ID: 922758391

View in Genome Browser
Species Human (GRCh38)
Location 1:228109332-228109354
Sequence ACTCTTGCCTCTCCCTGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 504
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 450}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922758391_922758398 17 Left 922758391 1:228109332-228109354 CCATGGCAGGGAGAGGCAAGAGT 0: 1
1: 0
2: 4
3: 49
4: 450
Right 922758398 1:228109372-228109394 GATATACGCCCCTGTTGGGCGGG 0: 1
1: 0
2: 0
3: 2
4: 21
922758391_922758399 18 Left 922758391 1:228109332-228109354 CCATGGCAGGGAGAGGCAAGAGT 0: 1
1: 0
2: 4
3: 49
4: 450
Right 922758399 1:228109373-228109395 ATATACGCCCCTGTTGGGCGGGG 0: 1
1: 0
2: 0
3: 2
4: 16
922758391_922758396 13 Left 922758391 1:228109332-228109354 CCATGGCAGGGAGAGGCAAGAGT 0: 1
1: 0
2: 4
3: 49
4: 450
Right 922758396 1:228109368-228109390 CGAAGATATACGCCCCTGTTGGG 0: 1
1: 0
2: 0
3: 1
4: 12
922758391_922758395 12 Left 922758391 1:228109332-228109354 CCATGGCAGGGAGAGGCAAGAGT 0: 1
1: 0
2: 4
3: 49
4: 450
Right 922758395 1:228109367-228109389 ACGAAGATATACGCCCCTGTTGG 0: 1
1: 0
2: 0
3: 0
4: 22
922758391_922758404 27 Left 922758391 1:228109332-228109354 CCATGGCAGGGAGAGGCAAGAGT 0: 1
1: 0
2: 4
3: 49
4: 450
Right 922758404 1:228109382-228109404 CCTGTTGGGCGGGGCCGGCGCGG 0: 1
1: 0
2: 2
3: 27
4: 289
922758391_922758400 22 Left 922758391 1:228109332-228109354 CCATGGCAGGGAGAGGCAAGAGT 0: 1
1: 0
2: 4
3: 49
4: 450
Right 922758400 1:228109377-228109399 ACGCCCCTGTTGGGCGGGGCCGG 0: 1
1: 0
2: 0
3: 9
4: 125
922758391_922758397 16 Left 922758391 1:228109332-228109354 CCATGGCAGGGAGAGGCAAGAGT 0: 1
1: 0
2: 4
3: 49
4: 450
Right 922758397 1:228109371-228109393 AGATATACGCCCCTGTTGGGCGG 0: 1
1: 0
2: 0
3: 1
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922758391 Original CRISPR ACTCTTGCCTCTCCCTGCCA TGG (reversed) Intergenic
900636693 1:3669484-3669506 GCTCTTTCCACTTCCTGCCAAGG + Intronic
900648669 1:3720493-3720515 ACGCTGGTCTGTCCCTGCCATGG - Intronic
901572112 1:10169392-10169414 ACTATTGCCACTCCCTGGCCTGG + Intronic
901647550 1:10724746-10724768 CGCCTTGCCTCTCCCTCCCAGGG - Intronic
901676764 1:10889859-10889881 ACTCATCCCTCTCACTGCCTGGG + Intergenic
902230220 1:15022967-15022989 ACCCTTTCCTTTACCTGCCAGGG + Intronic
902381728 1:16055931-16055953 CCTGTTGCCCCTCACTGCCAGGG + Intronic
902384768 1:16070137-16070159 AGTCCTGCCTCTCCATGCCCTGG + Intronic
902716559 1:18276798-18276820 ACCCTTCCCGCTGCCTGCCAGGG + Intronic
902745211 1:18469309-18469331 CCTCCTCTCTCTCCCTGCCATGG - Intergenic
902863258 1:19260783-19260805 AATCATGCCCCTCCCAGCCATGG + Intergenic
903766167 1:25736025-25736047 ACTCTGGCCTCTACTTGCCTGGG - Intronic
904103955 1:28060903-28060925 TCTCTTGCCTCAGCCTCCCAAGG - Intronic
904329286 1:29747438-29747460 ATCCTTGCCTCTCCCTGCCCAGG + Intergenic
904359544 1:29962962-29962984 CCTCTTGCCACTCCCTGGAAGGG + Intergenic
904359563 1:29963024-29963046 CCTCTTGCCACTCCCTGGAAGGG + Intergenic
905253748 1:36666532-36666554 ACTCCTGCCTCCCCCTGGCCTGG + Intergenic
905651726 1:39661263-39661285 ATGCTTGCCTCTCTCTGCCTAGG - Exonic
906406946 1:45549654-45549676 TGTCTTGCCCATCCCTGCCAAGG + Intergenic
906543654 1:46606747-46606769 GCTCTTCCCTCTTCCTGCAAAGG - Intronic
906958666 1:50399449-50399471 TCTCTTGCCTCAGCCTCCCAAGG + Intergenic
908168255 1:61480032-61480054 TCTCTTGCCTCAGCCTCCCAAGG - Intergenic
909183221 1:72450560-72450582 ACTATTGCCTCAGCCTCCCAAGG - Intergenic
910676186 1:89819462-89819484 CCTCTTGCCTCGGCCTCCCAAGG + Intronic
912099716 1:106190461-106190483 ACTCTTCCCTCTGCTTTCCAAGG - Intergenic
912206361 1:107513487-107513509 ACTCCTGCCTCAGCCTCCCAAGG - Intergenic
913485527 1:119329603-119329625 ACCTTGGCCTATCCCTGCCAGGG - Intergenic
914861973 1:151394059-151394081 TCTCCTGCCTCTGCCTGCCCAGG - Intergenic
914912175 1:151796447-151796469 TCTCTTGCCTCTCCCTCAGATGG + Intergenic
915437356 1:155918345-155918367 TCTCTTGCCTCAGCCTGCCGAGG + Intronic
915637406 1:157196136-157196158 ACACCTGCCTCTTCCTGCCTAGG - Intergenic
916430801 1:164726277-164726299 ACTATGGTCTTTCCCTGCCATGG + Intronic
916433495 1:164755257-164755279 TCTCCTGCCTCTGCCTCCCAAGG + Intronic
