Intronic
1087358227 11:97122459-97122481 GAACGAGGAAGGCAGAAGAGTGG - Intergenic
1087726265 11:101720384-101720406 ATACAAGAAAGGCAGAGACACGG + Intronic
1087797635 11:102471405-102471427 AAAAAAGAAAGAAAGAGGCGGGG - Intronic
1088547830 11:110979482-110979504 AAAGGAGGAAGGGAGAGGCTGGG - Intergenic
1089019970 11:115203350-115203372 AAAAGAGGAAGGCAGAGGGGAGG + Intronic
1091388981 12:113844-113866 GAAAGAGAAAGAGAGAGGCGAGG + Intronic
1093268988 12:17035616-17035638 GAAGGAGAAAGGCAGAGGCTAGG + Intergenic
1093762118 12:22922233-22922255 CAAGGAGAAGGGCAGAGGCAAGG + Intergenic
1094041147 12:26122740-26122762 CCGCGAGAAAGGCAAAGGCGCGG - Exonic
1094079385 12:26516152-26516174 AAAAGAGAAGGGGAGAGGAGAGG + Intronic
1095743843 12:45635616-45635638 AAGCGAGAAAGGCCTAGGCAGGG + Intergenic
1098982059 12:76967088-76967110 AAATAAGAATGGCTGAGGCGAGG - Intergenic
1099187313 12:79529691-79529713 TAAAGAGGAAGGCAGAGGCTGGG - Intergenic
1100242810 12:92726773-92726795 AAAGGAGAAGGGCAGAGGAAAGG + Intronic
1100566887 12:95804529-95804551 AAAAGTGAAATGCAGAGGCGGGG - Intronic
1101529786 12:105563346-105563368 AAAAAAGAAAGACAGAGGAGAGG - Intergenic
1102458817 12:113087574-113087596 AAAGGAGAAAGGGAGAGGGTGGG + Intronic
1102948456 12:117011094-117011116 AAACAAGGAAAGAAGAGGCGGGG - Intronic
1103542917 12:121678800-121678822 GAACCAGAAAGACTGAGGCGGGG - Intergenic
1103791497 12:123475215-123475237 TAAAAAGAAAGGCAGAGGAGGGG - Intronic
1103844070 12:123889156-123889178 AAACGAGAAGGGCGGAAGCAGGG - Intronic
1103888008 12:124217212-124217234 GAGGGAGAAAGGCAGAGGTGGGG - Intronic
1103904070 12:124318575-124318597 AAAGGACAAAGGCAGAGGTGGGG - Intergenic
1106602425 13:31199726-31199748 AGAGGAGAAAGGAAGAGGAGGGG + Intergenic
1107220907 13:37978810-37978832 AAAAGGGAAAGGGAGAGGAGAGG + Intergenic
1107812463 13:44213500-44213522 AATCCAGGAAGGCAGAGGTGAGG - Intergenic
1108104694 13:46996502-46996524 AGAGGAGAATGGCAGAGGAGGGG + Intergenic
1109444918 13:62423410-62423432 AAATGAGAGAGGAAGAGGAGAGG + Intergenic
1111653534 13:91124062-91124084 AAACCAGCAAGGCAAAGGCTGGG - Intergenic
1113010961 13:105765143-105765165 AAAGGAGAGAGGGAGAGGAGGGG - Intergenic
1113295994 13:108959207-108959229 AAAGGAGAAAAACAGAGGCCGGG - Intronic
1115381930 14:32749832-32749854 AGATGAGAAAGGAAGAGGCTAGG - Intronic
1117532575 14:56673973-56673995 TTAAGAGAAAGGCAGAGGTGAGG + Intronic
1117670716 14:58102836-58102858 AAAAGAGTAAGGCAGAGGTCAGG + Intronic
1118298873 14:64596146-64596168 AAACAAAAAAGGTAGAGGAGTGG - Intergenic
1119855003 14:77893056-77893078 AAAAGAAAAAGGCAGAGCCAGGG + Intronic
1122552376 14:102556953-102556975 CAACAAAAAAGGCAGAGGAGTGG + Intergenic
1123923260 15:25085584-25085606 AAAGGAGAATGGCAGGGGAGTGG + Intergenic
1124910835 15:33918906-33918928 AAAACAGAAAAGCAGAGGCATGG - Intronic
1127847784 15:62886573-62886595 AAACAAGACAGACAGAGACGGGG + Intergenic
