ID: 922753816

View in Genome Browser
Species Human (GRCh38)
Location 1:228083141-228083163
Sequence GTCCACGCGCGGGCGGCCTC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 60}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922753816_922753832 10 Left 922753816 1:228083141-228083163 CCCGAGGCCGCCCGCGCGTGGAC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 922753832 1:228083174-228083196 AGCGGCCGCGGGGGCCGGTGGGG 0: 1
1: 0
2: 0
3: 39
4: 463
922753816_922753829 5 Left 922753816 1:228083141-228083163 CCCGAGGCCGCCCGCGCGTGGAC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 922753829 1:228083169-228083191 GGATTAGCGGCCGCGGGGGCCGG 0: 1
1: 0
2: 0
3: 8
4: 126
922753816_922753827 0 Left 922753816 1:228083141-228083163 CCCGAGGCCGCCCGCGCGTGGAC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 922753827 1:228083164-228083186 GGTTGGGATTAGCGGCCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
922753816_922753837 19 Left 922753816 1:228083141-228083163 CCCGAGGCCGCCCGCGCGTGGAC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 922753837 1:228083183-228083205 GGGGGCCGGTGGGGGTCGTGGGG 0: 1
1: 1
2: 6
3: 52
4: 675
922753816_922753824 -8 Left 922753816 1:228083141-228083163 CCCGAGGCCGCCCGCGCGTGGAC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 922753824 1:228083156-228083178 GCGTGGACGGTTGGGATTAGCGG 0: 1
1: 0
2: 0
3: 0
4: 48
922753816_922753835 17 Left 922753816 1:228083141-228083163 CCCGAGGCCGCCCGCGCGTGGAC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 922753835 1:228083181-228083203 GCGGGGGCCGGTGGGGGTCGTGG 0: 1
1: 0
2: 7
3: 101
4: 999
922753816_922753825 -2 Left 922753816 1:228083141-228083163 CCCGAGGCCGCCCGCGCGTGGAC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 922753825 1:228083162-228083184 ACGGTTGGGATTAGCGGCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 24
922753816_922753833 11 Left 922753816 1:228083141-228083163 CCCGAGGCCGCCCGCGCGTGGAC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 922753833 1:228083175-228083197 GCGGCCGCGGGGGCCGGTGGGGG 0: 1
1: 0
2: 5
3: 103
4: 890
922753816_922753826 -1 Left 922753816 1:228083141-228083163 CCCGAGGCCGCCCGCGCGTGGAC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 25
922753816_922753831 9 Left 922753816 1:228083141-228083163 CCCGAGGCCGCCCGCGCGTGGAC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 922753831 1:228083173-228083195 TAGCGGCCGCGGGGGCCGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 114
922753816_922753836 18 Left 922753816 1:228083141-228083163 CCCGAGGCCGCCCGCGCGTGGAC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 922753836 1:228083182-228083204 CGGGGGCCGGTGGGGGTCGTGGG 0: 1
1: 0
2: 2
3: 30
4: 371
922753816_922753828 1 Left 922753816 1:228083141-228083163 CCCGAGGCCGCCCGCGCGTGGAC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 922753828 1:228083165-228083187 GTTGGGATTAGCGGCCGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 48
922753816_922753830 8 Left 922753816 1:228083141-228083163 CCCGAGGCCGCCCGCGCGTGGAC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 922753830 1:228083172-228083194 TTAGCGGCCGCGGGGGCCGGTGG 0: 1
1: 1
2: 1
3: 13
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922753816 Original CRISPR GTCCACGCGCGGGCGGCCTC GGG (reversed) Exonic
900124090 1:1061962-1061984 GTCCACACAGGGGCGGCTTCTGG - Intergenic
902624748 1:17670109-17670131 GGCCACTTGCGGGCTGCCTCTGG - Intronic
903832343 1:26182775-26182797 GGCCACGCGGGTGTGGCCTCAGG + Intronic
922270249 1:224026312-224026334 GTCCACGCCTGGGAGGGCTCAGG + Intergenic
922753816 1:228083141-228083163 GTCCACGCGCGGGCGGCCTCGGG - Exonic
923744400 1:236686812-236686834 CACCACGCGCGGGCGGCCCGCGG - Intronic
1070198009 10:74176721-74176743 CCCCGCGCGCGGGCGGCCCCTGG - Intronic
1072021826 10:91410250-91410272 GCGCGCGCGGGGGCGGCCTCGGG + Intergenic
1077035324 11:491626-491648 GTCCAAGGGCTGGCGGCCACTGG + Intergenic
