ID: 922753812

View in Genome Browser
Species Human (GRCh38)
Location 1:228083123-228083145
Sequence TCGGGAAACGAGAAAGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 208}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922753812_922753827 18 Left 922753812 1:228083123-228083145 CCTCTGCCTTTCTCGTTTCCCGA 0: 1
1: 0
2: 4
3: 18
4: 208
Right 922753827 1:228083164-228083186 GGTTGGGATTAGCGGCCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
922753812_922753828 19 Left 922753812 1:228083123-228083145 CCTCTGCCTTTCTCGTTTCCCGA 0: 1
1: 0
2: 4
3: 18
4: 208
Right 922753828 1:228083165-228083187 GTTGGGATTAGCGGCCGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 48
922753812_922753833 29 Left 922753812 1:228083123-228083145 CCTCTGCCTTTCTCGTTTCCCGA 0: 1
1: 0
2: 4
3: 18
4: 208
Right 922753833 1:228083175-228083197 GCGGCCGCGGGGGCCGGTGGGGG 0: 1
1: 0
2: 5
3: 103
4: 890
922753812_922753832 28 Left 922753812 1:228083123-228083145 CCTCTGCCTTTCTCGTTTCCCGA 0: 1
1: 0
2: 4
3: 18
4: 208
Right 922753832 1:228083174-228083196 AGCGGCCGCGGGGGCCGGTGGGG 0: 1
1: 0
2: 0
3: 39
4: 463
922753812_922753821 2 Left 922753812 1:228083123-228083145 CCTCTGCCTTTCTCGTTTCCCGA 0: 1
1: 0
2: 4
3: 18
4: 208
Right 922753821 1:228083148-228083170 CCGCCCGCGCGTGGACGGTTGGG 0: 1
1: 0
2: 0
3: 1
4: 30
922753812_922753829 23 Left 922753812 1:228083123-228083145 CCTCTGCCTTTCTCGTTTCCCGA 0: 1
1: 0
2: 4
3: 18
4: 208
Right 922753829 1:228083169-228083191 GGATTAGCGGCCGCGGGGGCCGG 0: 1
1: 0
2: 0
3: 8
4: 126
922753812_922753830 26 Left 922753812 1:228083123-228083145 CCTCTGCCTTTCTCGTTTCCCGA 0: 1
1: 0
2: 4
3: 18
4: 208
Right 922753830 1:228083172-228083194 TTAGCGGCCGCGGGGGCCGGTGG 0: 1
1: 1
2: 1
3: 13
4: 158
922753812_922753831 27 Left 922753812 1:228083123-228083145 CCTCTGCCTTTCTCGTTTCCCGA 0: 1
1: 0
2: 4
3: 18
4: 208
Right 922753831 1:228083173-228083195 TAGCGGCCGCGGGGGCCGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 114
922753812_922753818 -3 Left 922753812 1:228083123-228083145 CCTCTGCCTTTCTCGTTTCCCGA 0: 1
1: 0
2: 4
3: 18
4: 208
Right 922753818 1:228083143-228083165 CGAGGCCGCCCGCGCGTGGACGG 0: 1
1: 0
2: 0
3: 6
4: 86
922753812_922753825 16 Left 922753812 1:228083123-228083145 CCTCTGCCTTTCTCGTTTCCCGA 0: 1
1: 0
2: 4
3: 18
4: 208
Right 922753825 1:228083162-228083184 ACGGTTGGGATTAGCGGCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 24
922753812_922753819 1 Left 922753812 1:228083123-228083145 CCTCTGCCTTTCTCGTTTCCCGA 0: 1
1: 0
2: 4
3: 18
4: 208
Right 922753819 1:228083147-228083169 GCCGCCCGCGCGTGGACGGTTGG 0: 1
1: 0
2: 1
3: 2
4: 37
922753812_922753815 -7 Left 922753812 1:228083123-228083145 CCTCTGCCTTTCTCGTTTCCCGA 0: 1
1: 0
2: 4
3: 18
4: 208
Right 922753815 1:228083139-228083161 TTCCCGAGGCCGCCCGCGCGTGG 0: 1
