ID: 922753826

View in Genome Browser
Species Human (GRCh38)
Location 1:228083163-228083185
Sequence CGGTTGGGATTAGCGGCCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 25}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922753810_922753826 23 Left 922753810 1:228083117-228083139 CCCTCGCCTCTGCCTTTCTCGTT 0: 1
1: 0
2: 0
3: 36
4: 282
Right 922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 25
922753817_922753826 -2 Left 922753817 1:228083142-228083164 CCGAGGCCGCCCGCGCGTGGACG 0: 1
1: 0
2: 0
3: 3
4: 57
Right 922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 25
922753812_922753826 17 Left 922753812 1:228083123-228083145 CCTCTGCCTTTCTCGTTTCCCGA 0: 1
1: 0
2: 4
3: 18
4: 208
Right 922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 25
922753816_922753826 -1 Left 922753816 1:228083141-228083163 CCCGAGGCCGCCCGCGCGTGGAC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 25
922753814_922753826 11 Left 922753814 1:228083129-228083151 CCTTTCTCGTTTCCCGAGGCCGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 25
922753811_922753826 22 Left 922753811 1:228083118-228083140 CCTCGCCTCTGCCTTTCTCGTTT 0: 1
1: 0
2: 2
3: 32
4: 336
Right 922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 25
922753809_922753826 30 Left 922753809 1:228083110-228083132 CCTGCTTCCCTCGCCTCTGCCTT 0: 1
1: 0
2: 4
3: 58
4: 717
Right 922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 25
922753820_922753826 -8 Left 922753820 1:228083148-228083170 CCGCCCGCGCGTGGACGGTTGGG 0: 1
1: 0
2: 0
3: 0
4: 25
Right 922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922753826 Original CRISPR CGGTTGGGATTAGCGGCCGC GGG Exonic
916462056 1:165035252-165035274 AGGTTGGGATTGGCTGCCCCTGG - Intergenic
922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG + Exonic
1067116008 10:43436275-43436297 CAGTTGGAATTAGCAGCCTCAGG - Intergenic
1091205787 11:133820064-133820086 CAGATGGGCTTAGCGGCCTCAGG - Intergenic
1106340202 13:28820107-28820129 AGGTTGGGCTGGGCGGCCGCCGG + Intergenic
1110138689 13:72101013-72101035 TGGTTGGGATTGGAGGCCCCAGG - Intergenic
1128264116 15:66253071-66253093 TGCTGGGGCTTAGCGGCCGCGGG + Intronic
1149296273 17:55265027-55265049 CGCTGGGGAGCAGCGGCCGCCGG + Exonic
1149772723 17:59333334-59333356 CAGTTGGGCTTTGCCGCCGCAGG + Intronic
1160789900 19:918518-918540 CGGTGGGGATGCGCGGGCGCTGG - Intronic
1163503235 19:17688247-17688269 GGGTCGGGCTCAGCGGCCGCTGG + Intronic
925366283 2:3314267-3314289 CAGCTGGCATTAGCGGCAGCCGG - Intronic
926018588 2:9474987-9475009 GGGTCCGGGTTAGCGGCCGCGGG + Intronic
927981947 2:27380053-27380075 GGTTAAGGATTAGCGGCCGCTGG - Intronic
969442670 4:7226614-7226636 CGGTCTGGATTAGTGGCCTCGGG - Intronic
975370015 4:73574275-73574297 CTGTTGGGATTAGGAGCCGGAGG - Exonic
981615276 4:146638585-146638607 CGATTGTGAGTAGCAGCCGCGGG + Intergenic
1005587726 6:27293300-27293322 CGATTGGGTTTAACGGCCCCTGG + Intronic
1006089486 6:31620209-31620231 CGGGCGGGATTAGCTGCCGGAGG - Intergenic
1008013155 6:46490640-46490662 TGCTTGGGATTAGCGGCCTTGGG - Intronic
1010569564 6:77461950-77461972 CCTTTGGGATTGGCTGCCGCAGG + Intergenic
1018169938 6:161136714-161136736 CGCTTGTGATTTGCGGCCACGGG - Intronic
1024548878 7:50543953-50543975 CGGCAGGGATCAGCGGCCGCAGG + Exonic
1026817145 7:73521945-73521967 CGGTGGGGACTGGCGGCTGCTGG + Exonic
1038303816 8:26381571-26381593 TGGTAGGGATTGGCGGCTGCTGG - Intergenic
1049936360 9:504733-504755 AGGTTGGGAGGAGCGGCCGAAGG + Exonic
1193537551 X:82732377-82732399 CGAGTGGGATTAGGGGCGGCGGG - Intergenic