1077061305 11:618992-619014 GTCCACACCCGGGGGGCCCCCGG - Exonic
1083997113 11:66278137-66278159 GCCGCCGCGCGAGCGGCCTCGGG - Intergenic
1090854336 11:130598620-130598642 GTCCACCCCCGGGCGCCCTAGGG - Intergenic
1094653510 12:32399729-32399751 GTCCAGCCGCGAGCGGCCCCTGG - Intronic
1095949253 12:47773121-47773143 TTCCGGGCGCGGGCGGCCTCCGG + Intronic
1096495456 12:52037158-52037180 GACAGCGCGCGGGCGGCCGCGGG + Intronic
1105975500 13:25468882-25468904 GGCCGCGGGCGGGCGGCCACCGG - Intronic
1113855472 13:113442835-113442857 AGCGACCCGCGGGCGGCCTCAGG - Intronic
1114473886 14:22981293-22981315 ATCCGGGCCCGGGCGGCCTCCGG + Exonic
1121546654 14:94768283-94768305 GGCTAGTCGCGGGCGGCCTCGGG + Exonic
1127547653 15:60005372-60005394 CTCAGCGCGCTGGCGGCCTCGGG + Exonic
1127922597 15:63504902-63504924 GTCCGCGCGCCGGCCGCCTGCGG - Intronic
1129767678 15:78180723-78180745 GCCCACGGGCGGGAGGCCTGGGG - Intronic
1131035152 15:89217236-89217258 GTGCAGGCGCAGGCGGCCTCGGG - Exonic
1131263627 15:90902988-90903010 GTGCGCGCGCGGGAGGGCTCCGG + Exonic
1132585688 16:705069-705091 CTCCCCGGGCGGGCGGCTTCTGG - Intronic
1136111061 16:28063786-28063808 CTCCCCGTGCGGGCGGGCTCCGG - Intergenic
1137057750 16:35753587-35753609 TTCCACGCTGGGGCGCCCTCAGG - Intergenic
1137988688 16:53131193-53131215 GGCCGGGCGGGGGCGGCCTCAGG - Intronic
1141906931 16:87033104-87033126 GCCCACGCCAGGGCGGCCCCGGG + Intergenic
1142211794 16:88811926-88811948 GTCCCCGCGCAGGCGCGCTCGGG - Exonic
1142304444 16:89277757-89277779 ATCCAGGAGCGGGCGCCCTCGGG - Intronic
1160249118 18:77185834-77185856 CTCCACAGGCAGGCGGCCTCTGG - Intergenic
1160773378 19:843738-843760 GCCCACGCGCGCGGGGCCTGGGG - Intronic
1160973795 19:1782430-1782452 GTCCACGAGCGAGCAGCCTATGG - Exonic
1162572349 19:11480695-11480717 GGTCCCGCCCGGGCGGCCTCTGG + Exonic
1163559069 19:18008448-18008470 GGCCCCGCGCGCGCAGCCTCAGG - Exonic
1168339433 19:55614900-55614922 GCCCACGCGGGGGCGGGCGCCGG + Exonic
926325916 2:11785085-11785107 GGCCTCGCGCGGGCGCCCTCTGG + Intronic
935971508 2:108534417-108534439 GCCCCCGCGCGGCCGGCCCCTGG + Intronic
1171123383 20:22583568-22583590 GACAACGCGCGGGGCGCCTCGGG + Intronic
1176202003 20:63865349-63865371 GTCCATGTTCGGGCGGCGTCCGG - Exonic
1179480233 21:41672270-41672292 GTCCTCTCCCGCGCGGCCTCTGG - Intergenic
1180215915 21:46323831-46323853 GGTCCCGCGCGGGCGGCCCCTGG - Exonic
1183665151 22:39242584-39242606 GCCCCCGGGCGGGCGGCCTGCGG + Intronic
1183744711 22:39685868-39685890 GAGCAGGCGCGGGCGGCCCCAGG - Exonic
1184229674 22:43151807-43151829 GTTCCAGCGCGGGCCGCCTCCGG + Intronic
1185351807 22:50343449-50343471 GGCAAAGCCCGGGCGGCCTCGGG - Exonic
950584079 3:13880378-13880400 CTCCACCCGAGGGCAGCCTCTGG - Intergenic
953284407 3:41592369-41592391 GTCCTCGGGCGGGCTGCCTAAGG + Intronic
968698215 4:2042730-2042752 GTCCACGCATGGGCGGCCTGCGG - Exonic
969796597 4:9532368-9532390 GACCCGGCGCGAGCGGCCTCTGG - Intergenic
978361055 4:107931620-107931642 GTCCGGGCGCCGGCGGCCTCGGG - Exonic
985064292 4:186105449-186105471 GTCCCAGCGCGGCCGCCCTCGGG + Intronic
985783331 5:1881997-1882019 GTCCGCCAGCGTGCGGCCTCCGG + Exonic
994072838 5:95620888-95620910 GGCCAGGCGCGGGCGGCCGGGGG - Exonic
1003310165 6:4963657-4963679 GTTCACCCGAGGGAGGCCTCTGG + Intergenic
1022363373 7:29685051-29685073 CTCCCCGCGGCGGCGGCCTCCGG + Intergenic
1024326731 7:48114795-48114817 GTCCACGCCAGGCTGGCCTCTGG + Intergenic
1032260431 7:130331694-130331716 GTCCACCCGCCAGCTGCCTCTGG - Intergenic
1034147330 7:148884472-148884494 GTGCGCGCGCGGGCGGCGGCGGG + Intergenic
1035265155 7:157685999-157686021 GGCCCCGCGCGGTCGCCCTCCGG - Intronic
1049380766 8:142314693-142314715 GTCCACGCGTGGGAGCTCTCTGG + Intronic
1049409035 8:142464274-142464296 CGCCGCGCGCGGGCGGCCGCCGG + Exonic
1051894187 9:21971011-21971033 GTCCACGGGCAGACGGCCCCAGG + Exonic
1055044459 9:71910617-71910639 GTGCAGGTGCGTGCGGCCTCGGG - Exonic
1185610542 X:1391752-1391774 GTCCACGCGCCGCCGGCTTCCGG - Intronic
1198370578 X:135985451-135985473 GTCCGACCGCGGGCGGCCGCCGG + Exonic