ID: 922753826

View in Genome Browser
Species Human (GRCh38)
Location 1:228083163-228083185
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 27
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 25}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922753812_922753826 17 Left 922753812 1:228083123-228083145 CCTCTGCCTTTCTCGTTTCCCGA 0: 1
1: 0
2: 4
3: 18
4: 208
Right 922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 25
922753816_922753826 -1 Left 922753816 1:228083141-228083163 CCCGAGGCCGCCCGCGCGTGGAC 0: 1
1: 0
2: 0
3: 6
4: 60
Right 922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 25
922753820_922753826 -8 Left 922753820 1:228083148-228083170 CCGCCCGCGCGTGGACGGTTGGG 0: 1
1: 0
2: 0
3: 0
4: 25
Right 922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 25
922753810_922753826 23 Left 922753810 1:228083117-228083139 CCCTCGCCTCTGCCTTTCTCGTT 0: 1
1: 0
2: 0
3: 36
4: 282
Right 922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 25
922753817_922753826 -2 Left 922753817 1:228083142-228083164 CCGAGGCCGCCCGCGCGTGGACG 0: 1
1: 0
2: 0
3: 3
4: 57
Right 922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 25
922753809_922753826 30 Left 922753809 1:228083110-228083132 CCTGCTTCCCTCGCCTCTGCCTT 0: 1
1: 0
2: 4
3: 58
4: 717
Right 922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 25
922753811_922753826 22 Left 922753811 1:228083118-228083140 CCTCGCCTCTGCCTTTCTCGTTT 0: 1
1: 0
2: 2
3: 32
4: 336
Right 922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 25
922753814_922753826 11 Left 922753814 1:228083129-228083151 CCTTTCTCGTTTCCCGAGGCCGC 0: 1
1: 0
2: 0
3: 8
4: 71
Right 922753826 1:228083163-228083185 CGGTTGGGATTAGCGGCCGCGGG 0: 1
1: 0
2: 0
3: 1
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type