ID: 922753814

View in Genome Browser
Species Human (GRCh38)
Location 1:228083129-228083151
Sequence GCGGCCTCGGGAAACGAGAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 71}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922753814_922753819 -5 Left 922753814 1:228083129-228083151 CCTTTCTCGTTTCCCGAGGCCGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 922753819 1:228083147-228083169 GCCGCCCGCGCGTGGACGGTTGG 0: 1
1: 0
2: 1
3: 2
4: 37
922753814_922753835 29 Left 922753814 1:228083129-228083151 CCTTTCTCGTTTCCCGAGGCCGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 922753835 1:228083181-228083203 GCGGGGGCCGGTGGGGGTCGTGG 0: 1
1: 0
2: 7
3: 101
4: 999
922753814_922753828 13 Left 922753814 1:228083129-228083151 CCTTTCTCGTTTCCCGAGGCCGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 922753828 1:228083165-228083187 GTTGGGATTAGCGGCCGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 48
922753814_922753829 17 Left 922753814 1:228083129-228083151 CCTTTCTCGTTTCCCGAGGCCGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 922753829 1:228083169-228083191 GGATTAGCGGCCGCGGGGGCCGG 0: 1
1: 0
2: 0
3: 8
4: 126
922753814_922753832 22 Left 922753814 1:228083129-228083151 CCTTTCTCGTTTCCCGAGGCCGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 922753832 1:228083174-228083196 AGCGGCCGCGGGGGCCGGTGGGG 0: 1
1: 0
2: 0
3: 39
4: 463
922753814_922753824 4 Left 922753814 1:228083129-228083151 CCTTTCTCGTTTCCCGAGGCCGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 922753824 1:228083156-228083178 GCGTGGACGGTTGGGATTAGCGG 0: 1
1: 0
2: 0
3: 0
4: 48
922753814_922753821 -4 Left 922753814 1:228083129-228083151 CCTTTCTCGTTTCCCGAGGCCGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 922753821 1:228083148-228083170 CCGCCCGCGCGTGGACGGTTGGG 0: 1
1: 0
2: 0
3: 1
4: 30
922753814_922753827 12 Left 922753814 1:228083129-228083151 CCTTTCTCGTTTCCCGAGGCCGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 922753827 1:228083164-228083186 GGTTGGGATTAGCGGCCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
922753814_922753836 30 Left 922753814 1:228083129-228083151 CCTTTCTCGTTTCCCGAGGCCGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 922753836 1:228083182-228083204 CGGGGGCCGGTGGGGGTCGTGGG 0: 1
1: 0
2: 2
3: 30
4: 371
922753814_922753826 11 Left 922753814 1:228083129-228083151 CCTTTCTCGTTTCCCGAGGCCGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 25
922753814_922753833 23 Left 922753814 1:228083129-228083151 CCTTTCTCGTTTCCCGAGGCCGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 922753833 1:228083175-228083197 GCGGCCGCGGGGGCCGGTGGGGG 0: 1
1: 0
2: 5
3: 103
4: 890
922753814_922753825 10 Left 922753814 1:228083129-228083151 CCTTTCTCGTTTCCCGAGGCCGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 922753825 1:228083162-228083184 ACGGTTGGGATTAGCGGCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 24
922753814_922753830 20 Left 922753814 1:228083129-228083151 CCTTTCTCGTTTCCCGAGGCCGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 922753830 1:228083172-228083194 TTAGCGGCCGCGGGGGCCGGTGG 0: 1