1127915512 15:63451663-63451685 AAAAGAGGAAGGGAGAGGCCGGG - Intergenic
1128844583 15:70879653-70879675 AAAAGAGGAAGCCAGAGGGGAGG - Intronic
1129696220 15:77741954-77741976 AAGGGAGAAAGGCAGAGGGGGGG + Intronic
1129995246 15:79998962-79998984 AAACAAGAATAGCAGAGGCCAGG + Intergenic
1130206410 15:81879631-81879653 AGAGGAGAAAGGCAGAGGCAAGG + Intergenic
1130367609 15:83254374-83254396 AAACCAGAAAGGCTGAGCCAGGG + Intergenic
1130748073 15:86677392-86677414 GAAGGAGAAAGGAAGAGGAGAGG - Intronic
1131310222 15:91283951-91283973 GAGAGAGAAAGGCAGAGGCAGGG - Intronic
1133926644 16:10198223-10198245 AAAGGCAAAAGGCAGAAGCGGGG + Intergenic
1134398168 16:13884634-13884656 AAACAAAAAACGCAGAGGCCAGG - Intergenic
1135027043 16:19006569-19006591 AAACGTTAAAGTCAGAGGGGTGG - Intronic
1135423942 16:22323054-22323076 GGAGGAGAAAGGCAGAGGCCAGG - Intronic
1135479068 16:22806028-22806050 GCACTAGAAAGGCAGAGGTGAGG + Intergenic
1136219004 16:28815808-28815830 AAACCTGGAAGGCAGAGGCTGGG - Intergenic
1136372919 16:29847428-29847450 AAACCAGGAAGGCAGAGCCAAGG + Intronic
1136416424 16:30107002-30107024 AAAAGAAAAATGCAGAGGCAGGG - Intronic
1136617398 16:31406878-31406900 CATGGAGAAAGGCAGAGGCCCGG + Intronic
1136871102 16:33808737-33808759 ACATGAGGCAGGCAGAGGCGCGG + Intergenic
1139314799 16:66059096-66059118 AAAGGAGGAAGGCAGTGGAGAGG - Intergenic
1140259640 16:73366434-73366456 AAAAGAGAAAGACAGGGGCTGGG + Intergenic
1140584867 16:76277446-76277468 AAAAGAGAGAGACAGAGACGGGG + Intronic
1140758286 16:78088637-78088659 GAAAGAGGAAGGCAGAGGGGAGG - Intergenic
1141062943 16:80891689-80891711 TCACGACAAAGGCAGAGGCCAGG - Intergenic
1141922438 16:87145101-87145123 CAAATAGAAAGGCAGAGGTGAGG + Intronic
1141930630 16:87200135-87200157 AAATGAGAAAGGCAGTGTTGAGG + Intronic
1203101070 16_KI270728v1_random:1307321-1307343 ACATGAGGCAGGCAGAGGCGCGG - Intergenic
1142656928 17:1400423-1400445 GAACGAGAAGGGCTGAGGCGGGG + Intergenic
1143214382 17:5213530-5213552 AAAAGAGATAGCCAGAGGCCAGG - Intronic
1143671106 17:8396755-8396777 AAGCGAGAGAGGCAGAGGGAGGG - Intronic
1144200205 17:12934175-12934197 AAATGAGAAAAACAGAGACGTGG - Intronic
1145951964 17:28825507-28825529 AGATGACAAAGGCAGAGGCTAGG - Intronic
1146639892 17:34532448-34532470 AGAGGAGAAAGGCAGAGGTTTGG - Intergenic
1146695581 17:34907078-34907100 AAAAAAGAAATGCAGAGGCCAGG + Intergenic
1147819512 17:43233280-43233302 AAAAGAGCGAGGGAGAGGCGGGG + Intergenic
1147820604 17:43239428-43239450 AAAAGAGCGAGGGAGAGGCGGGG + Intergenic
1147820816 17:43240693-43240715 AAAAGAGCGAGGGAGAGGCGGGG + Intergenic
1147821626 17:43245162-43245184 AAAAGAGCGAGGGAGAGGCGGGG + Intergenic
1147822720 17:43251320-43251342 AAAAGAGCGAGGGAGAGGCGGGG + Intergenic
1147825237 17:43266116-43266138 AAAAGAGCGAGGGAGAGGCGGGG + Intergenic
1147826078 17:43270851-43270873 AAAAGAGCGAGGGAGAGGCGGGG + Intergenic