920133921 1:203754336-203754358 TCTCTTGCCTCAGCCTCCCAAGG - Intergenic
920349535 1:205328703-205328725 GCTCCTGCCTTTCCTTGCCAAGG - Intergenic
920679354 1:208060607-208060629 ACTCTCCCCTCTCCCTTCCTGGG - Intronic
921157905 1:212452555-212452577 TCTCAGACCTCTCCCTGCCAAGG + Intergenic
922227163 1:223655473-223655495 CCTCTTTCCCCTGCCTGCCATGG - Intronic
922230654 1:223682680-223682702 ACTCTGGTCTCTCCCTGCTTAGG + Intergenic
922758391 1:228109332-228109354 ACTCTTGCCTCTCCCTGCCATGG - Intergenic
923053002 1:230401890-230401912 AGCCTTGCCTCTCCTTGCCTGGG - Intronic
1063810625 10:9701428-9701450 AATCTGCCCTCTGCCTGCCAGGG + Intergenic
1064003229 10:11680800-11680822 ACACATGCCTCTCAATGCCAGGG + Intergenic
1064246987 10:13676368-13676390 TCTCCTGCCTCAGCCTGCCAAGG + Intronic
1064284487 10:13980641-13980663 ACTGTAGCCTCTCACTCCCAGGG - Intronic
1064425844 10:15228588-15228610 CCTCCTGCCTCTTCCTCCCAAGG + Intronic
1064506289 10:16033899-16033921 ACTCCTACTTCTCCCAGCCAAGG + Intergenic
1065331331 10:24603584-24603606 TCTCTTGCCTCTCACTTCCTCGG - Intronic
1066407648 10:35134323-35134345 TCTCCTGCCTCACCCTCCCAAGG + Intronic
1066456107 10:35573636-35573658 CCTCCTGCCTCACCCTCCCAGGG + Intergenic
1066624827 10:37395857-37395879 ACTCTAGGCTCCCCCTGGCATGG + Intergenic
1067093881 10:43285929-43285951 GCTCTGGCCTGTCCCTGCCATGG - Intergenic
1069124971 10:64619066-64619088 GTTCTTCTCTCTCCCTGCCAGGG + Intergenic
1069182397 10:65377945-65377967 ACTGTTGCCTCTCCCTGAGCTGG - Intergenic
1069536455 10:69257217-69257239 ACTCTGGCCTCTGTCTGCCTTGG + Intronic
1069565213 10:69459542-69459564 ACTCATGGCTCTCTCTGCCTGGG - Intronic
1069567822 10:69475161-69475183 GCTCTTGACTCTCCTTCCCATGG + Intronic
1069888499 10:71638656-71638678 ACCCTTGACCCTCCCTCCCAAGG + Intronic
1070028295 10:72652627-72652649 TCTCTTGCCTCAGCCTCCCAAGG - Intergenic
1070168676 10:73916296-73916318 ACTCTTCCCTCTCTCTGGTATGG + Intronic
1071847457 10:89535467-89535489 CCTCTTCCCTCTCCCTGACACGG - Exonic
1072083420 10:92055794-92055816 CCTCCTGCCTCACCCTTCCAAGG - Intronic
1072952826 10:99862917-99862939 TCTCCTGCCTCACCCTCCCAGGG + Intergenic
1072974376 10:100044817-100044839 TCTCTTGCCTCAGCCTCCCAAGG + Intronic
1073485980 10:103819500-103819522 CCTCCTGCCTCTCACTGCCTTGG - Intronic
1073934309 10:108612440-108612462 TCTCCTGCCTCACCCTCCCAAGG - Intergenic
1074119828 10:110485746-110485768 ATTCCTGCCACTTCCTGCCAGGG - Intergenic
1074325462 10:112446838-112446860 ACTCCAGCCTCTCGCTGCCAGGG - Exonic
1074376274 10:112943445-112943467 TCTCTTGCCTCAGCCTCCCAGGG + Intergenic
1074559127 10:114519482-114519504 ACACTTGCCTCTCCCAGCCGAGG - Intronic
1074767163 10:116707825-116707847 GCTCCTCCCTCCCCCTGCCAGGG + Intronic
1074774379 10:116756210-116756232 ACTGATGCCTCTCACTTCCAGGG + Intergenic
1075995428 10:126872983-126873005 ACTCATGCCTCCCCCTGGCTGGG - Intergenic
1076711601 10:132338816-132338838 CCTCTTGCCTCAGCCTCCCAAGG + Intronic
1077073139 11:686915-686937 ACTGCTGGCTCTTCCTGCCATGG + Exonic
1077528002 11:3079535-3079557 CCTCTTGCCTCGGCCTCCCAAGG - Intergenic
1078296183 11:10072806-10072828 ACTGCTGCCTCGCCCTCCCAGGG + Intronic
1079362342 11:19779317-19779339 AGTCATGCCTCTTCCTGCCTGGG - Intronic
1079455231 11:20630670-20630692 ACTCTGGTCTCTTCCTTCCAGGG + Exonic
1080315446 11:30942498-30942520 TCTTTTGCCTTTCCCTGCCATGG - Intronic
1080875936 11:36274343-36274365 AATGTTCCCTCACCCTGCCATGG + Exonic
1083273695 11:61585193-61585215 CCTCTGGCCTCTACCTGGCATGG + Intergenic
1084596599 11:70120406-70120428 GCTGCTGCCTCCCCCTGCCAGGG + Intronic
1084617814 11:70248007-70248029 ACTCATTTCTCTCCCTGCCCAGG - Intergenic
1085912865 11:80849248-80849270 CCTCCTGCCTCTGCCTCCCACGG - Intergenic
1087357563 11:97114023-97114045 TTTCTGACCTCTCCCTGCCAAGG + Intergenic
1088270689 11:108031286-108031308 ACTATAGCCTCTACCTCCCAGGG - Intronic
1088788602 11:113204531-113204553 TCTCTGGCCTCTCCTTGCCAAGG + Intronic
1088819902 11:113448171-113448193 ACTCCTGCATCTTCCTGCCTCGG - Intronic
1089559600 11:119337176-119337198 AGTCTGCCCTCTCCATGCCAGGG - Exonic
1089938873 11:122394617-122394639 CCTTTTGCCCCTCCCTGCAATGG - Intergenic
1090334684 11:125954557-125954579 ACTCTTTCCTGTCCCTCCCTGGG + Intergenic
1091211599 11:133865277-133865299 AGTCTTGGCCTTCCCTGCCAGGG + Intergenic
