ID: 922754823

View in Genome Browser
Species Human (GRCh38)
Location 1:228089880-228089902
Sequence GTGTAGTTCAGGAAGTGAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922754820_922754823 -2 Left 922754820 1:228089859-228089881 CCCAGCATGTCTGTGGTGAGTGT 0: 1
1: 0
2: 5
3: 17
4: 153
Right 922754823 1:228089880-228089902 GTGTAGTTCAGGAAGTGAACTGG 0: 1
1: 0
2: 1
3: 13
4: 133
922754818_922754823 16 Left 922754818 1:228089841-228089863 CCTGGCAGTAGCTCAGTGCCCAG 0: 1
1: 0
2: 2
3: 36
4: 322
Right 922754823 1:228089880-228089902 GTGTAGTTCAGGAAGTGAACTGG 0: 1
1: 0
2: 1
3: 13
4: 133
922754821_922754823 -3 Left 922754821 1:228089860-228089882 CCAGCATGTCTGTGGTGAGTGTG 0: 1
1: 0
2: 3
3: 25
4: 230
Right 922754823 1:228089880-228089902 GTGTAGTTCAGGAAGTGAACTGG 0: 1
1: 0
2: 1
3: 13
4: 133
922754817_922754823 27 Left 922754817 1:228089830-228089852 CCAGAACAGTGCCTGGCAGTAGC 0: 1
1: 0
2: 4
3: 26
4: 210
Right 922754823 1:228089880-228089902 GTGTAGTTCAGGAAGTGAACTGG 0: 1
1: 0
2: 1
3: 13
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922754823 Original CRISPR GTGTAGTTCAGGAAGTGAAC TGG Intronic
905085794 1:35375235-35375257 GAGTAGTTCAGAAAGTAAAATGG - Intronic
905627031 1:39495926-39495948 GTCTGGTTCAGGAAGGGATCAGG - Intronic
905669904 1:39784845-39784867 GTCTGGTTCAGGAAGGGATCAGG + Intronic
906778474 1:48551071-48551093 TTGTAGGTCAGGAAGTGACAAGG - Intronic
906946142 1:50295965-50295987 GAGCAGTTCAGGAAGGCAACAGG - Intergenic
912843173 1:113057358-113057380 GCCTAGATCAGGCAGTGAACTGG + Intergenic
916501391 1:165390363-165390385 CTGTAATTCAGGAAGGGAAGAGG + Intergenic
917362048 1:174187281-174187303 GTAGAGTGAAGGAAGTGAACAGG + Intronic
919180325 1:194072080-194072102 GTATAGTTCAGGAATTGGTCTGG + Intergenic
919561366 1:199124084-199124106 ATTTAGTTCATTAAGTGAACGGG + Intergenic
921246386 1:213246292-213246314 ATGGAGTTCAGGAAGAGAAAAGG + Intronic
922754823 1:228089880-228089902 GTGTAGTTCAGGAAGTGAACTGG + Intronic
922890068 1:229055100-229055122 ATGCAGGGCAGGAAGTGAACAGG + Intergenic
1065452297 10:25871501-25871523 GTGTACTTCAGAAAATGAAATGG - Intergenic
1068903159 10:62292705-62292727 GTAAAGTTCAGAAAGTGAAGAGG + Intergenic
1076606615 10:131693689-131693711 GTGTAGCTGAGGAAGGGGACAGG - Intergenic
1077148862 11:1059498-1059520 GTGTGGTTCAGGGAGTTAGCAGG + Intergenic
1077579550 11:3407968-3407990 CTGCAGTTTAGGAAGTGATCAGG + Intergenic
1078385794 11:10891397-10891419 TTGTAGTTGAGGAAGTGGAGGGG - Intergenic
1079437637 11:20474087-20474109 GTGCAGTTCAGGCTGGGAACAGG - Intronic
1080444509 11:32325537-32325559 TTTTAGTTCAGGAAGGGAAAAGG - Intergenic
1084835852 11:71801487-71801509 CTGCAGTTTAGGAAGTGATCAGG - Intergenic
1086375699 11:86198585-86198607 GTGTTCTTCAGTAGGTGAACTGG + Intergenic
1086808903 11:91280073-91280095 GTGTAGTACATTAAGTGACCTGG - Intergenic
1087560221 11:99780921-99780943 TTGTAGATCAGGAAGGGAAAGGG + Intronic