1147826357 17:43272628-43272650 AAAAGAGCGAGGGAGAGGCGGGG + Intergenic
1147827245 17:43277480-43277502 AAAAGAGCGAGGGAGAGGCGGGG + Intergenic
1147828357 17:43283636-43283658 AAAAGAGCGAGGGAGAGGCGGGG + Intergenic
1147829467 17:43289800-43289822 AAAAGAGCGAGGGAGAGGCGGGG + Intergenic
1147830558 17:43295935-43295957 AAAAGAGCGAGGGAGAGGCGGGG + Intergenic
1147831242 17:43299523-43299545 AAAAGAGCGAGGGAGAGGCGGGG + Intergenic
1148089823 17:45016649-45016671 CAAAGAGAAAGGCTGAGGCTGGG - Intergenic
1148860078 17:50600179-50600201 AGACGAGAAAGGGGGATGCGGGG - Intronic
1150009054 17:61488032-61488054 AAACGGGAAAGGAAAAGACGAGG + Intergenic
1150602605 17:66663762-66663784 AAAGGAGAAAGGGAGGGCCGGGG - Intronic
1152270059 17:79319301-79319323 ACAGCAGAAAGGAAGAGGCGAGG + Intronic
1153671902 18:7419587-7419609 AAAGGAGAAAGGGAGAGTGGTGG + Intergenic
1154298922 18:13175629-13175651 AAAGGAGAAAGCCAGAGAAGGGG + Intergenic
1155266403 18:24098557-24098579 AAGCAAGAAAGGGAGAGGAGAGG - Intronic
1156403548 18:36761622-36761644 GAACGGGACAGGCAGAGGAGCGG - Intronic
1156631577 18:38975666-38975688 AAAAGAGAAAAGCAGAGGATAGG + Intergenic
1156854344 18:41764793-41764815 CAACGAGAAAGGCAGTGGCTGGG - Intergenic
1157410018 18:47455656-47455678 AAAAGAAAAAGGCAGGGGGGCGG - Intergenic
1157436537 18:47674871-47674893 AAAAGAGAAAGAGAGAGGTGGGG + Intergenic
1161803513 19:6429396-6429418 AAGGGAGAAAGGAAGAGGGGAGG + Intronic
1162091622 19:8284040-8284062 AAAAAAAAAAGGCAGAGGGGAGG + Intronic
1162093859 19:8298888-8298910 AAAAAAAAAAGGCAGAGGGGAGG + Intronic
1164546175 19:29164966-29164988 AAATGAGACAGGGAGAGGCCAGG - Intergenic
1166430375 19:42720854-42720876 AAAGGAGACAGGCAGAAGCAAGG + Intronic
1166524669 19:43503799-43503821 AAACCAGAAAGACAGAGACCCGG - Intronic
1166618829 19:44276454-44276476 CAACCAGAAGGGCAGAGGTGAGG - Intronic
1167452748 19:49581634-49581656 TTACGAGAGAGGCAGAGGCAGGG - Intronic
1167559098 19:50214881-50214903 AAACCAGCCAGGCCGAGGCGGGG - Intronic
1167718517 19:51160838-51160860 AGGAGAGAAAGGCAGAGGAGGGG + Intergenic
925222521 2:2153529-2153551 AGAGGAGGAAGGCAGAGGCTGGG + Intronic
925572206 2:5324710-5324732 AAATGAAAAAGCCAGAGGTGGGG - Intergenic
925787360 2:7445771-7445793 AAACTAGACAGACAGAGGCTGGG - Intergenic
925900430 2:8505470-8505492 ATGCGGGAGAGGCAGAGGCGTGG - Intergenic
926605341 2:14892265-14892287 AAAAGAGAAAGGCAGACAGGAGG + Intergenic
927054031 2:19353846-19353868 AAAAGAAGAAGGCAGGGGCGTGG + Intronic
928137770 2:28701289-28701311 AAACCACAAAGGCAGCGGCCGGG + Intergenic
928325637 2:30317412-30317434 GAACAGGAAAAGCAGAGGCGAGG + Intronic
928516276 2:32047757-32047779 AAAAGACAAAGTCAGAGGCCAGG + Intergenic
929197670 2:39202818-39202840 TAATGAGAAAGGCAAAGGAGGGG - Intronic
929690746 2:44070693-44070715 AGACGTCAAAGGCAGAGGAGAGG + Intergenic