1092217492 12:6693531-6693553 TCTCTTGACCCTCCCTGGCAAGG + Intergenic
1093179955 12:15955189-15955211 ACTCATGCCTCAGCCTCCCAAGG - Intronic
1093993303 12:25614281-25614303 ACTCTTGCCTCCACCAGCCCTGG + Intronic
1094655842 12:32418944-32418966 ACTCTTCCCTCCCCTTTCCACGG + Intronic
1095764270 12:45876981-45877003 TCTCCTGCCTCACCCTCCCAAGG - Intronic
1096239522 12:49952227-49952249 TCTCTTGCCTCAGCCTCCCATGG + Intronic
1096379707 12:51145841-51145863 CCTCCTGCCTCTGCCTGTCAAGG - Intronic
1096759149 12:53825472-53825494 ACTCTTGCATGACCCTGCCCTGG + Intergenic
1097053711 12:56238152-56238174 ATTCCTGCCTCTCCCTGCCCCGG - Exonic
1097891692 12:64783116-64783138 ATTGTCTCCTCTCCCTGCCAGGG + Intronic
1098731494 12:74040944-74040966 ACTTTTACCTCTCCCAGCCATGG + Intergenic
1100458135 12:94772478-94772500 ACCCTGCCCTCTCCCTGCCCAGG - Intergenic
1101154952 12:101918519-101918541 ACTCTTCACTCTCCTTGTCATGG - Intronic
1101161897 12:101986109-101986131 GCTGTTGCCTCTGCCTCCCAGGG - Intronic
1101661988 12:106774418-106774440 TCTCCTGCCTCTCCCTCCCTCGG - Intronic
1101750543 12:107579727-107579749 TCTCTTGCCTCCCCCGGCCCTGG - Intronic
1102773875 12:115502174-115502196 CCTCATGCCTCTCACTTCCATGG + Intergenic
1103005922 12:117420143-117420165 CCTCTTGCCTCGGCCTCCCAAGG + Intronic
1103848523 12:123916115-123916137 CCTCTTCCCTCAGCCTGCCAGGG + Intronic
1103932629 12:124458637-124458659 ACTCCTGCCTGTACCTCCCATGG - Intronic
1104000487 12:124856914-124856936 ACCCTGGCCTCTCCCTTCCGGGG - Intronic
1104336162 12:127897934-127897956 ACTATTGCTTCTGCCTGCCCTGG + Intergenic
1104667259 12:130656315-130656337 ATTCTAGCCCCTGCCTGCCAGGG - Intronic
1105253934 13:18727086-18727108 AGTCTTGGCCTTCCCTGCCAGGG - Intergenic
1106923130 13:34586247-34586269 ACTCTGGACTCTTGCTGCCAAGG + Intergenic
1107112696 13:36715082-36715104 TCTCTTGCCTCTGCATGCCATGG - Intergenic
1107620095 13:42218615-42218637 TCTCTTGCCTCAGCCTCCCAAGG + Intronic
1108039915 13:46330581-46330603 AGTCATGCCTCTCTCTGCCATGG + Intergenic
1108395873 13:49990867-49990889 TCTCCTGCCTCAGCCTGCCAAGG - Intergenic
1108681603 13:52785380-52785402 ACTGATGCCTCTCCCTGCCATGG + Intergenic
1109347418 13:61131684-61131706 ACTGTAGCCTCTACCTCCCAAGG + Intergenic
1110549313 13:76794157-76794179 ACTCTTCCTTCTCACTGCCAAGG + Intergenic
1110789293 13:79569610-79569632 ACTCTGGCCTCTCTATGCAAAGG + Intergenic
1112409275 13:99148305-99148327 CCTCTTGCCTCAGCCTCCCAAGG + Intergenic
1113592593 13:111511796-111511818 AGGCTTGCCTCTCCCCGTCAGGG - Intergenic
1113917979 13:113885659-113885681 TCTCCTGCCTCACCCTCCCAAGG - Intergenic
1114293905 14:21312343-21312365 ACCCACGCCCCTCCCTGCCATGG + Intronic
1114341506 14:21750250-21750272 GCTCTCTCCTCTCTCTGCCATGG + Intergenic
1114974593 14:28078724-28078746 ACTCTGGCCTCTTCCTAACACGG + Intergenic
1115637560 14:35305249-35305271 CCTCTTGCCTCAGCCTCCCAAGG + Intronic
1117699677 14:58400294-58400316 TCTCTTGCCTCAGCCTCCCAGGG - Intronic
1117777292 14:59196010-59196032 AGTCTTGCCTCTCACTTACAGGG - Intronic
1117974727 14:61286431-61286453 ATTCTCTCCACTCCCTGCCACGG + Intronic
1118777465 14:68981925-68981947 TCTCTTGCCCCTCCCGGCCTTGG - Intergenic
1119312092 14:73656667-73656689 CCTCTTGCCTCAGCCTCCCATGG + Intronic
1119776262 14:77250693-77250715 TTTCTTTTCTCTCCCTGCCATGG + Intronic
1119797507 14:77412423-77412445 TCTCTTGCATCTCCCTAGCAGGG - Intronic
1121451242 14:94009483-94009505 CCTCCTGCCTCTGCCTCCCAAGG - Intergenic
1122502728 14:102212090-102212112 CCTCTTGCCTCTCCCACCCCTGG - Intronic
1122681495 14:103467564-103467586 TCTCTTGCCTCAGCCTCCCAAGG - Intronic
1122900225 14:104779355-104779377 GCTCGTGCCTCTCCCTGCACAGG - Intronic
1123050326 14:105538250-105538272 TCCCTTGCCTCTGCCTGCCCCGG + Intergenic
1202936651 14_KI270725v1_random:94038-94060 CTTTTTGCCCCTCCCTGCCACGG - Intergenic
1124200818 15:27677334-27677356 ACTCCTACCTCCCCCTGCCCTGG + Intergenic
1124350542 15:28952421-28952443 CCTCTTGCCTCTGCCTCCCACGG - Intronic
1124366737 15:29077332-29077354 ACCCTGGCTTCTGCCTGCCAAGG - Intronic
1124883785 15:33665313-33665335 ATTTTTGCATCTCCCTCCCAGGG + Intronic
1125737102 15:41934421-41934443 TCTCTTGCCTCGGCCTCCCAAGG + Intronic