1: 0
2: 0
3: 4
4: 82
922753812_922753824 10 Left 922753812 1:228083123-228083145 CCTCTGCCTTTCTCGTTTCCCGA 0: 1
1: 0
2: 4
3: 18
4: 208
Right 922753824 1:228083156-228083178 GCGTGGACGGTTGGGATTAGCGG 0: 1
1: 0
2: 0
3: 0
4: 48
922753812_922753826 17 Left 922753812 1:228083123-228083145 CCTCTGCCTTTCTCGTTTCCCGA 0: 1
1: 0
2: 4
3: 18
4: 208
Right 922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922753812 Original CRISPR TCGGGAAACGAGAAAGGCAG AGG (reversed) Intronic
900586978 1:3437304-3437326 TGGGGAAGCGGGGAAGGCAGAGG - Exonic
903860664 1:26362642-26362664 TCGGGAAATCAGAAGGGCAGGGG - Intronic
904345701 1:29867389-29867411 CCAGGAAAGGGGAAAGGCAGTGG - Intergenic
905652921 1:39668499-39668521 TCTGGAAAAGAGAGAAGCAGAGG - Intronic
909144824 1:71916970-71916992 TGGGAAAAAGAGAAAGGCAGAGG + Intronic
910721447 1:90290949-90290971 TAGGGAAAGGAGATAGGTAGGGG + Intergenic
911010045 1:93271002-93271024 ACGGGGAAAGAGAGAGGCAGAGG + Intronic
911094355 1:94043485-94043507 TGGGACAACGAGAAAAGCAGTGG + Intronic
915927938 1:160038468-160038490 TCTGGAAATGGGAAAGGGAGGGG - Exonic
916690862 1:167188714-167188736 AGGGGAAGGGAGAAAGGCAGAGG + Intergenic
917066556 1:171100960-171100982 TCGTTAAAAGAGAGAGGCAGAGG + Intronic
918548956 1:185717820-185717842 AGGGGAAAGGATAAAGGCAGAGG + Intergenic
919943771 1:202305660-202305682 TGGGGAAAAGAGAAAGGCCAGGG - Intronic
921121639 1:212142551-212142573 TTGGGAAACCAAAAAGTCAGGGG + Intergenic
921308216 1:213818082-213818104 ACGGGAAAACAGAAAGTCAGTGG - Intergenic
922753812 1:228083123-228083145 TCGGGAAACGAGAAAGGCAGAGG - Intronic
923613406 1:235515743-235515765 TCATTAAACGAAAAAGGCAGAGG - Intergenic
924174188 1:241373083-241373105 TAGAGAAATGAAAAAGGCAGTGG - Intergenic
924795034 1:247286863-247286885 TCCAGGAACGAAAAAGGCAGCGG + Intergenic
924829161 1:247574140-247574162 CAGGAAAACGAGAATGGCAGTGG + Exonic
1062841509 10:676791-676813 GCGGGAAGGGAGAAAGGGAGAGG + Intronic
1064117618 10:12592251-12592273 TCCGGAAAGGAGAAAGATAGAGG - Intronic
1066452089 10:35539006-35539028 TGGGGAAAGGATAAAGGCACTGG - Intronic
1067027852 10:42859325-42859347 TGAGGAAACGAGACAGCCAGGGG + Intergenic
1072503627 10:96043503-96043525 TCGCGAGACGAGATTGGCAGCGG + Intronic
1074457084 10:113604555-113604577 TGGTGAAAGGAGAAAGGCTGGGG + Intronic
1074792498 10:116904827-116904849 TGGAGAAACGAAAAAGCCAGTGG + Intronic
1075219956 10:120576290-120576312 TCGGAAAACAAGAAAGGGAGAGG - Intronic
1075735987 10:124664908-124664930 TCAGGAGCCGAGAAAGCCAGAGG - Intronic
1077235202 11:1478756-1478778 TAGGGAGACGAGAAAGGGGGCGG - Intronic
1077791865 11:5449718-5449740 TCGGGAATCTAGAAGGGAAGTGG + Intronic
1079017545 11:16881949-16881971 TCTGAAAACGAGAAGGGCAGAGG + Intronic
1079222239 11:18573375-18573397 TAGGGAAAGGAGGAAGGGAGAGG - Intronic
