ID: 922753817

View in Genome Browser
Species Human (GRCh38)
Location 1:228083142-228083164
Sequence CGTCCACGCGCGGGCGGCCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 57}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922753817_922753830 7 Left 922753817 1:228083142-228083164 CCGAGGCCGCCCGCGCGTGGACG 0: 1
1: 0
2: 0
3: 3
4: 57
Right 922753830 1:228083172-228083194 TTAGCGGCCGCGGGGGCCGGTGG 0: 1
1: 1
2: 1
3: 13
4: 158
922753817_922753832 9 Left 922753817 1:228083142-228083164 CCGAGGCCGCCCGCGCGTGGACG 0: 1
1: 0
2: 0
3: 3
4: 57
Right 922753832 1:228083174-228083196 AGCGGCCGCGGGGGCCGGTGGGG 0: 1
1: 0
2: 0
3: 39
4: 463
922753817_922753833 10 Left 922753817 1:228083142-228083164 CCGAGGCCGCCCGCGCGTGGACG 0: 1
1: 0
2: 0
3: 3
4: 57
Right 922753833 1:228083175-228083197 GCGGCCGCGGGGGCCGGTGGGGG 0: 1
1: 0
2: 5
3: 103
4: 890
922753817_922753828 0 Left 922753817 1:228083142-228083164 CCGAGGCCGCCCGCGCGTGGACG 0: 1
1: 0
2: 0
3: 3
4: 57
Right 922753828 1:228083165-228083187 GTTGGGATTAGCGGCCGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 48
922753817_922753835 16 Left 922753817 1:228083142-228083164 CCGAGGCCGCCCGCGCGTGGACG 0: 1
1: 0
2: 0
3: 3
4: 57
Right 922753835 1:228083181-228083203 GCGGGGGCCGGTGGGGGTCGTGG 0: 1
1: 0
2: 7
3: 101
4: 999
922753817_922753825 -3 Left 922753817 1:228083142-228083164 CCGAGGCCGCCCGCGCGTGGACG 0: 1
1: 0
2: 0
3: 3
4: 57
Right 922753825 1:228083162-228083184 ACGGTTGGGATTAGCGGCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 24
922753817_922753837 18 Left 922753817 1:228083142-228083164 CCGAGGCCGCCCGCGCGTGGACG 0: 1
1: 0
2: 0
3: 3
4: 57
Right 922753837 1:228083183-228083205 GGGGGCCGGTGGGGGTCGTGGGG 0: 1
1: 1
2: 6
3: 52
4: 675
922753817_922753826 -2 Left 922753817 1:228083142-228083164 CCGAGGCCGCCCGCGCGTGGACG 0: 1
1: 0
2: 0
3: 3
4: 57
Right 922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 25
922753817_922753827 -1 Left 922753817 1:228083142-228083164 CCGAGGCCGCCCGCGCGTGGACG 0: 1
1: 0
2: 0
3: 3
4: 57
Right 922753827 1:228083164-228083186 GGTTGGGATTAGCGGCCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
922753817_922753824 -9 Left 922753817 1:228083142-228083164 CCGAGGCCGCCCGCGCGTGGACG 0: 1
1: 0
2: 0
3: 3
4: 57
Right 922753824 1:228083156-228083178 GCGTGGACGGTTGGGATTAGCGG 0: 1
1: 0
2: 0
3: 0
4: 48
922753817_922753831 8 Left 922753817 1:228083142-228083164 CCGAGGCCGCCCGCGCGTGGACG 0: 1
1: 0
2: 0
3: 3
4: 57
Right 922753831 1:228083173-228083195 TAGCGGCCGCGGGGGCCGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 114
922753817_922753829 4 Left 922753817 1:228083142-228083164 CCGAGGCCGCCCGCGCGTGGACG 0: 1
1: 0
2: 0
3: 3
4: 57
Right 922753829 1:228083169-228083191 GGATTAGCGGCCGCGGGGGCCGG 0: 1
1: 0
2: 0
3: 8
4: 126
922753817_922753836 17 Left 922753817 1:228083142-228083164 CCGAGGCCGCCCGCGCGTGGACG 0: 1
1: 0
2: 0
3: 3
4: 57
Right 922753836 1:228083182-228083204 CGGGGGCCGGTGGGGGTCGTGGG 0: 1
1: 0
2: 2
3: 30
4: 371

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922753817 Original CRISPR CGTCCACGCGCGGGCGGCCT CGG (reversed) Exonic
900244574 1:1631284-1631306 CGTCCAGGCGCGAGCGGCTCTGG - Intergenic
903225800 1:21893628-21893650 CAGCCACGGGCGGGCGGCCCAGG + Intronic
912879139 1:113390986-113391008 AGACCCCGCGCGGGCGGCCGGGG - Exonic
918041490 1:180916611-180916633 CGTCCAGGGGCAGGCGGCCTGGG - Exonic
919638708 1:200029246-200029268 CGCGCCCGCGCGGGCGGTCTTGG + Intronic
922753817 1:228083142-228083164 CGTCCACGCGCGGGCGGCCTCGG - Exonic
1071618202 10:87095041-87095063 CGCGCAGGCGCGGGCGGGCTCGG + Intronic
1075393908 10:122113244-122113266 GGGCCACGGGCGGGCGGCCGGGG + Intronic