1125841988 15:42811235-42811257 CCTCTTGCCTCAGCCTCCCAAGG + Intronic
1126601262 15:50430236-50430258 TCTCTTGCCTCAGCCTCCCAAGG - Intronic
1127587213 15:60389884-60389906 TATCTTGCCTTTCACTGCCAGGG + Intronic
1127961331 15:63893105-63893127 CCTCTTGCTTCTGCATGCCATGG - Intergenic
1128728450 15:70004986-70005008 ACTCTTCTTTCTCCCTGCCCTGG + Intergenic
1129061910 15:72867153-72867175 CCTCTGGCTTCTCCCAGCCATGG + Intergenic
1129564719 15:76609241-76609263 CCTCTTGCCTCAGCCTCCCAAGG - Intronic
1130353390 15:83109822-83109844 ACTCCTGCTGCTCCCTGACAGGG + Intronic
1130671897 15:85920177-85920199 TCTCCTGCCTCTGCCTCCCAAGG - Intergenic
1130942519 15:88523419-88523441 ACTCTTGTCTCCCCTTTCCACGG + Intronic
1131234923 15:90687809-90687831 ACTGTAGCCTCTACCTCCCAGGG + Intergenic
1132303089 15:100788432-100788454 ACTTTTGCCACACCATGCCAGGG - Intergenic
1132413074 15:101600166-101600188 ACTCCTGCCCCTCCCAGCCAGGG - Intergenic
1132653595 16:1032317-1032339 GCTCTGGCCTCTTCCTGGCAAGG - Intergenic
1132945816 16:2530975-2530997 TCACCTGCCTCTCCCTGCCTGGG - Exonic
1133171906 16:3986993-3987015 ACTCCTGCCCCACCCTGCCCCGG + Intronic
1133701843 16:8316343-8316365 TCTCCTGCCTCTGCCTCCCAAGG + Intergenic
1134047841 16:11114426-11114448 GCACTGGCCTCTCCTTGCCATGG + Intronic
1134583157 16:15388785-15388807 ACTCCTGCCTCAGCCTCCCAAGG - Intergenic
1134857804 16:17535354-17535376 ACTCTTCCCTCTCTCTGCTCTGG + Intergenic
1135045138 16:19149203-19149225 TCTCTTGCCTCAGCCTCCCAAGG - Intronic
1135314655 16:21434329-21434351 CCTCCTGCCTCACCCTCCCAAGG - Intronic
1135367578 16:21866609-21866631 CCTCCTGCCTCACCCTCCCAAGG - Intronic
1135444236 16:22504553-22504575 CCTCCTGCCTCACCCTCCCAAGG + Intronic
1135749262 16:25043785-25043807 CCTCTTGCCTCGGCCTCCCAAGG + Intergenic
1136193126 16:28630592-28630614 ACTCCTGCCTCACCCTCCCAAGG + Intergenic
1136311320 16:29413011-29413033 CCTCCTGCCTCACCCTCCCAAGG - Intergenic
1136324768 16:29514804-29514826 CCTCCTGCCTCACCCTCCCAAGG - Intergenic
1136419218 16:30122080-30122102 GCTCTCTCCCCTCCCTGCCAAGG - Intronic
1136439453 16:30254789-30254811 CCTCCTGCCTCACCCTCCCAAGG - Intergenic
1137557252 16:49478446-49478468 ACTCCTACCCCTCCCAGCCAGGG + Intergenic
1137667151 16:50257986-50258008 ACGCTTGCCTCGGCCTCCCAAGG + Intronic
1138618053 16:58187811-58187833 ATTCCTGCCCCTCTCTGCCATGG - Intronic
1138646393 16:58428459-58428481 TCTCTTGCCTCTCTCTTACAAGG - Intergenic
1138774649 16:59706649-59706671 ACTGTTGCCTCTCCTGGCAAAGG + Intergenic
1138867915 16:60846393-60846415 ACTCTTGCCTCAACCTTCGAAGG + Intergenic
1139123032 16:64043329-64043351 ACTCTTTCCTCTCCTTTCCATGG - Intergenic
1139129619 16:64125761-64125783 TCTCTTGCCTCAGCCTCCCAAGG + Intergenic
1139858840 16:70003937-70003959 CCTCCTGCCTCACCCTCCCAAGG - Intergenic
1139885959 16:70207089-70207111 CCTCCTGCCTCACCCTCCCAAGG - Intergenic
1140826087 16:78708080-78708102 ATTCCTGCCTCTGCCTCCCAAGG - Intronic
1141076800 16:81013610-81013632 ACTCCTGCCTCAGCCTCCCAAGG - Intronic
1141179326 16:81741700-81741722 TCTCTTGCCTCAGCCTCCCAAGG - Intronic
1141452648 16:84116241-84116263 AATCTTGCCTCGCCTTGGCATGG - Intronic
1141617845 16:85220341-85220363 TCGCTTGCCTCTCCCAGCCAAGG - Intergenic
1142308951 16:89300962-89300984 AGTCTCGCTTCTCCCTGCCTAGG - Intronic
1142357059 16:89606207-89606229 ACTCTGGCCTGCCCCTGCCTTGG - Intergenic
1142514220 17:416432-416454 ACCCCTGCCTCTCACCGCCATGG - Intronic
1142862672 17:2772536-2772558 TCTCCTGCCTCTGCCTCCCAAGG + Intergenic
1142896556 17:2982968-2982990 CCTGGTGCCTCTCCCTGGCAGGG + Intronic
1142990093 17:3724446-3724468 TCTCTGGCCTCGCCCTGCCCCGG + Exonic
1143024082 17:3930621-3930643 GCCCTTGCTTCTCCCTGGCACGG - Intronic
1143129259 17:4665868-4665890 CCTCTTGCCTCAGCCTCCCAAGG + Intergenic
1143758589 17:9084758-9084780 TCTCCTGCCTCACCCTCCCAAGG + Intronic
1145023120 17:19447434-19447456 ACTCTTCTACCTCCCTGCCAAGG + Intergenic
1145225415 17:21124155-21124177 ACTGTCCCCTCTCCCTGGCATGG - Intronic
1146005643 17:29158960-29158982 GCCCTTGCCTCTTCCTGTCATGG - Intronic
1147197450 17:38777003-38777025 CCTCCTGCCTCACCCTTCCAAGG + Intronic
1148767407 17:50047250-50047272 ACTCTTGCCCCTTCCTGCCTGGG + Intergenic
1149145435 17:53486249-53486271 AGTCTTCCCTGTCCCTGTCAGGG + Intergenic