929701728 2:44168668-44168690 AAATTAGAAACCCAGAGGCGGGG + Intronic
931149860 2:59560852-59560874 ACGAGAGAAAGGCAGAGGGGAGG + Intergenic
931476193 2:62590171-62590193 AAAAGACAAATGCAGAGGCGAGG + Intergenic
931760951 2:65416558-65416580 TAACAAGAAAAGCAGAGGGGAGG + Intronic
932582937 2:73004279-73004301 AATGGAGAAAGCCAGAGGAGAGG + Intronic
934076678 2:88434361-88434383 AAAAGAGAAAGGTAGAGGCCGGG - Intergenic
934122357 2:88852670-88852692 AAAAGAGAAAGGGAGAAGAGAGG - Intergenic
934566082 2:95342160-95342182 ACACGAGAAAGAGAGAGGAGGGG + Intronic
934663738 2:96156558-96156580 AAACCAGAAAAGCAGAGAGGTGG + Intergenic
935021478 2:99236715-99236737 AATGGAGAAAGGCAGAGGGCAGG + Intronic
937092543 2:119216069-119216091 AAAGGAGAATGGCAGAAGCCAGG - Intergenic
937164082 2:119795423-119795445 ACAGGAGAAAGGCCGAGGAGGGG - Intronic
937299981 2:120833117-120833139 AGGAGAGAAAGGCAAAGGCGAGG - Intronic
938505582 2:131878389-131878411 AGACAAGAAAAGCAGAGGCTAGG - Intergenic
938905694 2:135833889-135833911 GAAGGAGAATGGCAGAGGCCAGG - Intronic
939847917 2:147269904-147269926 AAAGGTGAAAGGCAAAGGCAAGG + Intergenic
939952602 2:148493092-148493114 AAAGCAGAAAGGCAGAGACTAGG + Intronic
940047294 2:149423185-149423207 GAAAGAGGAAGGCAGAGGCTGGG - Intronic
940858540 2:158749133-158749155 GATCTAGAAAGGCAGAGGCTGGG - Intergenic
941347589 2:164389370-164389392 AGACTAGAAAGGGAGAGGAGAGG - Intergenic
941500770 2:166273022-166273044 ACATGAGAGAGACAGAGGCGAGG + Intronic
946171835 2:217900313-217900335 AAACGTGAAAGGCACAGGAGAGG - Intronic
946309611 2:218876019-218876041 AAACAATAGATGCAGAGGCGAGG - Intergenic
946322951 2:218964111-218964133 AAACCAGAAAGGAAGAGGGGTGG + Intergenic
946385492 2:219381877-219381899 AAGGGAGAAAGGAAGAGGCTGGG + Intronic
947525355 2:230873959-230873981 AAACAAGAGAGGGAGAGGGGTGG + Intronic
947823547 2:233089098-233089120 AACTGAGGAAGACAGAGGCGGGG + Intronic
948041586 2:234905690-234905712 AAAAGAGAAAGGAAGAAGGGAGG + Intergenic
948581660 2:238991313-238991335 AAAAGAGCAAGGAAGAGGGGAGG - Intergenic
1172379425 20:34475679-34475701 AGACGGGAGAGGCAGAGGCAGGG + Intronic
1172777146 20:37414446-37414468 AAGGGAGGAAGGCAGAGGTGGGG - Intergenic
1172806964 20:37619019-37619041 AAAGGAGAAAGGGAGAGGAGAGG - Intergenic
1173501272 20:43555733-43555755 AAAAAAAAAAGGCAGAGGTGGGG + Intronic
1173838673 20:46142010-46142032 CAAGGGGAGAGGCAGAGGCGTGG - Intergenic
1174146437 20:48455659-48455681 AACAGAGAAAGGGAGAGGCTGGG - Intergenic
1174408855 20:50321006-50321028 AAACCAGAACGGCAGATGCGAGG - Intergenic
1175095612 20:56539133-56539155 CAACTAGAAAGGCTGAGGTGGGG - Intergenic
1176980365 21:15375043-15375065 AAAAGAGAAAGAGAGAGGCCAGG - Intergenic
1177751070 21:25284503-25284525 AATAGAGAAATGCAGAGGTGAGG + Intergenic
1178222338 21:30674658-30674680 AAACTATAAAGGCAGAAGCAGGG + Intergenic
