ID: 922753820

View in Genome Browser
Species Human (GRCh38)
Location 1:228083148-228083170
Sequence CCCAACCGTCCACGCGCGGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 26
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 25}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922753820_922753827 -7 Left 922753820 1:228083148-228083170 CCGCCCGCGCGTGGACGGTTGGG 0: 1
1: 0
2: 0
3: 0
4: 25
Right 922753827 1:228083164-228083186 GGTTGGGATTAGCGGCCGCGGGG 0: 1
1: 0
2: 0
3: 3
4: 50
922753820_922753831 2 Left 922753820 1:228083148-228083170 CCGCCCGCGCGTGGACGGTTGGG 0: 1
1: 0
2: 0
3: 0
4: 25
Right 922753831 1:228083173-228083195 TAGCGGCCGCGGGGGCCGGTGGG 0: 1
1: 0
2: 0
3: 5
4: 114
922753820_922753837 12 Left 922753820 1:228083148-228083170 CCGCCCGCGCGTGGACGGTTGGG 0: 1
1: 0
2: 0
3: 0
4: 25
Right 922753837 1:228083183-228083205 GGGGGCCGGTGGGGGTCGTGGGG 0: 1
1: 1
2: 6
3: 52
4: 675
922753820_922753825 -9 Left 922753820 1:228083148-228083170 CCGCCCGCGCGTGGACGGTTGGG 0: 1
1: 0
2: 0
3: 0
4: 25
Right 922753825 1:228083162-228083184 ACGGTTGGGATTAGCGGCCGCGG 0: 1
1: 0
2: 0
3: 0
4: 24
922753820_922753836 11 Left 922753820 1:228083148-228083170 CCGCCCGCGCGTGGACGGTTGGG 0: 1
1: 0
2: 0
3: 0
4: 25
Right 922753836 1:228083182-228083204 CGGGGGCCGGTGGGGGTCGTGGG 0: 1
1: 0
2: 2
3: 30
4: 371
922753820_922753830 1 Left 922753820 1:228083148-228083170 CCGCCCGCGCGTGGACGGTTGGG 0: 1
1: 0
2: 0
3: 0
4: 25
Right 922753830 1:228083172-228083194 TTAGCGGCCGCGGGGGCCGGTGG 0: 1
1: 1
2: 1
3: 13
4: 158
922753820_922753829 -2 Left 922753820 1:228083148-228083170 CCGCCCGCGCGTGGACGGTTGGG 0: 1
1: 0
2: 0
3: 0
4: 25
Right 922753829 1:228083169-228083191 GGATTAGCGGCCGCGGGGGCCGG 0: 1
1: 0
2: 0
3: 8
4: 126
922753820_922753826 -8 Left 922753820 1:228083148-228083170 CCGCCCGCGCGTGGACGGTTGGG 0: 1
1: 0
2: 0
3: 0
4: 25
Right 922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 25
922753820_922753835 10 Left 922753820 1:228083148-228083170 CCGCCCGCGCGTGGACGGTTGGG 0: 1
1: 0
2: 0
3: 0
4: 25
Right 922753835 1:228083181-228083203 GCGGGGGCCGGTGGGGGTCGTGG 0: 1
1: 0
2: 7
3: 101
4: 999
922753820_922753828 -6 Left 922753820 1:228083148-228083170 CCGCCCGCGCGTGGACGGTTGGG 0: 1
1: 0
2: 0
3: 0
4: 25
Right 922753828 1:228083165-228083187 GTTGGGATTAGCGGCCGCGGGGG 0: 1
1: 0
2: 0
3: 3
4: 48
922753820_922753832 3 Left 922753820 1:228083148-228083170 CCGCCCGCGCGTGGACGGTTGGG 0: 1
1: 0
2: 0
3: 0
4: 25
Right 922753832 1:228083174-228083196 AGCGGCCGCGGGGGCCGGTGGGG 0: 1
1: 0
2: 0
3: 39
4: 463
922753820_922753833 4 Left 922753820 1:228083148-228083170 CCGCCCGCGCGTGGACGGTTGGG 0: 1
1: 0
2: 0
3: 0
4: 25
Right 922753833 1:228083175-228083197 GCGGCCGCGGGGGCCGGTGGGGG 0: 1
1: 0
2: 5
3: 103
4: 890

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922753820 Original CRISPR CCCAACCGTCCACGCGCGGG CGG (reversed) Exonic
903007841 1:20310232-20310254 CCCAACAGACCACGCGGGGAGGG - Intronic
917835559 1:178938991-178939013 CCCAGCCCTCCACGCTCTGGAGG - Intergenic
922753820 1:228083148-228083170 CCCAACCGTCCACGCGCGGGCGG - Exonic
1074137957 10:110644242-110644264 CCCGGCCGGCCACGCGGGGGCGG - Intergenic
1090645760 11:128765470-128765492 CCCCACCGTCCACAAACGGGAGG + Intronic
1092750203 12:11711868-11711890 CCCAACCTTCCCCCCGTGGGTGG + Intronic
1108292552 13:48976041-48976063 CCCAACAGTCAGCGCGCCGGCGG + Intronic
1127953632 15:63834036-63834058 CCCAACAGGCCCAGCGCGGGAGG + Intergenic
1134192790 16:12135409-12135431 CCCAACTGTCCAGGCCTGGGTGG - Intronic
1160767046 19:813298-813320 CCCCACCGTGCAGGCGCGGCCGG - Exonic
1161072871 19:2271117-2271139 CCCAACCTTCCCAGGGCGGGGGG - Intronic
1163786411 19:19277160-19277182 CCCAGCCCTGCACCCGCGGGAGG - Intronic
1166809679 19:45507795-45507817 CCGACCCGTCCCCGCCCGGGCGG + Intronic
1168721029 19:58555128-58555150 CCCAACCTTCCGGGTGCGGGCGG - Intergenic
1175951431 20:62585624-62585646 CTCAGCCGGACACGCGCGGGGGG + Intergenic
1179511730 21:41878522-41878544 CCCACCTGTCCACGCGAGGCGGG + Intronic
1179574705 21:42300709-42300731 CCCAACTGGCCAGGCGGGGGAGG + Intergenic
1181585223 22:23849422-23849444 CCCACCCGGCCCCGCGCGGCTGG + Intergenic
994648578 5:102499020-102499042 CTCAACCGTCAACCCCCGGGAGG - Intergenic
998135356 5:139671499-139671521 CCCAACCCGCCACCCGCGGCTGG - Intronic
1009940532 6:70283181-70283203 CCAAAGCGTCCAGGCCCGGGAGG + Intronic
1029089428 7:98036590-98036612 CCCAACTGTCCACCAGCGGATGG - Intergenic
1031134867 7:117873465-117873487 CTCAGCCGTCTCCGCGCGGGCGG + Exonic
1033406495 7:141074514-141074536 CCCAGCGGTCCAGGCGCGAGCGG - Exonic
1049199817 8:141334538-141334560 CCCAACAGTCCACGGGAGGTTGG - Intergenic
1061170179 9:128947903-128947925 CCAAACGGTCCCCGCGCGCGGGG + Intronic