1149487529 17:57054579-57054601 CTTCTTGCCTCTCCCTGCAAGGG - Intergenic
1149932928 17:60773722-60773744 ACAGTTGCCTCTGCCTCCCAGGG + Intronic
1149956891 17:61061184-61061206 GCTTTTGTCTCTCCATGCCAGGG + Intronic
1150304633 17:64073885-64073907 CCTCCTGCCTCACCCTCCCAAGG + Intronic
1150313663 17:64150347-64150369 AATCTGGCCTCTCCCTCCCCTGG - Intronic
1150758071 17:67933933-67933955 TCTCTTGCCTCAGCCTCCCAAGG - Intronic
1152007225 17:77690294-77690316 AATCTTGCCTCTTCCTTCCAGGG - Intergenic
1152231727 17:79117291-79117313 ACTCCTGCCTGTCCCTGCCAGGG - Intronic
1153511186 18:5854780-5854802 TCTCTTGCCTCAGCCTCCCAAGG + Intergenic
1153948578 18:10038090-10038112 AATCTGGCTTCTCCCTGCCAAGG + Intergenic
1154388059 18:13913334-13913356 ACTCGGACCTTTCCCTGCCACGG + Intronic
1154473091 18:14723722-14723744 CCTCCTGCCTCACCCTCCCATGG + Intergenic
1155068166 18:22286743-22286765 TCTCTTTCCTCTCTCTGCCAAGG + Intergenic
1155163116 18:23211502-23211524 CCTCTTGCCCCTCCCTGCACTGG + Intronic
1157076592 18:44473857-44473879 AGTGTTGCCTTTCCCAGCCAAGG - Intergenic
1157201908 18:45666908-45666930 ACTCTTGCCTATCTCTGTCCTGG + Intronic
1157273680 18:46295058-46295080 ACTCTTGCCTCCCTGCGCCAGGG + Intergenic
1160112714 18:76048657-76048679 ACACATGACTCTGCCTGCCAGGG - Intergenic
1160569322 18:79806077-79806099 AGTCTGTCCTCTCCCTGCCAGGG + Intergenic
1160762900 19:794749-794771 TCTCTTGCCTCAGCCTCCCAAGG + Intergenic
1161142315 19:2654941-2654963 CCTCCTGCCTCTGCCTCCCAGGG - Intronic
1161279639 19:3438824-3438846 ACTCTTGTCCCTACCTTCCAGGG + Intronic
1161656701 19:5520483-5520505 CCTCTTGCCTCAGCCTCCCAAGG - Intergenic
1162110701 19:8398128-8398150 ACTGTTTCCTGTCCCAGCCATGG - Intronic
1162314247 19:9927951-9927973 CCTCTTGCCTCAGCCTCCCAAGG - Intronic
1162831694 19:13288630-13288652 ACCCCTGCCTCTCCAAGCCATGG + Intronic
1164567597 19:29338984-29339006 ACACTAGCACCTCCCTGCCATGG - Intergenic
1164629755 19:29754365-29754387 TGTCTTGACTCTCCCTGCCCCGG - Intergenic
1164837434 19:31366257-31366279 AATCTTCCCTCTCCCTGTCCTGG - Intergenic
1164882113 19:31741278-31741300 GGGCCTGCCTCTCCCTGCCAAGG + Intergenic
1165735021 19:38170340-38170362 ACACGTGCCTCTGCCTCCCATGG + Intronic
1166293582 19:41878316-41878338 TCCCTGGCCTCTCCCTGCCTGGG - Intronic
1167160596 19:47765057-47765079 CCTCTTGCCTCAGCCTCCCAAGG + Intergenic
1167265474 19:48480882-48480904 CTTCCTGCCTCTGCCTGCCACGG - Intronic
1167788737 19:51657690-51657712 ACTCTTCCTTCTCCCTACCAGGG - Intergenic
1167953707 19:53047639-53047661 TCTCATGCCTCTCCCTGCAAGGG - Intronic
1168242038 19:55093232-55093254 ACTGTCCCCTTTCCCTGCCAGGG - Exonic
1168702896 19:58452068-58452090 CGTCTTTCCTCTCCCTGCCCTGG + Intronic
1168705387 19:58467590-58467612 CGTCTTTCCTCTCCCTGCCCTGG + Exonic
925766001 2:7235885-7235907 ACTCTTGCCTCTCAGTTCCTTGG - Intergenic
927089726 2:19701091-19701113 ACTCTTCCCCCTCCTTGCAAAGG - Intergenic
927462963 2:23315119-23315141 ACTATCGACTCTCCCTCCCATGG - Intergenic
927614697 2:24581091-24581113 ATTCCTGCCCCTCCCAGCCAGGG - Intronic
928138925 2:28710782-28710804 ACTCTTATCTCTGACTGCCATGG - Intergenic
928300910 2:30122724-30122746 ACTCCTGTCTCTTCCAGCCAGGG + Intergenic
928439267 2:31278184-31278206 ACTCTTCCCGCTGCCTGCAATGG + Intergenic
929248766 2:39730375-39730397 CCCCTTGCCTCTCCCTGGCAGGG + Intergenic
929827910 2:45324103-45324125 TCTCTTGCCTCTCTCTTCTAAGG + Intergenic
929886815 2:45886110-45886132 ACTCTTACCTGTCCGGGCCATGG + Intronic
930022084 2:47007678-47007700 CCTCTTCCCCCTCCCTGCCAGGG - Intronic
931424815 2:62161262-62161284 CCTCTTGCCTCACCCTCCCGAGG + Intergenic
931637323 2:64352201-64352223 ACTCTTCCCTCCCCTTTCCAAGG - Intergenic
932494578 2:72140075-72140097 AGCCTTCCCACTCCCTGCCAAGG + Intronic
932570090 2:72934029-72934051 ACTCTGGCCACTCCCTGGCCAGG + Exonic
933981942 2:87557478-87557500 ACCCCTGCCTCTCCCAGCCATGG - Intergenic
934488218 2:94737713-94737735 AGTCTTGGCCTTCCCTGCCAGGG - Intergenic
935884343 2:107599363-107599385 TCTCCTGCCTCTGCCTCCCAAGG + Intergenic
936002652 2:108849741-108849763 AGTCTGGCCTCTCCCAGCCTAGG + Intronic
936058822 2:109281302-109281324 CCTCTTGCCTCTTCCTTCCCCGG + Intronic
936311896 2:111393339-111393361 ACCCCTGCCTCTCCCAGCCATGG + Intergenic
