ID: 922758103

View in Genome Browser
Species Human (GRCh38)
Location 1:228107837-228107859
Sequence CAGAGCACCGTGAAGGCCAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 145}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922758103_922758108 12 Left 922758103 1:228107837-228107859 CCGGTGGCCTTCACGGTGCTCTG 0: 1
1: 0
2: 0
3: 11
4: 145
Right 922758108 1:228107872-228107894 GCAGATAAATGTTCAAGCTCTGG 0: 1
1: 0
2: 1
3: 23
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922758103 Original CRISPR CAGAGCACCGTGAAGGCCAC CGG (reversed) Exonic
900187480 1:1339187-1339209 CACAGCCCCATGACGGCCACAGG + Intronic
900690847 1:3979424-3979446 CAGAGCACCGAGAGGGCCTGGGG - Intergenic
900997271 1:6129384-6129406 CAGAGCTTCGTGGGGGCCACGGG + Intronic
902255210 1:15184433-15184455 CAGAGTACCTTGAAGGCAAGTGG + Intronic
902301439 1:15505454-15505476 CAAAACACCGTGCAGACCACAGG + Intronic
902394783 1:16126678-16126700 CAGACCACGGTGAAGGAGACAGG + Intronic
902760597 1:18578358-18578380 CAGAACAGCGAGAAGGCCAGAGG + Intergenic
914904160 1:151730160-151730182 CAGTGCATCGTGCAGGCCAGAGG - Intergenic
916311286 1:163401482-163401504 CAGAATACTGTGAAGGTCACTGG - Intergenic
922758103 1:228107837-228107859 CAGAGCACCGTGAAGGCCACCGG - Exonic
1066554800 10:36600245-36600267 CTGAGCACCATGAAGGCTTCAGG + Intergenic
1066649712 10:37642829-37642851 CAGAGCACCGAGCAGGCTCCTGG - Intergenic
1068523951 10:58106698-58106720 CTGAGCATCCTGAACGCCACTGG + Intergenic
1071992241 10:91110968-91110990 ATGTGCACCGTGGAGGCCACAGG - Intergenic
1073314063 10:102566001-102566023 CAGAGGGCAGTGAAGCCCACTGG + Intronic
1075732236 10:124643528-124643550 CAGAGCCCCGGGAGGGCCAGCGG + Intronic
1076815545 10:132913055-132913077 CTGAGCATCGTTAAGGCCACAGG - Exonic
1077471978 11:2768180-2768202 CACAGCGCCATGGAGGCCACAGG - Intronic
1079150471 11:17894601-17894623 CACAGCACTGTGCAAGCCACTGG - Intronic
1081653274 11:44839788-44839810 CAGAGGACAGAGAAGGCCAGTGG + Intronic
1081864317 11:46351329-46351351 TTGAGCACCGTGAAGGGCAGGGG - Intronic
1083143427 11:60739976-60739998 GAGAGCTCCCTGAAGGCCCCAGG + Intronic
1085394663 11:76201221-76201243 CAGAGCAGTGTGAAGGCCCAGGG + Intronic
1089297310 11:117477887-117477909 CAGAGCACTGAGAAGGCAGCCGG - Intronic
1090563902 11:127965141-127965163 GAGAGCACCTGGAAGGCCTCCGG - Intergenic
1091351573 11:134901752-134901774 CAGAGCACGGAGCAGGCCAGCGG - Intergenic
1092000440 12:5027277-5027299 AAGAGGACAATGAAGGCCACTGG - Intergenic
1092860643 12:12716957-12716979 CAGAGGACCGCGAAGGTCGCCGG - Intronic
1094063576 12:26340572-26340594 GAAAGCACCGTGAAGGCTGCAGG + Intronic
1100461644 12:94805496-94805518 AAGAGCACCGTGAAGGGCTGAGG - Intergenic
1102002324 12:109565056-109565078 CTGAGTCCCGTGATGGCCACCGG + Intronic
1102748050 12:115267540-115267562 CAGAGAAACTGGAAGGCCACTGG - Intergenic
1104580198 12:130005986-130006008 CAGATAACCGTGAAGCCCAGGGG + Intergenic
