ID: 922753814

View in Genome Browser
Species Human (GRCh38)
Location 1:228083129-228083151
Sequence GCGGCCTCGGGAAACGAGAA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 71}

Found 15 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922753814_922753824 4 Left 922753814 1:228083129-228083151 CCTTTCTCGTTTCCCGAGGCCGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 922753824 1:228083156-228083178 GCGTGGACGGTTGGGATTAGCGG 0: 1
1: 0
2: 0
3: 0
4: 48
922753814_922753825 10 Left 922753814 1:228083129-228083151 CCTTTCTCGTTTCCCGAGGCCGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 922753825 1:228083162-228083184 ACGGTTGGGATTAGCGGCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 24
922753814_922753827 12 Left 922753814 1:228083129-228083151 CCTTTCTCGTTTCCCGAGGCCGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 922753827 1:228083164-228083186 GGTTGGGATTAGCGGCCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
922753814_922753833 23 Left 922753814 1:228083129-228083151 CCTTTCTCGTTTCCCGAGGCCGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 922753833 1:228083175-228083197 GCGGCCGCGGGGGCCGGTGGGGG 0: 1
1: 0
2: 5
3: 103
4: 890
922753814_922753836 30 Left 922753814 1:228083129-228083151 CCTTTCTCGTTTCCCGAGGCCGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 922753836 1:228083182-228083204 CGGGGGCCGGTGGGGGTCGTGGG 0: 1
1: 0
2: 2
3: 30
4: 371
922753814_922753819 -5 Left 922753814 1:228083129-228083151 CCTTTCTCGTTTCCCGAGGCCGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 922753819 1:228083147-228083169 GCCGCCCGCGCGTGGACGGTTGG 0: 1
1: 0
2: 1
3: 2
4: 37
922753814_922753831 21 Left 922753814 1:228083129-228083151 CCTTTCTCGTTTCCCGAGGCCGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 922753831 1:228083173-228083195 TAGCGGCCGCGGGGGCCGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 114
922753814_922753821 -4 Left 922753814 1:228083129-228083151 CCTTTCTCGTTTCCCGAGGCCGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 922753821 1:228083148-228083170 CCGCCCGCGCGTGGACGGTTGGG 0: 1
1: 0
2: 0
3: 1
4: 30
922753814_922753828 13 Left 922753814 1:228083129-228083151 CCTTTCTCGTTTCCCGAGGCCGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 922753828 1:228083165-228083187 GTTGGGATTAGCGGCCGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 48
922753814_922753826 11 Left 922753814 1:228083129-228083151 CCTTTCTCGTTTCCCGAGGCCGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 25
922753814_922753835 29 Left 922753814 1:228083129-228083151 CCTTTCTCGTTTCCCGAGGCCGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 922753835 1:228083181-228083203 GCGGGGGCCGGTGGGGGTCGTGG 0: 1
1: 0
2: 7
3: 101
4: 999
922753814_922753830 20 Left 922753814 1:228083129-228083151 CCTTTCTCGTTTCCCGAGGCCGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 922753830 1:228083172-228083194 TTAGCGGCCGCGGGGGCCGGTGG 0: 1
1: 1
2: 1
3: 13
4: 158
922753814_922753818 -9 Left 922753814 1:228083129-228083151 CCTTTCTCGTTTCCCGAGGCCGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 922753818 1:228083143-228083165 CGAGGCCGCCCGCGCGTGGACGG 0: 1
1: 0
2: 0
3: 6
4: 86
922753814_922753832 22 Left 922753814 1:228083129-228083151 CCTTTCTCGTTTCCCGAGGCCGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 922753832 1:228083174-228083196 AGCGGCCGCGGGGGCCGGTGGGG 0: 1
1: 0
2: 0
3: 39
4: 463
922753814_922753829 17 Left 922753814 1:228083129-228083151 CCTTTCTCGTTTCCCGAGGCCGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 922753829 1:228083169-228083191 GGATTAGCGGCCGCGGGGGCCGG 0: 1
1: 0
2: 0
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922753814 Original CRISPR GCGGCCTCGGGAAACGAGAA AGG (reversed) Exonic