936514094 2:113170909-113170931 TCTCTTGCCTCTGCCTCCCAAGG - Intronic
936949569 2:117964705-117964727 CCTCCTGCCTCTGCCTCCCAAGG + Intronic
937672305 2:124551095-124551117 ACACATGCCTCTCCCTGCACGGG - Intronic
938789078 2:134660691-134660713 TCTCTTGCTTCTCTCTGCCATGG - Intronic
939994354 2:148906350-148906372 ACTGTGGCATCTCCCTCCCATGG - Intronic
941207196 2:162588897-162588919 CCTCTTTCCTCTCCCTCCAATGG + Intronic
941591732 2:167428567-167428589 TCTCTTGCCTCAGCCTCCCAAGG - Intergenic
942160820 2:173184804-173184826 TCTCTTGCCTCAGCCTCCCAAGG - Intronic
943364929 2:186959739-186959761 CCTCTTGCCTCAGCCTCCCAAGG + Intergenic
944081475 2:195793178-195793200 CCTCTTGCCTCAGCCTCCCAAGG + Intronic
944738157 2:202586990-202587012 TCTCTTGCCTCAGCCTCCCAGGG + Intergenic
945731468 2:213541509-213541531 CCTCTTGCCTCAGCCTCCCAAGG - Intronic
946183944 2:217966234-217966256 AGCCTTGCCCCTCCCTGCTATGG + Intronic
946407440 2:219499063-219499085 ACCCTGGCCTCTCATTGCCAGGG - Exonic
946754542 2:222931124-222931146 ACCCTTGCCTTGCCCTGCCCAGG + Intronic
947291247 2:228577181-228577203 AATCTTTTCTCTCCCTACCACGG + Intergenic
947637923 2:231689400-231689422 ACCCATCCCTCTCCCTTCCATGG + Intergenic
948030858 2:234816261-234816283 GTTCTTGCCTCTCCCTGCCTCGG - Intergenic
948631045 2:239302953-239302975 CACCTTTCCTCTCCCTGCCAAGG - Intronic
948718983 2:239884185-239884207 ACACGTGCCTCTCCTTTCCATGG - Intergenic
1170726159 20:18928762-18928784 ACTCTGGCCTCTCCATTCCAAGG - Intergenic
1171085779 20:22236828-22236850 TTTCTTGCCTTTCCCTACCAGGG - Intergenic
1171097959 20:22350398-22350420 ACCCTTGCCTCTCCATCCTATGG + Intergenic
1171205914 20:23281091-23281113 CCTCTTGCCTCAGCCTCCCAAGG - Intergenic
1171263910 20:23754954-23754976 TCTCTTGCCTTTCCCAGCCGGGG - Intergenic
1172001633 20:31782642-31782664 CCTCTTGCCTCGGCCTCCCAAGG - Intronic
1173063238 20:39681917-39681939 ACTCTTGCCTCTCTAGACCAAGG - Intergenic
1173738049 20:45375551-45375573 TGCCTTTCCTCTCCCTGCCAGGG - Exonic
1174406558 20:50306747-50306769 ACTCTAGCTGCTCCCTGCCCCGG + Intergenic
1174615790 20:51834388-51834410 TCTCCTGCCTCTGCCTCCCAAGG - Intergenic
1175206706 20:57316931-57316953 ACTCTTGCATGTGCCTCCCAGGG + Intergenic
1175231625 20:57477040-57477062 ACTCTGGCATCACCCTGCCCAGG + Intergenic
1175334371 20:58185459-58185481 AGTCTTGCCTCTCCCTGGAGAGG + Intergenic
1175693205 20:61081287-61081309 ACTCTTGGCTCGCTCAGCCAGGG + Intergenic
1176028294 20:62997628-62997650 ACTCTGGCCCCTCCCTGCCCTGG + Intergenic
1176299117 21:5090302-5090324 ACTGCTGCCTCTCCCCGCCAGGG - Intergenic
1176586858 21:8595640-8595662 CTTTTTGCCCCTCCCTGCCACGG + Intergenic
1176801392 21:13434127-13434149 CCTCCTGCCTCACCCTCCCATGG - Intergenic
1176926309 21:14753611-14753633 ACTCTTCTCCCTCCTTGCCAAGG - Intergenic
1177284813 21:19036189-19036211 ACTCTTTCCTCTTCCTTCAAAGG - Intergenic
1177429288 21:20969620-20969642 ACGCTTGCCTCGGCCTCCCACGG - Intergenic
1177762517 21:25418256-25418278 ACTCCTGCCTCTCCATGCCAGGG + Intergenic
1179508165 21:41855529-41855551 ACCCCTGCCTCTCACTTCCAAGG - Intronic
1179676194 21:42984181-42984203 ACTCCTGCCTCAGCCTCCCAAGG + Intronic
1179881992 21:44296758-44296780 GCTCGAGCCTCTGCCTGCCAGGG - Intronic
1180140351 21:45889674-45889696 ATTCCTGAGTCTCCCTGCCATGG + Intronic
1180269714 22:10572718-10572740 CTTTTTGCCCCTCCCTGCCACGG + Intergenic
1180795380 22:18601617-18601639 CCTCCTGCCTCTGCCTCCCAAGG - Intergenic
1180979153 22:19870610-19870632 AGTCTTGCCTCTCTCTCCCAGGG + Intergenic
1181003695 22:19999579-19999601 CCTATGGCCACTCCCTGCCACGG - Intronic
1181063668 22:20294854-20294876 ACTGTAGCCTCTACCTCCCAAGG + Intergenic
1181169261 22:20999086-20999108 AGTATGGCCTCTCCCTGCCGAGG - Intronic
1181226360 22:21393695-21393717 CCTCCTGCCTCTGCCTCCCATGG + Intergenic
1181252290 22:21541143-21541165 CCTCCTGCCTCTGCCTCCCATGG - Intergenic
1181764777 22:25083751-25083773 ACTCTGCCCTCTCCCTGTTAAGG + Intronic
1182221745 22:28764214-28764236 AATCTTACCTCTCCATGGCATGG - Intergenic
1183290106 22:36996029-36996051 ACTCTAGCCTCTGACTGGCAGGG + Intronic
1183377270 22:37472528-37472550 ACTCTTCTATCTCCCTGCCCAGG - Exonic
1184223016 22:43112512-43112534 ACTCCTGCCTCAGCCTCCCAAGG + Intronic