1080121699 11:28685313-28685335 TGGAAAAACAAGAAAGGCAGTGG - Intergenic
1083599820 11:63939586-63939608 TCGAGTAACGGGAAGGGCAGTGG - Intronic
1084167883 11:67384976-67384998 CCAGGGAACAAGAAAGGCAGGGG + Intronic
1086175504 11:83886267-83886289 ATGGGAAACAAAAAAGGCAGGGG + Intronic
1087049310 11:93869501-93869523 TCTGGGAACAAAAAAGGCAGCGG - Intergenic
1087526051 11:99314700-99314722 TAGGGAAAGGAGAAAGGGAGAGG + Intronic
1088234827 11:107711891-107711913 GCTGCAAATGAGAAAGGCAGAGG - Intronic
1089308998 11:117545562-117545584 TGGGGAGGGGAGAAAGGCAGAGG + Intronic
1089435785 11:118465079-118465101 TTGGGAAACAAAAAAGGCAAAGG - Intronic
1089798875 11:121007016-121007038 TTGGGAAAGGAGGAAGGGAGGGG + Intergenic
1090110979 11:123908770-123908792 TGCAGAAACCAGAAAGGCAGCGG + Intergenic
1090541686 11:127712850-127712872 TCTGGAAACGAAAAAGGATGGGG + Intergenic
1091913499 12:4250785-4250807 TCGGGAGAGGAGAAAGCCCGAGG - Intergenic
1092732182 12:11545296-11545318 ACGGGAAACTAGAAAAGCAGAGG - Intergenic
1099380563 12:81947146-81947168 TTGGGAAATGAGGATGGCAGTGG - Intergenic
1101646450 12:106634911-106634933 TTGGGAAAAGAGAAAGGCAGAGG - Intronic
1101664068 12:106793669-106793691 TCAGGAAAAGAGAAAGTCAGAGG + Intronic
1101926817 12:108978663-108978685 TCTGGGAAGGAGAAAGGGAGAGG + Exonic
1102536052 12:113582464-113582486 GCTGGAAACGAGAGAGGCTGTGG - Intergenic
1103505122 12:121437635-121437657 TGGGGTAAAGGGAAAGGCAGGGG + Intronic
1105252430 13:18711591-18711613 TAGGGAAAGGAGATAGGTAGAGG - Intergenic
1106583718 13:31038993-31039015 TGGGGAAAAGAGAAAGGCTGGGG - Intergenic
1110103993 13:71646977-71646999 TAGAGAAAAGAGAAAGGCATGGG + Intronic
1111640818 13:90967267-90967289 TGGGGAAACTAGGAAGGGAGTGG - Intergenic
1112086833 13:96040940-96040962 TGGGGAAAGGATAAAGGAAGGGG + Intronic
1112931472 13:104744609-104744631 TGGGGAAAAGAGGAAGACAGGGG - Intergenic
1113629067 13:111868654-111868676 TGGGGAAAGGAGGAAGGCAGAGG - Intergenic
1117124611 14:52609020-52609042 TAGGGAACTGAGAAAGACAGGGG - Intronic
1117891260 14:60425003-60425025 ACGGAAAACAAAAAAGGCAGGGG - Intronic
1118941704 14:70345356-70345378 TCCAGGAACGAAAAAGGCAGCGG + Intronic
1121322876 14:93002773-93002795 TTTGGAAAGGGGAAAGGCAGTGG + Intronic
1122014226 14:98780200-98780222 TCAGGACACAAGAAAAGCAGAGG - Intergenic
1122501311 14:102201993-102202015 TGGGGAACAGAGACAGGCAGAGG - Intronic
1123923259 15:25085579-25085601 TGGGCAAAGGAGAATGGCAGGGG + Intergenic
1125012192 15:34890553-34890575 TTATGAAACGAGAAAGGCATTGG + Intronic
1125724437 15:41861135-41861157 TTGGGAAGCGAGGAGGGCAGGGG + Intronic
1125786881 15:42326707-42326729 TCGGGGAATAAGAAAAGCAGAGG + Intronic
1126392622 15:48176358-48176380 TGGGAAAAAGAGAAAGGGAGAGG + Intronic
1127652322 15:61021267-61021289 GTGGGAGACTAGAAAGGCAGAGG + Intronic