1088022743 11:105139443-105139465 ATGTAGTTCAGGATGAGAATGGG - Intronic
1091169898 11:133510693-133510715 GTGTAGGTCAGGTAGTAAATGGG - Intronic
1092407474 12:8230916-8230938 CTGCAGTTTAGGAAGTGATCAGG + Intergenic
1094130187 12:27066565-27066587 GTGTAGATAAGGCAGTGAAATGG - Intergenic
1094179650 12:27578577-27578599 GTGTAGATAAGGTAGTGAAATGG - Intronic
1104124951 12:125837635-125837657 GTGAAGGTCAGGAAGTTAAAGGG + Intergenic
1104628068 12:130376104-130376126 GTGGAGTTCAGGGAGGAAACTGG - Intergenic
1105617939 13:22037554-22037576 GTGGAGGTCAGCTAGTGAACTGG + Intergenic
1106859025 13:33884942-33884964 GAGGAGTTCAGGAAATGACCTGG - Intronic
1111672092 13:91344992-91345014 GTTGAGTTCAGAAAGTGAACTGG - Intergenic
1116763308 14:49040862-49040884 GTGAAGTTTAGGGAGTGAAGGGG - Intergenic
1117938072 14:60929668-60929690 GTGTAATTCAGGAAAAGAAAAGG - Intronic
1118340380 14:64891201-64891223 GAGCAGCTCAGGAAGTCAACTGG + Intergenic
1118662289 14:68028110-68028132 GTGTACTTCAGGCTGTGATCTGG + Intronic
1126044783 15:44629084-44629106 GTGTAGTTGAGTAAGTGAAATGG - Intronic
1130579277 15:85120886-85120908 GTGTAATGCTGGAAGTGAGCTGG + Exonic
1133691195 16:8217016-8217038 GTACACTGCAGGAAGTGAACTGG + Intergenic
1135692875 16:24557934-24557956 GTGAAGTTGAGGAAGTGAGCAGG - Intronic
1138739763 16:59294465-59294487 GTGTAGCTCTTGAAGTGAATGGG - Intergenic
1146063694 17:29619910-29619932 GTAAAGTGCAGGAAGTGGACTGG - Intronic
1148104089 17:45110129-45110151 GAGTCTTTAAGGAAGTGAACTGG - Exonic
1153354826 18:4123252-4123274 CTGGAATGCAGGAAGTGAACTGG - Intronic
1155161188 18:23197043-23197065 GTGCAGCTCAAGAAATGAACAGG + Intronic
1161297929 19:3529016-3529038 GAGTAGTTGAGGAAGTGGATGGG + Intronic
1164460791 19:28445855-28445877 CTGAAGTCCAGGGAGTGAACAGG + Intergenic
1165373019 19:35421687-35421709 CTGTAGTGCAGAAAGTGCACAGG - Intergenic
1165481136 19:36064973-36064995 GCGTATTTCAGGAGGGGAACTGG + Intronic
1168586287 19:57596136-57596158 ATGTCCTTCAGTAAGTGAACAGG + Intergenic
928091701 2:28378544-28378566 GTGTAGCAGAGGAAGGGAACAGG + Intergenic
928762254 2:34598601-34598623 GTGAAATTAAGGAAGAGAACAGG - Intergenic
929251120 2:39756620-39756642 GGGTAGCAGAGGAAGTGAACAGG + Intronic
930087203 2:47506186-47506208 CTGTAGAACAGCAAGTGAACAGG + Intronic
930161552 2:48163001-48163023 TGGTAGTTGAGGAAATGAACTGG - Intergenic
930916536 2:56696957-56696979 GTGCTGTTCAGGATGTGAAATGG + Intergenic
932038422 2:68272341-68272363 GTGTAGTTCAGGAGGAGAATGGG - Intergenic
934979217 2:98826479-98826501 GTGTTCTGAAGGAAGTGAACGGG + Intronic
936730189 2:115373744-115373766 GGGTAGTTCAGGAAGAAAAGAGG + Intronic
938384367 2:130853822-130853844 GTGTGGCTCAGGAGGTGAGCCGG + Intronic
938979723 2:136514616-136514638 GTGTAGTTCAGGGACTGCACGGG + Intergenic
942204005 2:173601216-173601238 GTGTAGTTCAGAAAATAAAAAGG + Intergenic
944844627 2:203656305-203656327 GTGGTGTTTAGGCAGTGAACAGG + Intergenic