1184849622 22:47112805-47112827 TGCCTTGCCTCTCCCAGCCATGG + Intronic
1185265111 22:49897762-49897784 TCTCTTGCCTCAGCCTCCCAAGG + Intergenic
949414333 3:3799645-3799667 AGTCCTGCCTCCCCCTGCCCTGG + Exonic
949529609 3:4941291-4941313 ACTGCAGCCTCTACCTGCCAAGG - Intergenic
950083329 3:10239200-10239222 ACACCTCCCTCTCCCTGCCCTGG + Intronic
950171883 3:10844374-10844396 GCTCGTGCCTTCCCCTGCCACGG - Intronic
950249210 3:11449984-11450006 ACTCCTCCCACCCCCTGCCAGGG - Intronic
950549795 3:13659181-13659203 ACTGTTTCCTCTCCAAGCCAAGG - Intergenic
953280955 3:41556594-41556616 TCTCTTGCCTCAGCCTCCCAAGG + Intronic
953389480 3:42526156-42526178 ACCCTTGGCTCCCCCTGACAGGG + Intronic
954003113 3:47573227-47573249 TCTCAGGCCTCTCCCTGCCCTGG + Intronic
954514737 3:51163310-51163332 ACTCCTGTCTGTCTCTGCCAAGG + Intronic
954645053 3:52126161-52126183 GCTCTTGCCGCTCCCTGCACTGG - Intronic
955057918 3:55472604-55472626 TCTCAGGCCTCTCACTGCCATGG - Intronic
955408685 3:58642176-58642198 CCTCCTGCCACTCCCTGCCCTGG + Intronic
955604366 3:60684592-60684614 ACTCTGTTCTCTCCGTGCCAGGG + Intronic
956223037 3:66923963-66923985 ACTCTTCCCTCCCCTTTCCACGG - Intergenic
958868146 3:99525303-99525325 GCTCTTGCTTCTCCATGACAAGG - Intergenic
960045089 3:113189511-113189533 TCTTTTCCCTCTCCCTGCCTAGG + Intergenic
960569578 3:119172645-119172667 TTTCTCCCCTCTCCCTGCCATGG + Intronic
962157735 3:132966279-132966301 ACTGTGGCATCTCACTGCCAGGG - Intergenic
962736514 3:138329948-138329970 CCTCCTGCCTCTCCCTGGCTGGG - Intergenic
962829555 3:139128168-139128190 ACTGTAACCTCTCCCTCCCAGGG + Intronic
963082282 3:141404950-141404972 ACTCTGGTCTGTCCCTGCGATGG - Intronic
964589001 3:158340245-158340267 TCTCTTGCCGCTCCCTGGCCAGG + Intronic
966042176 3:175505154-175505176 CCTCTTGCCTCAGCCTCCCAAGG - Intronic
967856585 3:194122495-194122517 ACTCTTGCTTCTACCAGCCATGG - Intergenic
967925043 3:194639370-194639392 ACTCCTGGCTCTCCCTCACAGGG + Intergenic
968224030 3:196961498-196961520 CCTCCTGCCTCTGCCTCCCAAGG - Intronic
968474770 4:799024-799046 GCTCCTGCCTCTCACTCCCATGG + Intronic
968767383 4:2480004-2480026 ACTCTAGCCTCAACCTCCCAGGG + Exonic
968961206 4:3744554-3744576 GCGCCTGCGTCTCCCTGCCATGG - Intergenic
969445651 4:7243426-7243448 TCTCTCTCCTCTCACTGCCAAGG - Intronic
970368478 4:15384906-15384928 GCTCTTGCTTCTCCCTGCTATGG - Intronic
970500547 4:16672462-16672484 ACTCTTGCCTCTCTGGGCAAGGG - Intronic
971391004 4:26185063-26185085 ACTCTAACCTCTGCCTTCCAGGG - Intronic
972316450 4:37931209-37931231 TCTCCTGCCTCACCCTCCCAAGG + Intronic
973341145 4:49005782-49005804 TCTCTTGCCTCAGCCTCCCAAGG + Intronic
973852349 4:54973752-54973774 ACTCTTCCTTCTCCTTGGCAGGG - Intergenic
974630286 4:64479874-64479896 ACTCTTCCCTCCCCTTTCCAAGG + Intergenic
977187743 4:93961247-93961269 GCTTTTGCTTCTCCCTGCCGAGG - Intergenic
977276939 4:94989278-94989300 TCTCTTGCCTCAGCCTCCCAAGG - Intronic
978442398 4:108747541-108747563 ATTCCTGCCTCTGCCTCCCAAGG + Intronic
980790014 4:137608313-137608335 ACTGCTCCCTCACCCTGCCATGG + Intergenic
981399530 4:144297185-144297207 CCTGTTGCCTCTCCCTCCCAAGG + Intergenic
983388972 4:167103504-167103526 ACTCTTCCCTGTCCCTTCCATGG - Intronic
984267506 4:177512298-177512320 TCTCCTGCCTCTGCCTCCCAAGG + Intergenic
985781020 5:1871960-1871982 CCTCTTGCTTCCCCATGCCAGGG + Intergenic
985913520 5:2900830-2900852 AATGTGGCTTCTCCCTGCCATGG + Intergenic
986049919 5:4080031-4080053 ACCCTTTCCTCTCCCTGTCCTGG + Intergenic
987987561 5:25168074-25168096 ACACTTGCCACTCTCTGGCATGG - Intergenic
995576592 5:113542799-113542821 ACTCTTGTCTTTCCCTTCCTTGG + Intronic
996079431 5:119240023-119240045 CCTCCTGCCTCAGCCTGCCAAGG - Intronic
997275040 5:132578633-132578655 TCTCTTGCCTCAGCCTCCCAAGG + Intronic
997344275 5:133175109-133175131 TCTCTTGCCTCAGCCTCCCAAGG + Intergenic
997505762 5:134415421-134415443 CCTCTTGCCTCAGCCTCCCAAGG + Intergenic
998140718 5:139697946-139697968 ACTCATGCCCCACCCTGCCAAGG - Intergenic
998233939 5:140381553-140381575 CCTCTTGCCTCTGCCTGCCTAGG + Intergenic
999205696 5:149846388-149846410 CCTCTTGCCTCAGCCTCCCAAGG - Intronic
999748287 5:154608555-154608577 AGTCCTGCCTCTTCCTGCCTGGG + Intergenic
1000082802 5:157863552-157863574 ACTCTTGCTTTTGTCTGCCAGGG - Intergenic