1128290570 15:66475513-66475535 TTGGGGGAAGAGAAAGGCAGTGG - Intronic
1129696215 15:77741949-77741971 TGGGCAAGGGAGAAAGGCAGAGG + Intronic
1130053351 15:80502413-80502435 TGGGGTAAAGAGAAAGGCTGTGG + Intronic
1134045739 16:11099589-11099611 TCAGGAAACAAGAAAGGCAAGGG + Intronic
1136133084 16:28236832-28236854 GGGAGAAAAGAGAAAGGCAGAGG + Intergenic
1137494487 16:48959209-48959231 CCAGGACACGAGACAGGCAGGGG - Intergenic
1139314800 16:66059101-66059123 TGGAGAAAGGAGGAAGGCAGTGG - Intergenic
1139920426 16:70456459-70456481 TCGGGAATCAAGCAAGGCTGAGG - Intronic
1140756660 16:78073808-78073830 TGAGTAAATGAGAAAGGCAGTGG + Intergenic
1141291003 16:82718077-82718099 TCAGGAAACCGGTAAGGCAGTGG + Intronic
1142656925 17:1400418-1400440 CCGGGGAACGAGAAGGGCTGAGG + Intergenic
1143671109 17:8396760-8396782 TCAGAAAGCGAGAGAGGCAGAGG - Intronic
1144696261 17:17305789-17305811 CAGGGGAAGGAGAAAGGCAGCGG + Intronic
1146640429 17:34536641-34536663 TGGGGAATGGAGAGAGGCAGAGG - Intergenic
1147056900 17:37841761-37841783 GCGGGAGTAGAGAAAGGCAGGGG - Intergenic
1147739976 17:42665884-42665906 TGGGGAAGAGAGAAAGGCTGGGG - Intronic
1147798339 17:43062510-43062532 TGGGGAAAAGAGAAAGGAAAAGG - Intronic
1149744261 17:59079811-59079833 TCGGGAAATTAGGAATGCAGTGG - Exonic
1151790867 17:76304955-76304977 TCAGGAAAGGAGAATGACAGTGG + Intronic
1153046945 18:864909-864931 TCGGCAAACCAGAAAGGCCAAGG + Intergenic
1157836644 18:50909847-50909869 TAGGGAAAGGAAAAAGGCATAGG + Intronic
1158065365 18:53400526-53400548 TCAGGAGAAGAGCAAGGCAGAGG + Intronic
1159040438 18:63319420-63319442 TCGAGAAAAAAAAAAGGCAGCGG + Exonic
1161442306 19:4299021-4299043 TCGTGAAATGAGAACTGCAGTGG + Intronic
1161777078 19:6269478-6269500 TCAGGAAAGGAGAAATGCAGAGG + Intronic
1162807270 19:13144486-13144508 TCTGGGAACGAGAAGGTCAGGGG + Exonic
1164393670 19:27846083-27846105 TAGTGAAATGAGAAAGGGAGGGG + Intergenic
1167178887 19:47886085-47886107 TCGTGAACTGAGAAAGGCTGTGG - Intronic
1167369237 19:49071057-49071079 TCAGGCAACCAGAAAGTCAGCGG - Intronic
1167777375 19:51567882-51567904 TCCTGAAACGAGAGAGGCAATGG - Intergenic
1168017054 19:53582034-53582056 TGGGGTAAGGAGAAGGGCAGGGG + Intergenic
924973341 2:151309-151331 GCTGGAAAAGAGAAGGGCAGAGG - Intergenic
925904470 2:8531196-8531218 TCAGGAAAAGAGAAACACAGAGG + Intergenic
926974005 2:18495282-18495304 AGGGGAAAGGAGAAAGGAAGAGG - Intergenic
927056714 2:19372263-19372285 CCAGGAAACGAGTGAGGCAGGGG + Intergenic
927973784 2:27322705-27322727 TGGGGAAGAGAGAAAGGCTGTGG + Intronic
929708751 2:44244270-44244292 TCTGGTGACAAGAAAGGCAGTGG + Intronic
930290089 2:49482644-49482666 ATGGAAAACGAAAAAGGCAGGGG + Intergenic
930806022 2:55491626-55491648 TGTGGGAAGGAGAAAGGCAGTGG + Intergenic
931301786 2:60987283-60987305 ACGGGAAAGGAGAAAGGCAGGGG + Intronic