1112280594 13:98059582-98059604 CTGAGCCCCATGAAAGCCACGGG + Intergenic
1112756621 13:102641996-102642018 CAGAGTAGCGGCAAGGCCACGGG + Intronic
1116380792 14:44265180-44265202 CAGAACACTGTGAGGGGCACAGG + Intergenic
1120546707 14:85820575-85820597 GAGAGCAGGGAGAAGGCCACTGG + Intergenic
1121901629 14:97698162-97698184 GAGAGCACTGTGAAGGTGACTGG - Intergenic
1122882330 14:104695670-104695692 CAGAGCCCTGTGGAAGCCACAGG - Intronic
1123031942 14:105456090-105456112 CAGGGCACCCTGGAGGCCACAGG - Intronic
1123125806 14:105945233-105945255 CTGAGCTCCGTGATGGCCAAGGG - Intergenic
1123406390 15:20021652-20021674 CTGAGCTCCGTGATGGCCAAGGG - Intergenic
1123515720 15:21028300-21028322 CTGAGCTCCGTGATGGCCAAGGG - Intergenic
1127370272 15:58332472-58332494 CAGAGCCCTGTGAAGGAGACAGG + Intronic
1127760828 15:62137623-62137645 CAGAGCCCCTTGAAGACAACAGG + Intergenic
1128552783 15:68609066-68609088 CAGTGCACCGTGCAGGCACCCGG - Intronic
1128738575 15:70067649-70067671 CAGAACACAGTGAAGGCCCATGG + Intronic
1128891370 15:71334775-71334797 CTGAGCACTATGAGGGCCACAGG - Intronic
1132336588 15:101051982-101052004 CAGAACACAGTGCAGGTCACAGG + Intronic
1134074783 16:11283014-11283036 CAGAGCATGGTGCAGGGCACTGG + Intronic
1134310276 16:13070238-13070260 CAGAGCAACATGAGGGGCACGGG - Intronic
1136714259 16:32264270-32264292 AAGAACCCAGTGAAGGCCACAGG - Intergenic
1138321088 16:56112615-56112637 CAGACCACATTTAAGGCCACTGG - Intergenic
1138457101 16:57127424-57127446 CACAGGACCTTGAATGCCACAGG + Intronic
1141835490 16:86536314-86536336 GAGAGCACAGGGAAGGCCAAGGG + Intronic
1142149414 16:88506090-88506112 CAGAGCACCCTGGAGGCCAGTGG - Intronic
1142244353 16:88962698-88962720 CCGAGCACCGTGAGGACCACAGG - Intronic
1203055794 16_KI270728v1_random:925499-925521 AAGAACCCAGTGAAGGCCACAGG + Intergenic
1146713719 17:35065631-35065653 AAGAGCAGCCTGAAGGCCAAAGG + Intronic
1146768753 17:35548770-35548792 CAGAGCACAGTGGATCCCACTGG + Exonic
1148048990 17:44759941-44759963 CAGAGCCCCAGGAAGCCCACGGG + Intronic
1152020481 17:77777693-77777715 CAGCAGACCGTGAAGGCCCCAGG + Intergenic
1152288326 17:79424930-79424952 CAGAGCACAGCAGAGGCCACAGG - Intronic
1152425306 17:80215224-80215246 CAGGGCCCCGAGAAGGCCCCTGG - Intronic
1153160523 18:2199865-2199887 GAGAGAACCATGAAGGCCACAGG + Intergenic
1160385870 18:78495852-78495874 CAGAGCTCAGAGAAGGACACAGG + Intergenic
1161026094 19:2038094-2038116 CAGAGCACCCCCACGGCCACCGG + Exonic
1161590102 19:5125642-5125664 CAGAGACCCGTGGAAGCCACAGG - Intronic
1163325654 19:16601518-16601540 AGGAGCACCTTCAAGGCCACAGG - Intronic
1165266073 19:34664587-34664609 CAGAGCACCATGCAGTGCACTGG - Intronic
1167499345 19:49836527-49836549 CAGAGCTCCGCAAAGGCCATGGG - Intronic
924981424 2:225551-225573 CACACCAGTGTGAAGGCCACTGG + Intronic
925288697 2:2732073-2732095 CACAGCAACGTGAAGGTGACCGG + Intergenic
925664736 2:6240640-6240662 CGGAGCACAGAGAAGGCAACGGG + Intergenic