947543975 2:230997762-230997784 GTGGAGTTCAGGAGGTGGGCTGG + Intronic
948207690 2:236171251-236171273 GGGAAGTTCACGAAGTTAACTGG - Intergenic
1169549813 20:6691133-6691155 ATGTAGATAAGGGAGTGAACAGG + Intergenic
1171118108 20:22544412-22544434 GTGTAGGTCAGAAATTTAACAGG - Intergenic
1172976304 20:38908388-38908410 CTGTAGTTAAGGAGGTGATCGGG + Intronic
1173179186 20:40789461-40789483 GTGTAGTGAAGGAAGGGAAGAGG + Intergenic
1174742724 20:53031481-53031503 GTGGAGTGCAGCAAGTGAACAGG + Intronic
1174862281 20:54102248-54102270 GTGTGGATCTGGAACTGAACGGG + Intergenic
1175553083 20:59829410-59829432 GAGAAGTTCAGGAAGAGAAGAGG - Intronic
1177181372 21:17747921-17747943 GAGTATATCAGGAAGGGAACAGG + Intergenic
1177181873 21:17753138-17753160 GAGTATATCAGGAAGGGAACAGG - Intergenic
1178197309 21:30361615-30361637 GTATAGTTCAGGAAACTAACTGG + Intronic
1179528561 21:42001449-42001471 GTCTTGTGCAGGAAGAGAACAGG + Intronic
1180614345 22:17118246-17118268 GTGTAGATCAGAAAGTGAGGTGG - Exonic
952804117 3:37330629-37330651 GAGTAGTACAGCAAGTGGACAGG + Intronic
952854120 3:37753451-37753473 GTCTAGTTCACCAAGAGAACAGG + Intronic
953854592 3:46491381-46491403 GTGTATTTCAGCCAATGAACAGG + Intergenic
955779574 3:62469959-62469981 GTGTAGCACAGGAAGTCAAGTGG - Intronic
956510439 3:69988013-69988035 TTGTGGGTCAGGAAGTGAACAGG + Intergenic
957052517 3:75421290-75421312 CTGCAGTTTAGGAAGTGATCAGG + Intergenic
960675856 3:120194023-120194045 CAGAAGTTCAGGATGTGAACTGG + Intronic
961302325 3:125930264-125930286 CTGCAGTTTAGGAAGTGATCAGG - Intronic
961886134 3:130097521-130097543 CTGCAGTTTAGGAAGTGATCAGG + Intronic
964857699 3:161164901-161164923 GTGCAGTTCAGCAGGTGAACAGG - Intronic
965888527 3:173479400-173479422 GGGTAGGTCAGGAATAGAACTGG + Intronic
965894971 3:173564449-173564471 GTGTAATCCATGAAGAGAACTGG - Intronic
967408310 3:189141832-189141854 GTGTAATGAAGGAAGAGAACAGG + Intronic
968995327 4:3941672-3941694 CTGCAGTTTAGGAAGTGAGCAGG + Intergenic
969027891 4:4189166-4189188 GGGTGGTTGAGGAAGTGAGCAGG - Intronic
969818632 4:9704591-9704613 CTGCAGTTTAGGAAGTGATCAGG - Intergenic
970855815 4:20648660-20648682 CTGAAGGTCAGGGAGTGAACAGG - Intergenic
974467571 4:62276732-62276754 GAAGAGTTCATGAAGTGAACCGG + Intergenic
975268189 4:72396074-72396096 GTGAAAATCAGGAAGTTAACTGG + Intronic
977375875 4:96203394-96203416 CTGTTGTTCAGGAAGTGAGTTGG + Intergenic
977397210 4:96485827-96485849 GTGTAGTTCAGGAATCACACAGG + Intergenic
978763217 4:112377947-112377969 GTGTCGTTCAGGCAGGGGACAGG - Intronic
980057411 4:128091767-128091789 TTGTAGTTCTGGTAGAGAACGGG + Intronic
980175446 4:129338922-129338944 CTGGAGTTCAGGAAGAGACCTGG + Intergenic
983268152 4:165529636-165529658 GAGTAATTCAGGAAGTAAAGAGG - Intergenic
985371557 4:189290501-189290523 GTGTAGGTGAGGGAGTGAAGTGG - Intergenic
986418328 5:7550679-7550701 GTGTAATGCAGGGAGTGGACTGG - Intronic