1178545839 21:33492174-33492196 AAAAGAAAAAGGCAGAGGCTTGG + Intergenic
1179887137 21:44319007-44319029 GTACGGGGAAGGCAGAGGCGAGG + Intronic
1180944880 22:19687374-19687396 AAAAAAAAAAGGCAGAGTCGGGG + Intergenic
1181781646 22:25198070-25198092 GAAGGAGGAAGGCAGAGGTGGGG - Intergenic
1181964738 22:26648385-26648407 ACAAAAGAGAGGCAGAGGCGAGG + Intergenic
1183066326 22:35365833-35365855 AAACGTGAAAGTGAGAGGCTGGG + Intergenic
1183476241 22:38037577-38037599 AAAGGAGATAGGAAGAGGCCAGG - Intronic
1183547358 22:38461608-38461630 AAACGAGGAGGGGAGAGGCTGGG - Intergenic
1183591609 22:38782403-38782425 AAACGAGACAGGCGAAGGCCTGG - Intronic
1183753323 22:39735144-39735166 GAAAGAGAAAAGCAGAGGAGAGG + Intergenic
1184600315 22:45539492-45539514 CAAGAAGAAAGGCAGAGGCTGGG - Intronic
950724314 3:14906554-14906576 CCACGAGAAAGGCAGGGGCAAGG - Intronic
950821388 3:15763293-15763315 AAATGAGAATGGGAGAGGTGGGG - Intronic
953868417 3:46604745-46604767 AAAAGAGAAAGCAAGAGGCGGGG + Intronic
954574912 3:51670750-51670772 AACCAAGAAAGGCATAGGTGAGG - Intronic
957470113 3:80648510-80648532 AAGAGAGAAAGGGAGAGGAGAGG + Intergenic
958079323 3:88725665-88725687 CAATGAGAAAGGCAGAAGCAAGG - Intergenic
958483112 3:94669619-94669641 AAGCAAGAAAGGCAGAGTGGAGG - Intergenic
958536785 3:95414384-95414406 AAGAGAGAAAGGGAGAGGCCGGG + Intergenic
958896408 3:99834675-99834697 AAATGAGAAAGACACAGGAGAGG - Intronic
959644138 3:108678473-108678495 AAAGTAGAAATGCAGAGGTGAGG - Intronic
959682483 3:109111630-109111652 AAAGGAGGAAGGCATAGGCAAGG + Intronic
960640780 3:119820723-119820745 AAACTAAAAAGGCAGGGGCCGGG + Intergenic
961229897 3:125295573-125295595 AAACAAGAAAAGCACAGGCTTGG + Intronic
962672435 3:137722690-137722712 AAAGGACAAAGGCAGAAGCTAGG - Intergenic
962994454 3:140611619-140611641 AATTTAGAAAGGCAGAGGGGTGG - Intergenic
963674151 3:148287234-148287256 AAACCAGAAAGGCTGAGGCAAGG - Intergenic
964198772 3:154093840-154093862 AGAAGAGAAAGGCCCAGGCGTGG + Intergenic
966101476 3:176274296-176274318 AAACAAAAAAGGCAGAGGAAAGG - Intergenic
966307137 3:178549281-178549303 AAAAGAAAAAGGAAGAGGCAAGG - Intronic
966755250 3:183364219-183364241 TAAAGATAAAGGCAGAGGCCAGG + Intronic
966819240 3:183911748-183911770 AAAGGAGAAAGAAAGAGGCCAGG - Intergenic
967095533 3:186174478-186174500 AAAAGAGAAAGGCAGAGAGACGG + Intronic
967628229 3:191711251-191711273 AAAGGAGAAATGCAAAGGCATGG + Intergenic
969111520 4:4847242-4847264 AAAGGACAAAGGCAGGGGGGTGG - Intergenic
969648339 4:8447350-8447372 AAACGAAAAAGTCAGAGGAGGGG + Intronic
969851853 4:9963712-9963734 AAACAGCAAAGGCAGAGGCTGGG + Intronic
970369854 4:15395646-15395668 AATAGAGAAAGGCAGGGCCGAGG + Intronic
972475116 4:39442726-39442748 AAAACAGAGAGGCAGAGGCCGGG - Intronic
972599026 4:40555360-40555382 AAACTAGAAAGTCAGGGGCTGGG - Intronic
973632187 4:52829962-52829984 AAAGGAGAAAGGAAGAGGAAGGG - Intergenic