934609363 2:95723101-95723123 TGGGGAGACCAGAGAGGCAGAGG + Intergenic
936542696 2:113364679-113364701 TGGGGAGACCAGAGAGGCAGGGG + Intergenic
936609523 2:113988247-113988269 TCTAGAAACAAGAAGGGCAGTGG - Intergenic
936623455 2:114123763-114123785 TGGGGAAAGTAGTAAGGCAGAGG + Intergenic
940973300 2:159917291-159917313 TCAGGAAAAGAGAGAGGAAGAGG + Intergenic
942709178 2:178813333-178813355 TTTGGAAATAAGAAAGGCAGTGG - Intronic
944297915 2:198088549-198088571 TCAGGAAAACAGAATGGCAGGGG - Intronic
946171836 2:217900318-217900340 TGGGCAAACGTGAAAGGCACAGG - Intronic
948336189 2:237209172-237209194 TGGGGACACGAGAGAGGCTGGGG - Intergenic
1168952378 20:1811259-1811281 TCGGGAAAAGAGAACTTCAGGGG - Intergenic
1172792009 20:37512229-37512251 TGGGAAAATGAGCAAGGCAGAGG + Intronic
1172806965 20:37619024-37619046 AAGGGAAAGGAGAAAGGGAGAGG - Intergenic
1172950517 20:38720417-38720439 TCAGCAAAAGAGAAAGGCTGTGG + Intergenic
1173322194 20:41998183-41998205 TCTGGAAGCGAGAAAGGAATTGG + Intergenic
1175380673 20:58560349-58560371 CCGGGGAACAAAAAAGGCAGAGG - Intergenic
1175670776 20:60901037-60901059 GCTGGAAACCAGGAAGGCAGAGG + Intergenic
1176249093 20:64111790-64111812 ACGGGGAAAGAGAGAGGCAGCGG - Intergenic
1176837958 21:13811475-13811497 TAGGGAAAAGAGATAGGTAGAGG - Intergenic
1178755385 21:35344739-35344761 GCGGACAACAAGAAAGGCAGTGG - Intronic
1178883211 21:36464794-36464816 TGGGGAAACGAGAGGAGCAGAGG + Intronic
1178989932 21:37344450-37344472 ACAGGAACCCAGAAAGGCAGAGG + Intergenic
1179667851 21:42924857-42924879 TCTGGGAATGAAAAAGGCAGCGG - Intergenic
1181434092 22:22900297-22900319 TCTGGACACCAGAAAGCCAGGGG + Intergenic
1181435030 22:22905663-22905685 TCTGGACACCAGAAAGCCAGGGG + Intergenic
1181830740 22:25558482-25558504 TCGGGGCACCAGAAAGCCAGTGG - Intergenic
1182322705 22:29488889-29488911 TCTGGAAGCGAGAAAGGAATTGG - Exonic
1182371899 22:29817130-29817152 TCTGGAATCAAGAAATGCAGTGG - Intronic
1184269601 22:43371456-43371478 TGGGAAAAAGAGAAAGGCAAGGG - Intergenic
1184380679 22:44143347-44143369 GTGTGAAAGGAGAAAGGCAGGGG - Intronic
1184820440 22:46905740-46905762 GTGGGAAACCAGCAAGGCAGGGG - Intronic
1185015706 22:48341357-48341379 TCTGGAAAAGAGAAAGTCATGGG - Intergenic
950866783 3:16196091-16196113 TGGGGAAACCAGTAAGGCAGTGG + Intronic
950922062 3:16704760-16704782 TCAGGAAGGGAGGAAGGCAGAGG - Intergenic
952179567 3:30903367-30903389 TGGGCTAATGAGAAAGGCAGTGG + Intergenic
952999353 3:38917953-38917975 TGGGGAAAGTAGAGAGGCAGAGG - Intronic
954574913 3:51670755-51670777 TTGGGAACCAAGAAAGGCATAGG - Intronic
956681554 3:71785732-71785754 CCTGGAAACGTGGAAGGCAGGGG + Intergenic
957243312 3:77686727-77686749 TGGGAAAAGGAGGAAGGCAGCGG + Intergenic
957501329 3:81061409-81061431 TTGGGAATAGAGAAATGCAGTGG - Intergenic
962249709 3:133828342-133828364 TGGGGATAGGAGGAAGGCAGAGG + Exonic