986480480 5:8181735-8181757 GAGCAGTTGAGGAAGTGAGCAGG + Intergenic
986745739 5:10743146-10743168 GTGTACTTCAGTTAGTAAACAGG - Intronic
989730853 5:44646619-44646641 GAGTAGTTAGGGAAATGAACAGG + Intergenic
991449021 5:66732087-66732109 CAGTAGTCTAGGAAGTGAACTGG - Intronic
998095936 5:139395464-139395486 GTGCAGTTCAGGCTGTGAGCGGG + Exonic
1006197488 6:32254867-32254889 GGGTGGTTCAGGGAGTGAATAGG + Intergenic
1012198286 6:96372707-96372729 CTGTGGTTCAGGAAGTGAACAGG + Intergenic
1012979180 6:105811996-105812018 GTGTTGTGCAGGAGATGAACAGG + Intergenic
1013482810 6:110566684-110566706 GTTTAGTTCAGGAAGCAAACTGG + Intergenic
1017028357 6:150200270-150200292 CTGTACTTCAGAAAGTTAACTGG - Intronic
1017515825 6:155154966-155154988 GTGTATTTCTGGATGTGTACAGG + Intronic
1018125319 6:160677178-160677200 GTGTATATCATGGAGTGAACTGG + Intergenic
1020319599 7:6929989-6930011 CTGCAGTTTAGGAAGTGATCAGG + Intergenic
1021326133 7:19271920-19271942 GTGTAGTTCTGGAAATGATTAGG - Intergenic
1022034309 7:26519180-26519202 GTGTAGGCCAGTAAGAGAACAGG + Intergenic
1028617390 7:92783882-92783904 GTCCAGTTCAGGAATTGATCTGG - Intronic
1029034171 7:97501299-97501321 GTGGATTTCAGGAACTGACCAGG + Intergenic
1029480247 7:100807931-100807953 ATGCAGTTTAGGAAGTGGACGGG - Intronic
1036716550 8:11130113-11130135 GTCTAGTTCTAGAAGTGAAAAGG - Intronic
1037303842 8:17483890-17483912 GTGTAGTTCTTGAAGTGAAATGG - Intergenic
1038572673 8:28676344-28676366 GTGCACTTCAGTCAGTGAACTGG + Intronic
1039918194 8:41875133-41875155 TTGGAGTTCAGGAAGAGAAAGGG - Intronic
1041696235 8:60739667-60739689 CTGTAGTTCTGACAGTGAACAGG + Intronic
1044096146 8:88068557-88068579 GTATAGTACAGGATGTGAATTGG + Intronic
1044926165 8:97210373-97210395 GGCTGGCTCAGGAAGTGAACTGG + Intergenic
1049981662 9:909366-909388 GTGTATTTCAGAAGGTGAACGGG + Intronic
1056424397 9:86462429-86462451 GTGAGGCTCAGGAAATGAACTGG + Intergenic
1056873763 9:90308068-90308090 GTGAAGTGCAGGCAGAGAACAGG + Intergenic
1058884229 9:109311250-109311272 GTGCAGCTCAGCAAGTGAACAGG + Intronic
1061226768 9:129284947-129284969 GAGGAGTTCAGGAAGAGCACTGG + Intergenic
1061695860 9:132372922-132372944 ATGTATTTCAGGAAATAAACAGG + Intergenic
1061930676 9:133831565-133831587 CTGTAGTTCAGGAAGTGTCCTGG + Intronic
1186951225 X:14627677-14627699 GAGTTGTTCAGGAAGTGAGTAGG - Intronic
1191202951 X:57804143-57804165 GTTTAGTTCAAGATGAGAACTGG - Intergenic
1192127216 X:68513181-68513203 GTGTAGTGAAGGAGTTGAACTGG + Intronic
1200820636 Y:7579167-7579189 GTCTACTTCTGGAAGTGAATGGG + Intergenic
1201141440 Y:11031860-11031882 GTGGAATTCATGAAGTGAAGTGG - Intergenic
1202039287 Y:20665932-20665954 GAGGATTTCAGAAAGTGAACAGG - Intergenic
1202239671 Y:22753575-22753597 GTCTACTTCTGGAAGTGAATGGG - Intergenic
1202392656 Y:24387337-24387359 GTCTACTTCTGGAAGTGAATGGG - Intergenic
1202478126 Y:25282780-25282802 GTCTACTTCTGGAAGTGAATGGG + Intergenic