973688083 4:53395359-53395381 AAAAGAGAAAGAGAGAGGTGGGG - Intronic
973797358 4:54441613-54441635 AGTCGAGAAATGCAGAAGCGTGG - Intergenic
975410151 4:74039194-74039216 AAATGAGAGAGGCAGAGACCGGG - Intergenic
976365998 4:84232933-84232955 AAATGAGACAGGCAGAGTTGTGG + Intergenic
976568617 4:86582654-86582676 AAAAGAGAGAGGCAGTGGCCTGG + Intronic
981413494 4:144460143-144460165 AAAGGGCAAAGGCAGAGACGTGG + Intergenic
983149046 4:164254753-164254775 AAACATGAAAGGGAGAGGCTGGG - Intronic
983558994 4:169082788-169082810 AAAAAAAAAAGGCCGAGGCGGGG - Intergenic
985587895 5:750430-750452 AAAGGAGAGACGCAGAGGGGAGG - Intronic
985879836 5:2629949-2629971 AAAGGAGAAAGGGCCAGGCGCGG + Intergenic
985880396 5:2634941-2634963 ACACGTGAAAGGCAGATGTGGGG + Intergenic
985888115 5:2695896-2695918 AAAGAAAAAAGGCAGAGGAGAGG - Intergenic
986209170 5:5654087-5654109 GAAAGAGAGAGGCAGAGGCAAGG - Intergenic
987313057 5:16699113-16699135 AAACGAGACAGGGAGAGACAGGG + Intronic
989573046 5:42962918-42962940 AAACCAGAAAGTAAGAGGCAAGG - Intergenic
990475491 5:56158184-56158206 AAAAAAAAAAGGCAGATGCGGGG + Intronic
991657530 5:68918986-68919008 AAACGAGAAGGGGCCAGGCGCGG + Intergenic
991947569 5:71914450-71914472 AAACCAGAAAGGCTCAGGCTGGG + Intergenic
992889538 5:81191216-81191238 CAACAAGCAAGGCAGAGCCGTGG - Intronic
993645859 5:90460844-90460866 AAACAAGAAAAACAGAGGCAAGG + Exonic
994890923 5:105635563-105635585 AAACAAGAAAGAAAGAGGCGTGG - Intergenic
995994941 5:118286483-118286505 ATATGAGAAGGGCAGAGGCTGGG - Intergenic
996391751 5:122970069-122970091 AAACAACAACGGCAGCGGCGAGG - Intronic
997241999 5:132314493-132314515 AAATGAGAGAAGCAGAGGTGAGG + Intronic
997454787 5:134008249-134008271 ATAAGAGAAAGGCAGAGATGAGG + Intergenic
998364241 5:141618676-141618698 AAACGAGGAAGGAAGGCGCGGGG + Intronic
998390564 5:141784565-141784587 AAAGGGGAAAGGCAGAGAGGAGG - Intergenic
999317382 5:150593133-150593155 AAATGAGAAAGCCAGAGACCAGG - Intergenic
999589125 5:153124519-153124541 AAATGAGGGAGGGAGAGGCGGGG + Intergenic
1002473219 5:179449939-179449961 AGACCAGGAAGGCAGAGGAGGGG + Intergenic
1002481003 5:179500714-179500736 AGACCAGGAAGGCAGAGGAGGGG - Intergenic
1003317389 6:5024837-5024859 AATAGAGATAGGCAGAGGCTAGG + Intergenic
1003334749 6:5159902-5159924 AAATGAGAAAGGCATAGACAAGG - Intronic
1003443487 6:6164714-6164736 AAAAGAGGAAGGCACAGGAGGGG - Intronic
1004589033 6:17030971-17030993 AAAAGATAAAGCCAGAGGCAAGG + Intergenic
1004999132 6:21223465-21223487 CAGCGAGAAAGGCAGAGGATAGG - Intronic
1005972407 6:30771686-30771708 AAAAGAGAAAGAAAGAGGCCAGG - Intergenic
1007018784 6:38497577-38497599 GAACGAGAAAGGCAGTGAAGGGG + Intronic
1007097906 6:39225566-39225588 AAATGAGAAGCGCAGAGGGGTGG + Intronic
1007358179 6:41335746-41335768 AAATGAGACAGGCTGAGGCCTGG - Intronic
1007948793 6:45850917-45850939 AAAGCAGAAAGGCTGAGGCAGGG + Intergenic