962817573 3:139016166-139016188 TGGGGAAAAGAAAAATGCAGTGG - Intronic
963175005 3:142289051-142289073 TCCGAAAAAGAGAAAAGCAGTGG - Intergenic
967070685 3:185960012-185960034 TCAGGAAAAGAGAGAGTCAGTGG - Intergenic
970793515 4:19887873-19887895 TCTGGAAACAAAAAAGGCAATGG + Intergenic
971142671 4:23941588-23941610 TTGGGAAAAGAGAATGGCACTGG + Intergenic
972169068 4:36322784-36322806 TTGTGAAAGGAGAAAGGCTGAGG - Intronic
973329165 4:48895110-48895132 TCTAGAAACGAGAAAGGAAAAGG + Intronic
976441902 4:85085547-85085569 TCAGGAAACCAGACAGACAGTGG - Intergenic
976568616 4:86582649-86582671 GTGGGAAAAGAGAGAGGCAGTGG + Intronic
977778751 4:100955443-100955465 TGAGGAAACGAGAAAGGTACCGG + Intergenic
979071192 4:116208876-116208898 TCAGGAAACTAGAAATGGAGGGG + Intergenic
979375498 4:119941839-119941861 TGGGGAAAGGAGGAAGGCTGAGG + Intergenic
980127530 4:128788049-128788071 TTGGGGGAGGAGAAAGGCAGTGG - Intergenic
982531305 4:156547493-156547515 GCTGGAACAGAGAAAGGCAGAGG - Intergenic
984767982 4:183414055-183414077 TTGGGGAACGATAAAGGGAGGGG - Intergenic
984901503 4:184590629-184590651 TCGGGAAAACGGAAGGGCAGGGG + Intergenic
984957413 4:185059053-185059075 TCAGGAAACCAGGAAGGAAGCGG + Intergenic
985573101 5:661131-661153 TCAGGAAAGGAGAAAGGCAGAGG - Exonic
985839375 5:2294560-2294582 TAGGAAAACGAAAATGGCAGTGG - Intergenic
986586298 5:9321402-9321424 TCCTGAAACCAGAAAGACAGTGG - Intronic
987140636 5:14942299-14942321 TCAGTAAAAGAGAAAGGCAGAGG - Intergenic
987369708 5:17181887-17181909 TCGGGGAGGGAGAAGGGCAGTGG - Intronic
989383410 5:40831259-40831281 TCTGTAAACAAGAAAGGCAATGG + Exonic
990140255 5:52694945-52694967 TAGTGAAAGGAGAAAGGGAGAGG - Intergenic
991642318 5:68767486-68767508 TTGGGAAACGGGAAAAGAAGCGG - Intergenic
995665211 5:114534474-114534496 ATGGGAAACAAAAAAGGCAGGGG - Intergenic
999181720 5:149674589-149674611 TGGGGACATGGGAAAGGCAGAGG - Intergenic
1003188067 6:3849864-3849886 TCAAGAAGCGCGAAAGGCAGCGG + Exonic
1006026616 6:31151017-31151039 TCTGGAAACCAGAAGAGCAGGGG - Exonic
1007284300 6:40736645-40736667 TAGCGAAGCCAGAAAGGCAGAGG + Intergenic
1007576794 6:42930135-42930157 TCAGGAAACTACAGAGGCAGAGG + Intronic
1016468895 6:144354164-144354186 GCAGTAAATGAGAAAGGCAGTGG + Intronic
1017696324 6:157019998-157020020 TTGCTAAAAGAGAAAGGCAGGGG - Intronic
1018320934 6:162607852-162607874 TCTGGAAAAGAGAAGGGAAGAGG + Intronic
1018460652 6:163995501-163995523 TAAGGAAACAAGAAATGCAGGGG - Intergenic
1018467988 6:164069412-164069434 TAGGGAACAGAGAAAGCCAGGGG - Intergenic
1018926003 6:168207507-168207529 TCGGGGTGGGAGAAAGGCAGAGG + Intergenic
1019078927 6:169414259-169414281 GTGGGAAAAGAGAAATGCAGAGG + Intergenic
1021120684 7:16792030-16792052 TTAGGAAACGTGAAAGGCTGTGG - Exonic