1083869684 11:65479092-65479114 CGGCCAGGCGCGGGTGGACTAGG + Intergenic
1084276419 11:68053376-68053398 GCTCCACACGCTGGCGGCCTTGG + Exonic
1090854337 11:130598621-130598643 CGTCCACCCCCGGGCGCCCTAGG - Intergenic
1121352447 14:93184581-93184603 CGTCCGTGCGCCGGCGGCCAAGG + Exonic
1122162281 14:99793261-99793283 CGCCCGCGAGGGGGCGGCCTCGG - Intronic
1123036963 14:105475434-105475456 AGTCCAAGCGGGGGCGACCTTGG + Intronic
1124629427 15:31328116-31328138 CGGGCAGGTGCGGGCGGCCTGGG + Intronic
1129767679 15:78180724-78180746 GGCCCACGGGCGGGAGGCCTGGG - Intronic
1131035153 15:89217237-89217259 GGTGCAGGCGCAGGCGGCCTCGG - Exonic
1131108592 15:89750628-89750650 CGTCCGCGCCGGGGCGTCCTGGG - Exonic
1132875628 16:2135723-2135745 CCTCCGCGCGCGGGCGGGCCTGG - Exonic
1134519358 16:14911630-14911652 CCTCCGCGCGCGGGCGGGCCTGG + Intronic
1134554575 16:15154598-15154620 CCTCCGCGCGCGGGCGGGCCTGG - Intergenic
1134707028 16:16310285-16310307 CCTCCGCGCGCGGGCGGGCCTGG + Intergenic
1134960512 16:18401839-18401861 CCTCCGCGCGCGGGCGGGCCTGG - Intergenic
1142211795 16:88811927-88811949 CGTCCCCGCGCAGGCGCGCTCGG - Exonic
1143962135 17:10729785-10729807 CTTCTTCGCGCTGGCGGCCTTGG - Exonic
1148356368 17:46978511-46978533 CGTCCCCGCCCGGGCGCCCCAGG + Exonic
1160766854 19:812646-812668 CGGCGCCACGCGGGCGGCCTGGG - Exonic
1160773379 19:843739-843761 TGCCCACGCGCGCGGGGCCTGGG - Intronic
1160969837 19:1762652-1762674 GGACCACGCGCCCGCGGCCTTGG + Intronic
1165157561 19:33797209-33797231 CCTCCCCACGCGGGCGGTCTCGG + Intronic
928093589 2:28391121-28391143 CGCGCACGCGCGCGCGTCCTTGG + Intergenic
933847433 2:86337313-86337335 CGTCCGCCCGCAGGCGTCCTCGG + Intronic
935595045 2:104871989-104872011 TTCCCACGCGCGGGCCGCCTGGG + Intergenic
936278721 2:111120764-111120786 CCTGCACGCGCCGGCGGCCGCGG + Intronic
937203748 2:120223073-120223095 CGTCCACGCGGAGCCGGCTTGGG - Exonic
937283559 2:120736342-120736364 CGGCCAAGCGCGGGCCGACTGGG + Intronic
942463965 2:176188995-176189017 CGGCCGCGCGGGGGCGGCCGGGG - Exonic
948429712 2:237911790-237911812 GGTGCACCCGCGGGCAGCCTGGG - Exonic
1170898378 20:20436880-20436902 CTGCCACGGGCGGGCGGCCAGGG + Intronic
1173279809 20:41618182-41618204 CGTCCAGGCCCGGCCGGGCTGGG - Intronic
1175404837 20:58719322-58719344 CGTCCATGTGCGTGGGGCCTGGG - Intergenic
1176216232 20:63949275-63949297 CGACCAGGCGAGGGCGGCCCGGG + Intronic
1177783052 21:25640039-25640061 CGTCCGCTCGCGGGCACCCTGGG - Intronic
955916355 3:63912216-63912238 CTTCCCCGCGCGGGCTGCCATGG + Intronic
956487735 3:69739942-69739964 CGTCCAGGCGCGGGGACCCTCGG + Intronic
967858547 3:194135215-194135237 CCTCGCCCCGCGGGCGGCCTCGG - Intergenic
968450689 4:674721-674743 CGCCCACCCGAGGGTGGCCTGGG + Intronic
968519384 4:1028794-1028816 CCTCCACGTGCAGGAGGCCTGGG + Intergenic
968643036 4:1724257-1724279 CCACCACGCCCGGCCGGCCTTGG + Intronic
978361056 4:107931621-107931643 GGTCCGGGCGCCGGCGGCCTCGG - Exonic
990383149 5:55234597-55234619 CTGCCACGCCCGGTCGGCCTGGG - Intergenic
994072839 5:95620889-95620911 CGGCCAGGCGCGGGCGGCCGGGG - Exonic
996785074 5:127229414-127229436 CGTCCTCGCGCCGGCGACCCTGG + Intergenic
1002405054 5:179024008-179024030 CGTCCGAGCCGGGGCGGCCTCGG + Intronic
1004194130 6:13488388-13488410 CGTCTACGCGGGGGCGGGCATGG - Intergenic
1029640224 7:101815791-101815813 CGGCCTCGCGCGCGCGGCCCCGG - Intergenic
1034147329 7:148884471-148884493 CGTGCGCGCGCGGGCGGCGGCGG + Intergenic
1040501457 8:48008679-48008701 CGGCCGCGCGCCGGCGGGCTGGG + Intronic
1040627335 8:49163912-49163934 CGTCCATGCACGGCCTGCCTTGG - Intergenic
1049406220 8:142452847-142452869 CGGCCCCGCGCCGGCCGCCTGGG - Intronic
1062352660 9:136146905-136146927 CCTCCACACGGGGGTGGCCTGGG - Intergenic