1008427735 6:51379345-51379367 AAGGGAGAAAGGAAGAGGGGAGG + Intergenic
1008543367 6:52564789-52564811 ACAAGAGAAAGACAGAGGTGGGG + Intronic
1008622894 6:53289069-53289091 AAAGGAGACAGGAAGAAGCGGGG - Intronic
1010717807 6:79250030-79250052 AAACAAAAAAGGCAGAGAAGGGG + Intergenic
1010988093 6:82449117-82449139 AAAGGAGAAAGGCAGAGCATTGG + Intergenic
1011219773 6:85042037-85042059 AGAAGAGAAAGGAAGAGGCAGGG - Intergenic
1012346303 6:98191632-98191654 AAAGGAGAAAGGAAGATGAGAGG - Intergenic
1012529285 6:100214672-100214694 AGAAGAGAAAGGCAGAGGCAGGG + Intergenic
1013113132 6:107080019-107080041 AAAGTAGAAAGGGTGAGGCGTGG - Intronic
1013118989 6:107124753-107124775 AAAAAAGGAAGGCAGAGGCCGGG - Intergenic
1014167117 6:118238024-118238046 AGATGAGAAAGGAAGAGGGGAGG - Intronic
1016623540 6:146140059-146140081 AAAGGAGAAAAGAAGAGGAGAGG - Intronic
1017190836 6:151651012-151651034 AAAGGAGAAGGGAAGAAGCGAGG - Intergenic
1018331601 6:162733709-162733731 AAACAGGAAGGGCAAAGGCGTGG - Intronic
1019108511 6:169690329-169690351 GGAAGAGAAAGGCAGAGGCTGGG - Intronic
1019508600 7:1405764-1405786 AAATGAGAAAGGCAGGTGAGAGG - Intergenic
1020005799 7:4783324-4783346 AAACGAGGAGGTCAGAGCCGTGG + Exonic
1021172208 7:17412912-17412934 AGAACAGAAAGGCAGAGGAGGGG + Intergenic
1023042726 7:36186244-36186266 AACCGAGAAAGGCAGAAGGAAGG - Intronic
1023905074 7:44516220-44516242 AGCCAAGAAAGGCAGAGGTGGGG + Intronic
1026141639 7:67711908-67711930 ACACGCGAAAGGCTGAGGGGTGG + Intergenic
1026213488 7:68327564-68327586 AAGAGAGAAAGGAAGAGGCCTGG - Intergenic
1026834876 7:73631930-73631952 AAAAGAGAAAAGAAGAGGAGGGG - Intergenic
1026986783 7:74559767-74559789 AAAAAAGAAAGGCAGGGGCCTGG - Intronic
1027270356 7:76515367-76515389 AAACCAGAAAGGCAGAGGAGAGG - Exonic
1028983753 7:96994018-96994040 AAAAGAGAAAGGTAGAGAAGTGG + Intergenic
1029895804 7:103982551-103982573 AAAGGAGAAAGGAAGAGGAGAGG + Intronic
1032122083 7:129163945-129163967 AAAAGAGAAAGGGAGAGGGGAGG + Intronic
1032300337 7:130680606-130680628 ATAGGAGAAAGGCAGAGGGTTGG + Intronic
1032500823 7:132398510-132398532 AAAGGAGAAACGCAGAGCTGGGG - Intronic
1032760222 7:134933689-134933711 AAAGGAGAGAGGCAGAAGAGAGG + Exonic
1033444740 7:141410459-141410481 AAAAAAGAAAGACAGAGGTGGGG - Intronic
1033543331 7:142376827-142376849 AAATGAGGAAGCCAGAGGAGAGG - Intergenic
1033934233 7:146563371-146563393 AAACGAGAAAGGTAAAAGCTGGG - Intronic
1034185689 7:149174921-149174943 TAAGGAAAAAGGCAGAGGGGGGG - Intronic
1034542336 7:151766473-151766495 AAAGGAGAAAACCAAAGGCGAGG + Intronic
1035161214 7:156951149-156951171 TAAAGATAAAGGCTGAGGCGGGG + Intronic
1035175344 7:157046164-157046186 CAAGGAGAAAGGCAGGGGCTGGG + Intergenic
1036133118 8:6134718-6134740 AAATGAGAAGGGAAGAGGGGAGG + Intergenic
1037886688 8:22599482-22599504 AGACGAGGAAGGGAGGGGCGAGG - Intronic
1038307313 8:26416630-26416652 AAAAGAGGAAGCAAGAGGCGGGG - Intronic