1: 1
2: 1
3: 13
4: 158
922753814_922753831 21 Left 922753814 1:228083129-228083151 CCTTTCTCGTTTCCCGAGGCCGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 922753831 1:228083173-228083195 TAGCGGCCGCGGGGGCCGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 114
922753814_922753818 -9 Left 922753814 1:228083129-228083151 CCTTTCTCGTTTCCCGAGGCCGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 922753818 1:228083143-228083165 CGAGGCCGCCCGCGCGTGGACGG 0: 1
1: 0
2: 0
3: 6
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922753814 Original CRISPR GCGGCCTCGGGAAACGAGAA AGG (reversed) Exonic
900787131 1:4655938-4655960 GGGGCCCCGAGAAAGGAGAAGGG - Intronic
901644635 1:10709892-10709914 GAGGCCTCGGGAAAGGAGCCTGG + Intronic
905283545 1:36864598-36864620 GCTGCCTCTGGAGACCAGAAGGG - Intronic
915616908 1:157045988-157046010 GCGGCCGCGGGAACCGAGGCAGG - Intergenic
922526764 1:226309661-226309683 GCGGTCTCGGGAAAAGTGAGGGG - Exonic
922753814 1:228083129-228083151 GCGGCCTCGGGAAACGAGAAAGG - Exonic
924527316 1:244863910-244863932 GCCGCCTCGGAAGACGAGAACGG - Exonic
1067479295 10:46584872-46584894 GCTGCCTCGGGAAACAGGAGGGG - Intronic
1067615444 10:47756929-47756951 GCTGCCTCGGGAAACAGGAGGGG + Intergenic
1067764842 10:49076987-49077009 GGGGCCTCAGAAACCGAGAAAGG + Intronic
1077972612 11:7210862-7210884 GCAGCCTCTGGGAATGAGAACGG - Intergenic
1083888332 11:65583610-65583632 GGGGTCTTGGGAAATGAGAAGGG + Exonic
1084122669 11:67078391-67078413 GCGGCATGGGGAAACGAAGACGG - Intergenic
1084493866 11:69492570-69492592 GCGGCCTCTGGAAGCCAGAAAGG + Intergenic
1089556121 11:119316781-119316803 GCTGCTTCTGGGAACGAGAAGGG - Intronic
1090660802 11:128880466-128880488 GGGGCCTGGGGACACCAGAAAGG + Intergenic
1091657271 12:2354794-2354816 GCAGCCCAGGGAAACGAGAATGG - Intronic
1092081844 12:5723117-5723139 GCTGCCTTGGGAAATGAGAAAGG - Intronic
1092505797 12:9098573-9098595 GCAGCCTCAGGAATCAAGAAGGG - Intronic
1093661112 12:21758057-21758079 GCAGCCTGGGTAAACAAGAAAGG - Intergenic
1106724867 13:32473667-32473689 GTGGCCTCTGGAAAAGAGACTGG - Intronic
1107994033 13:45843159-45843181 GCAGCCTCTGGAATCGAGGAAGG - Intronic
1112337617 13:98527785-98527807 GCGGCCACGGGAGACCAGAGGGG + Intronic
1112599066 13:100837429-100837451 AGGGCCTGGGGAAAGGAGAATGG - Intergenic
1114256333 14:21004394-21004416 GAGGCCTCTGGGAAGGAGAAAGG + Intergenic
1119087401 14:71750902-71750924 GCAGCCTCAGGAAAGGGGAAGGG - Intergenic
1121067679 14:90983697-90983719 GGGGCATCGGGAAAGGGGAATGG + Intronic
1122070592 14:99203174-99203196 GCGGCCATGGGGAACGAGAACGG - Intronic
1127752479 15:62060022-62060044 TTGGCCTCGGGGGACGAGAAAGG + Intronic
1134819654 16:17236526-17236548 GCAGCCCCGGGAAACTACAATGG - Intronic
1134872768 16:17666778-17666800 GCAGCCTCTGGAAATGGGAATGG - Intergenic
1136379394 16:29885396-29885418 GCTGCCTGGGGGAAGGAGAAGGG + Intronic
1137788275 16:51154279-51154301 GTGGCCCCGGGAAAGGAGATGGG + Intergenic
1203105082 16_KI270728v1_random:1348837-1348859 GCGGCCTCGAGAGAGGAGATCGG + Intergenic
1203128432 16_KI270728v1_random:1613531-1613553 GCGGCCTCGAGAGAGGAGATCGG - Intergenic