925945355 2:8857352-8857374 CAGAGGACTGTGGTGGCCACAGG - Exonic
926188380 2:10709047-10709069 CAGTGCCCCGTGGAGGACACCGG - Intergenic
929886127 2:45880160-45880182 CAGAGCAACGTAAATGCAACTGG - Intronic
929905287 2:46040388-46040410 CAGAGCACCGTGAATACCTTAGG + Intronic
932399092 2:71467111-71467133 CAGAGCACAATAAATGCCACAGG + Intronic
936065471 2:109328876-109328898 CAGAGCATGGAGAAGGCAACTGG - Intronic
937443665 2:121938077-121938099 CTGAGCAGCATGGAGGCCACGGG + Intergenic
940497603 2:154453279-154453301 TAAAGGACCTTGAAGGCCACCGG - Exonic
942369951 2:175273023-175273045 CACAGCACCCTGAAGCCCAGTGG - Intergenic
946375524 2:219306702-219306724 AAGAGCACCATGGAGGCCAGGGG - Intronic
948234609 2:236379084-236379106 CAGAGCACCCAGAGGGGCACTGG - Intronic
948938418 2:241183487-241183509 CACAGCACCGTGTGGGACACAGG - Exonic
1169140089 20:3222893-3222915 CAGAGCAGTCTGCAGGCCACGGG + Intronic
1171113028 20:22501603-22501625 CAGAGCACCTTGAGGGCTGCTGG - Intergenic
1173498955 20:43538737-43538759 CAGAGCACAGGGAAGAGCACAGG - Intronic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1176114134 20:63423744-63423766 CAGAGCAGCGGGAAGGCCAGAGG + Intronic
1176360934 21:5995946-5995968 GAGGGCACCGTGAGGGCCACGGG + Intergenic
1177684498 21:24418794-24418816 AGGAGCACAGTGAAAGCCACTGG + Intergenic
1179762584 21:43542604-43542626 GAGGGCACCGTGAGGGCCACGGG - Intronic
1180103968 21:45605244-45605266 GAGGGCACCGCGAGGGCCACGGG + Intergenic
1180229901 21:46421021-46421043 GAGAGCAGCATGAAGGCCTCAGG - Intronic
1185122075 22:48977325-48977347 CAGAGCACCGGGCAGCCCCCAGG + Intergenic
949852669 3:8434563-8434585 CATAGTACAGTGATGGCCACTGG - Intergenic
949863683 3:8529559-8529581 CAGAGCACCGCGAGGGCAAAGGG + Intronic
950940174 3:16884347-16884369 CAGAGCCCCGTTAAGGCCCGCGG - Intronic
952338295 3:32423860-32423882 CAGAGGACAGTGACGGGCACAGG - Intronic
953069706 3:39506834-39506856 AAAAGCAGCATGAAGGCCACAGG - Intronic
953158838 3:40399590-40399612 CAGGCCACCCTGAAGGCCTCTGG + Intronic
953682599 3:45051120-45051142 AAGAGCATCATGAAGGCCACCGG - Intergenic
959112061 3:102133825-102133847 AAGAGCCCCCAGAAGGCCACTGG - Intronic
960289912 3:115871431-115871453 CAGAGGCCCTTGAAGGCCTCAGG + Intronic
960532886 3:118785214-118785236 CAAAGGCCAGTGAAGGCCACAGG - Intergenic
961449803 3:126997557-126997579 CAGGGCCCCGTGAAGGGGACTGG - Intronic
961471613 3:127116872-127116894 CAGTGCACCCAGAAGGCCAAGGG + Intergenic
965670250 3:171140525-171140547 CAGACAACCATGAAGGCAACAGG + Intronic
975681830 4:76885172-76885194 CAGCACATGGTGAAGGCCACTGG - Intergenic
976511158 4:85910936-85910958 CAGGGCACCATGAAAGCCAGTGG - Intronic
979010308 4:115358460-115358482 CAGAGCAAAGAGAGGGCCACAGG - Intergenic
980167123 4:129242436-129242458 CAGAGAACCATGGAGGCCAGAGG + Intergenic
985964908 5:3332471-3332493 CAGAGAACCTGGGAGGCCACGGG - Intergenic
988636608 5:32991028-32991050 CAGAGCAGCGTGTTTGCCACTGG + Intergenic