1038399140 8:27269727-27269749 AAACTACAAAGGAAGAGGCATGG - Intergenic
1039215898 8:35270497-35270519 AAAAGAAAAAGGCAGAAGCTGGG - Intronic
1040492556 8:47938109-47938131 AAAGGAAAAAGGGAGAGGCCAGG + Intronic
1041177552 8:55212118-55212140 AAAAAAAAAAGGCAGAGGGGTGG + Intronic
1043219421 8:77640553-77640575 AAAGGGGAAAGGGAGAGGAGAGG + Intergenic
1044758670 8:95493612-95493634 AAAGGAGAAAGGCAAAGGGGAGG + Intergenic
1045231997 8:100314686-100314708 AAATGAGCCAGGCAGAGGAGAGG - Intronic
1045389960 8:101705498-101705520 CCTCGAGAAAGGCAGTGGCGAGG - Intronic
1045502542 8:102754338-102754360 CAGCGAGAAGGCCAGAGGCGTGG - Intergenic
1045524435 8:102929845-102929867 AAAGGAAAAAGGAAGAGGCTAGG + Intronic
1049078394 8:140419588-140419610 AAATTAGAAAGGAAGAGGCCGGG + Intronic
1052946819 9:34175299-34175321 AAACCAGGAAGGAAGAGGCTTGG - Intergenic
1053061592 9:35036252-35036274 AGAAGGGAAAGGCAGAGGGGAGG + Intergenic
1053860411 9:42381146-42381168 AACTGAGAAAGGCAGAGGAATGG + Intergenic
1055500637 9:76899267-76899289 AATGGAGAGAGGCAGAGGAGAGG - Intronic
1055523754 9:77109136-77109158 AAGCAAGAAAGGGAGAGGGGAGG - Intergenic
1056058461 9:82855191-82855213 AAAGGGGAAAGGCAGAGGAGTGG + Intergenic
1057306077 9:93912781-93912803 CAGGGAGAAAGGCAGGGGCGGGG - Intergenic
1059217496 9:112579387-112579409 AAAAAAGAAAGGGAGAGGAGAGG - Intronic
1059376505 9:113885820-113885842 AAAGGAGGAAGGCTGAGGTGAGG + Intronic
1059779675 9:117513308-117513330 AAACCAGATAGGCAAAGGCATGG + Intergenic
1061392705 9:130326741-130326763 AAGGTAGAAAGGCGGAGGCGGGG + Intronic
1061970282 9:134041289-134041311 AAACGAGGAAAGCAGAGAAGGGG + Intronic
1185708408 X:2282335-2282357 AAACGAGAAAGGAAGAGAGAAGG + Intronic
1186405523 X:9298884-9298906 AAAGCAGAAGGGCAGAGGCAGGG + Intergenic
1186460943 X:9748350-9748372 AAACGAGAAAGGCAGAGCCAGGG + Intronic
1186467307 X:9793734-9793756 AAAAAAGAAAGGAAGAGGCTAGG - Intronic
1187860060 X:23673455-23673477 TAAGAAGAAAGGCAGAGGCTGGG + Intronic
1189361250 X:40354039-40354061 AAAGGAGAAAGCCTGAGGCCGGG + Intergenic
1189948117 X:46201387-46201409 ACATGAGAAAGGCAAAGGTGGGG + Intergenic
1190246306 X:48692817-48692839 AAAAGAGAAAGGTAGTGGGGAGG + Intergenic
1190704386 X:53014371-53014393 AAAGGAGAAAGGAAGAGGCCTGG + Intergenic
1190811512 X:53888914-53888936 AAACATGAAAGGCAGAGTAGTGG + Intergenic
1190866283 X:54387419-54387441 AAACGAGAAGGAAAGAGGCACGG - Intergenic
1191218034 X:57953019-57953041 AAATGACAAAGTCAGAGGCATGG - Intergenic
1192063647 X:67857620-67857642 AAGGGAGAAAGGAAGAGGCTTGG + Intergenic
1196417843 X:115491753-115491775 AAAGGAGAGAGGGAGAGACGGGG - Intergenic
1197941785 X:131797782-131797804 AAAAGAGAGAGGCACAGGCCAGG + Intergenic
1200769595 Y:7111334-7111356 AAATGAGAAAAGCAGAAGCAGGG + Intergenic
1201737353 Y:17282500-17282522 AAATTAGAAAAGCAGAGGCCGGG - Intergenic