1022003059 7:26244294-26244316 TCCGGGAACGAAAATGGCAGCGG + Intergenic
1022523878 7:31024894-31024916 GCTGGCAACAAGAAAGGCAGAGG + Intergenic
1023258131 7:38331933-38331955 GCTGGGAATGAGAAAGGCAGGGG + Intergenic
1023854798 7:44176211-44176233 TCTGGAAACAAGAAGGGAAGGGG - Intronic
1024322603 7:48085964-48085986 TTGGGAAACCTGAAGGGCAGTGG + Intergenic
1025810719 7:64873808-64873830 TCAGGAAAAGAGAAGGCCAGAGG - Intronic
1027270357 7:76515372-76515394 GAGAGAAACCAGAAAGGCAGAGG - Exonic
1029439977 7:100582169-100582191 TGTGGAAGGGAGAAAGGCAGCGG + Intronic
1029803432 7:102973934-102973956 TCCGGGAACGAAAAAGGCAGCGG + Intronic
1030393234 7:108953121-108953143 TCTGGCAACGAGAAAAGCAGAGG - Intergenic
1032971033 7:137164270-137164292 CCGGGAAAACAGAAAGGCTGTGG + Intergenic
1033436588 7:141338519-141338541 TGGGGATGGGAGAAAGGCAGGGG + Intronic
1034738322 7:153449798-153449820 TCTGGAAAAGAGAAATGCAGGGG + Intergenic
1034990632 7:155545824-155545846 TCAGGAGAGGAGAAAGGTAGTGG - Intergenic
1044699065 8:94949706-94949728 GCGGGCAACGGGAAGGGCAGAGG + Intronic
1045401863 8:101827245-101827267 TCCTGAAAAGAAAAAGGCAGAGG - Intronic
1045474475 8:102541290-102541312 TCTGGCAGGGAGAAAGGCAGTGG + Intergenic
1046583505 8:116122763-116122785 TCGGGACACGAGAATGACAAGGG + Intergenic
1047907190 8:129484739-129484761 TGGGGAAAAGGGAAGGGCAGGGG - Intergenic
1048717017 8:137282015-137282037 TCAGGGAACGAGAAAAGCAGCGG + Intergenic
1051380341 9:16451627-16451649 TGGGCATACCAGAAAGGCAGAGG - Intronic
1051499629 9:17763012-17763034 TAGGGCTAAGAGAAAGGCAGTGG + Intronic
1051911735 9:22160536-22160558 TTGGGGAACTAGAGAGGCAGGGG + Intergenic
1055006508 9:71513231-71513253 TCGGGAAAGGATACAGCCAGGGG + Intergenic
1055544815 9:77358837-77358859 GCAGGAAACAAGAAAGGCAAAGG - Intronic
1055551242 9:77433961-77433983 TGGGGAAACCAGAAAGGCAGAGG + Intronic
1061222411 9:129259892-129259914 GCGGGTAACCAGAAAGGGAGTGG - Intergenic
1062351038 9:136138730-136138752 GCGGGACACAAGAAAGGCAGTGG + Intergenic
1185889873 X:3814539-3814561 TTGGGGAACTAGCAAGGCAGGGG + Intergenic
1187355290 X:18564256-18564278 AAGGGAAAGGAGAAAGGGAGAGG - Intronic
1187645455 X:21341880-21341902 ACGGAAAACAAAAAAGGCAGGGG + Intergenic
1188582866 X:31736376-31736398 TAGGGAAACGACAAAGAAAGTGG + Intronic
1189059546 X:37738330-37738352 TCAGGGAAGGAGAAGGGCAGGGG - Intronic
1192032421 X:67528465-67528487 TCTGGAAAGGAGAAATGCTGTGG + Intergenic
1192282877 X:69703103-69703125 TCCAGGAACGAAAAAGGCAGCGG - Intronic
1193029756 X:76884506-76884528 ACGGAAAACAAAAAAGGCAGGGG + Intergenic
1195681327 X:107549015-107549037 AGAGGAAAAGAGAAAGGCAGAGG + Intronic
1196350534 X:114724338-114724360 ATGGAAAACGAAAAAGGCAGGGG - Intronic
1199340739 X:146674666-146674688 TCCGCAAACGAGAAAGGCCTTGG + Intergenic
1201274818 Y:12287264-12287286 TAGTGGAATGAGAAAGGCAGAGG + Intergenic