988697142 5:33633636-33633658 CAGAGCACCATGAAAGACAAAGG - Intronic
996110718 5:119563429-119563451 CAGAGCTGCCTGTAGGCCACAGG + Intronic
997471548 5:134120107-134120129 AGGAGCACTCTGAAGGCCACAGG + Intronic
1001057460 5:168461510-168461532 CAGACCAGCGGGAAGCCCACAGG + Intronic
1004453686 6:15771173-15771195 CAGACCACCTTGGAGGCCCCTGG - Intergenic
1005050828 6:21682526-21682548 CAAAGCAAGGTGAAAGCCACAGG - Intergenic
1007355685 6:41314132-41314154 CAGAGAATAGTGAAGGCAACTGG + Intergenic
1007709605 6:43813895-43813917 CAGAGGACCGTGAAGATTACCGG - Intergenic
1008559526 6:52710130-52710152 CAGAGCACCCTGAGGGCTGCTGG - Intergenic
1018957052 6:168417194-168417216 CAGGGAACTGTGGAGGCCACTGG + Intergenic
1019341920 7:512469-512491 GAGAACACCGTGAATGCCCCAGG + Intronic
1021843643 7:24743596-24743618 CACAGGACCTTGAAGGCCACTGG - Intronic
1022442944 7:30448619-30448641 CACACGACCGTGAAGGACACAGG + Intronic
1026288260 7:68983141-68983163 AAGAGCAGCTTGAAGGCCAAAGG - Intergenic
1031771863 7:125853909-125853931 GTGAGCACTGTCAAGGCCACTGG - Intergenic
1036120013 8:6006165-6006187 TAAATCACGGTGAAGGCCACGGG + Intergenic
1036646140 8:10612290-10612312 CAGGGCACCGAGCAGGCCACGGG - Exonic
1043643036 8:82481432-82481454 CAGAGCACGATGAGGGCCCCAGG + Intergenic
1044599112 8:93985946-93985968 CAGACCACAGTGACAGCCACAGG - Intergenic
1045024692 8:98075642-98075664 CTGTGCACCCTGAAAGCCACTGG - Intronic
1045640172 8:104241074-104241096 CAGAGCACAGTGAAGGAGTCAGG - Intronic
1049310781 8:141932746-141932768 CAGAGCACCTTGCTGGGCACAGG - Intergenic
1049364379 8:142229713-142229735 CAGAGCCCCTTGAAAGACACAGG - Intronic
1049389740 8:142361539-142361561 GTGGGCACCGTGGAGGCCACAGG - Intronic
1049683286 8:143929329-143929351 CAGCGCCCCTTGAAGGCCAAAGG + Intronic
1050074268 9:1847305-1847327 CAGGGCACCTTGAGGGTCACAGG + Intergenic
1050094330 9:2047622-2047644 CTCAGCACCGGGAAGGCCCCAGG - Intronic
1053346034 9:37378824-37378846 CAGGGCAGAGTGAAGGCCTCGGG - Intergenic
1054757833 9:68976944-68976966 AAAAGCACCATGAAGGCAACAGG - Intronic
1054928797 9:70615309-70615331 CTGAGCAGCGTGACTGCCACTGG - Intronic
1056116778 9:83448447-83448469 CAGAGCAGCGGTAAGGCCTCAGG + Intronic
1058679770 9:107430746-107430768 CAGAGGAGTGAGAAGGCCACAGG + Intergenic
1062322428 9:135996946-135996968 GAGAGGACCGTGAAGGGCAAGGG - Intergenic
1188855131 X:35185422-35185444 CAGAGAACAGCGAAGACCACAGG - Intergenic
1193739778 X:85203434-85203456 CAAAGCACTTTGAAGGCCAAAGG + Intergenic
1199863756 X:151824792-151824814 CAGACCAACTTGAAGGTCACTGG + Intergenic
1199990876 X:152987303-152987325 CAGAGCACAGTGGGGGCCCCAGG + Intergenic
1200771037 Y:7125641-7125663 CAGAGCACAGTGCAGACCCCAGG - Intergenic
1200829803 Y:7679181-7679203 CTGGGCTCCGTGAATGCCACAGG + Intergenic
1202338424 Y:23834353-23834375 CAGAGCACACTGAAGCCCCCTGG + Intergenic
1202532342 Y:25835719-25835741 CAGAGCACACTGAAGCCCCCTGG - Intergenic