1144665066 17:17096791-17096813 GGGGCCTGGGGAAACCACAAGGG + Intronic
1147178284 17:38670143-38670165 GCCGCCTGGGGAAAGGGGAAAGG - Intergenic
1152341642 17:79729047-79729069 GCGGCCTCGGGAGAGGAGATCGG - Intergenic
1153592341 18:6686879-6686901 GCAGCCTCTGGAAGCCAGAAAGG - Intergenic
1154210785 18:12377143-12377165 GCGGCCTCGGGAAGCGGGCTCGG + Exonic
1156292010 18:35755598-35755620 GGGGCCTCAGGAAAGGAGAGTGG - Intergenic
1158962970 18:62601648-62601670 GCGGCCTGGGGTAAGGAGCAGGG + Intergenic
1160679635 19:406829-406851 GGGGCCTCGGGGGAAGAGAAGGG - Exonic
1160913689 19:1487060-1487082 GCGGCCCTGGGAAACCAGGAGGG + Exonic
1161384780 19:3985172-3985194 GCGCCCTCGGAAACGGAGAAAGG + Intronic
1162514249 19:11138679-11138701 ACGGCCTGGGGACAGGAGAAGGG - Intronic
1162958736 19:14113955-14113977 GCGGCCTGGGGAAGAGAGAGGGG - Intronic
925267825 2:2579478-2579500 GCTCCCCCGGGAAAGGAGAAGGG - Intergenic
931355834 2:61537453-61537475 GCGGCCGCGGGAAGCGAGCCCGG - Intronic
937366432 2:121265304-121265326 GAGGGCGGGGGAAACGAGAATGG + Intronic
938121688 2:128638529-128638551 GTGGCCTCTGGAAGCCAGAAGGG + Intergenic
944997135 2:205306153-205306175 GCAGCCTCTAGAAACTAGAAAGG + Intronic
946313877 2:218897259-218897281 GCGCCCTGGGGATACAAGAAGGG + Intronic
948801544 2:240435611-240435633 GCGGCCGCGGGAGAGGAGAGGGG - Intergenic
948830638 2:240596832-240596854 GGGCCCTCGGGGACCGAGAAGGG - Exonic
1169781965 20:9319523-9319545 GAGGCCTAGGAAAACGAGTAGGG + Intronic
1173685636 20:44921576-44921598 ACGGCCTGGGGAAAGGAGGAGGG - Exonic
1179155777 21:38849816-38849838 GCGGCCTCTGGAAGCTGGAAAGG + Intergenic
1180067101 21:45418002-45418024 GCTGCCGCAGGAACCGAGAAGGG + Intronic
1183185329 22:36288514-36288536 GGGGCCTCGGGAAACCAGTGGGG + Intronic
960190372 3:114697436-114697458 GCAGCCTAGGGCAACTAGAAAGG + Intronic
969650894 4:8467292-8467314 GCGGCAGCGGGAAACTAGGACGG + Intronic
972762435 4:42120124-42120146 GCGGCCTTGGGAAAAGGAAAAGG - Exonic
978457174 4:108907028-108907050 GCTGTCACGGGAAAAGAGAAGGG + Intronic
987168492 5:15226218-15226240 GGGGCCGGGGGAAAGGAGAATGG - Intergenic
990977199 5:61570455-61570477 GAGGCCTCTGGAAAGGAGAGTGG - Intergenic
1001481793 5:172093758-172093780 GTGGCCCCTGGAAATGAGAACGG - Exonic
1002194207 5:177493492-177493514 TGGGCCTCGGTAAAGGAGAATGG + Intronic
1002375549 5:178786528-178786550 GCTGCCTCAGATAACGAGAAGGG + Intergenic
1004471529 6:15933845-15933867 GCTGCCTCGGGGAAGGAGAAAGG - Intergenic
1004608132 6:17213096-17213118 AGGGCCTTGGGAAAAGAGAAGGG - Intergenic
1012977968 6:105800296-105800318 GGGGCCTCAGGAAGCGAGAGTGG - Intergenic
1020092683 7:5350202-5350224 GAGGCCTCGGAAAACGAGGCTGG + Intronic
1021467690 7:20964251-20964273 GCTGCATCAGGAAACCAGAATGG - Intergenic
1023658622 7:42451069-42451091 GCAGCCTCAGGAACTGAGAATGG + Intergenic
1028841675 7:95435258-95435280 GAAGACTAGGGAAACGAGAAAGG - Intergenic
1049405698 8:142451024-142451046 GCTGCCTCGAGGAACGAGCACGG + Intronic
1056246267 9:84698161-84698183 GTGGCCTTGGGAAAGGAGAATGG - Intronic
1061624729 9:131835008-131835030 GCGGCCTCGGGGAAGATGAAAGG + Intergenic
1197099100 X:122630393-122630415 AGGGCCTAGGGAAATGAGAATGG - Intergenic