1000560179 5:162777516-162777538 ACTTTTACCCCTCCCAGCCAAGG - Intergenic
1000977732 5:167783326-167783348 ACTCCTGCCCCTCACTGCCCAGG - Intronic
1001519138 5:172378275-172378297 CCTCTGCCCTCTCCCTGGCAAGG - Intronic
1001939717 5:175731845-175731867 AGTGTGGCCCCTCCCTGCCATGG + Intergenic
1002076448 5:176711548-176711570 CCTCTTGCCTCAGCCTCCCATGG + Intergenic
1002192841 5:177487784-177487806 ACTTTGGGCTCTCCCTGCCCTGG - Intronic
1004999726 6:21228956-21228978 GCTCTTGCCTCCCCCTGCCATGG + Intronic
1005384807 6:25275290-25275312 TCTCTTGCCTCAGCCTCCCAAGG - Intergenic
1006657851 6:35612042-35612064 CCTCTTGGCTCTACCTACCATGG - Intronic
1007115445 6:39339974-39339996 ACACCTCCCTCTCCCTGCCTGGG - Intronic
1007351057 6:41273813-41273835 ACTCCTGCCACCACCTGCCAGGG + Intronic
1007725227 6:43911946-43911968 GCTCTTCCCCCTCCCTGCCTAGG - Intergenic
1008039551 6:46782462-46782484 ATTCTTGCCTCTTCCTTTCACGG - Intergenic
1010390891 6:75336157-75336179 ACTATTGCCACTGCCTGGCAAGG + Intronic
1010999048 6:82566936-82566958 ATTCATTTCTCTCCCTGCCAAGG + Intergenic
1012908451 6:105093563-105093585 ACTGTAGCCTCGACCTGCCAGGG - Intergenic
1013716885 6:112972556-112972578 TCTCCTGCCTCACCCTCCCAAGG - Intergenic
1013787052 6:113793620-113793642 AATCTTGCCTCAGCCTCCCAAGG + Intergenic
1015300116 6:131643476-131643498 GCTCTTCCCTCTCCCTGGCAGGG + Intronic
1015384473 6:132606420-132606442 ACTCATGCCTCTCCCTTCACAGG - Intergenic
1015576018 6:134672053-134672075 TCTCTTGCCTCAGCCTCCCAAGG - Intergenic
1016878889 6:148890409-148890431 AGTCTTGCTTTTCCCTGCCAGGG - Intronic
1017239496 6:152151111-152151133 TCTCCTGCCTCAGCCTGCCAAGG - Intronic
1018029887 6:159833521-159833543 CCTCCTGCCTCAGCCTGCCAAGG + Intergenic
1018648187 6:165967386-165967408 TCTCTTGCCTCAGCCTCCCAAGG - Intronic
1018978038 6:168580379-168580401 ACCCCTGCCTCTCCCAGCCTCGG - Intronic
1019271903 7:154191-154213 CCTCCTGCCAGTCCCTGCCAGGG + Intergenic
1019416687 7:930869-930891 CCTCTTGCCTCAGCCTCCCAAGG - Intronic
1019450899 7:1097272-1097294 CATCTTGTCTCTCCCTGCCCCGG - Intronic
1019477717 7:1251986-1252008 ACCTTTGCCCCTGCCTGCCAGGG - Intergenic
1021613259 7:22477964-22477986 ACTCTTCCTACTCCGTGCCAAGG + Intronic
1022496576 7:30856649-30856671 ACTCTTGCCTACTTCTGCCATGG - Intronic
1022666538 7:32416327-32416349 ACTCTGGGCACTCCCTGCCCTGG + Intergenic
1023447148 7:40243731-40243753 ATTCTTGGCTATCCCTACCATGG - Intronic
1023797300 7:43804330-43804352 TCTCCTGCCTCAGCCTGCCAAGG - Intronic
1024606455 7:51026333-51026355 GCTCTTGCTGCTCCTTGCCATGG + Intronic
1024639146 7:51316136-51316158 AGTCTTCCCTCTCCCGGCCTCGG - Intronic
1025076427 7:55947707-55947729 TCTCTTGCCTCAGCCTCCCAAGG + Intergenic
1026315320 7:69222703-69222725 ACTCCTGCCTCAGCCTCCCAAGG + Intergenic
1026954040 7:74365587-74365609 CCCCCTGCCTCTCCCAGCCAGGG - Intronic
1027193898 7:76015001-76015023 TCTCCTGCCTCTGCCTCCCAAGG - Intronic
1027904537 7:84162462-84162484 TCTCTTGTCTCTCCCTTCCCAGG - Intronic
1028482420 7:91322081-91322103 CCTCTGGCCTCTTCCTGTCAGGG + Intergenic
1028526328 7:91790883-91790905 AGACGTCCCTCTCCCTGCCAGGG - Intronic
1028577628 7:92369893-92369915 AAACTTCCCTCTCCCTTCCATGG - Intronic
1029163170 7:98567395-98567417 ATTTTTCCATCTCCCTGCCAGGG - Intergenic
1029435840 7:100563646-100563668 ACCCTGCCCTCTCCCTGCCCGGG - Intronic
1030011016 7:105167717-105167739 ACTCATGCCTCAGCCTCCCAAGG + Intronic
1030881196 7:114882351-114882373 ACTCTTTCCTCCCCTTTCCATGG + Intergenic
1032785736 7:135198016-135198038 GCTCCTTCCTCTCCTTGCCATGG + Exonic
1033929507 7:146505628-146505650 ACTATAGGCTCTCCCTGCAAGGG + Intronic
1034026501 7:147710005-147710027 ACTGTAGCCTATCTCTGCCATGG - Intronic
1035362587 7:158323144-158323166 TGTCTCGCCTCTCCCAGCCAGGG - Intronic
1035690435 8:1556260-1556282 GCTCTGTCCTCTCCCTCCCAGGG + Intronic
1036811316 8:11868839-11868861 ACCCCTGCATCTCCCTTCCAGGG - Intronic
1036833055 8:12036944-12036966 ACTTTATCCTCTCCCTCCCAGGG - Intergenic
1037966326 8:23136503-23136525 ACTCTTCCCTCTTGATGCCATGG + Exonic
1038957689 8:32485221-32485243 ACTCCTGCCTCAGCCTCCCAAGG + Intronic
1040575442 8:48647454-48647476 CCTCTAACCTCCCCCTGCCAGGG - Intergenic
1040998526 8:53426414-53426436 ACTCTAGCCTTGCCCTGACAGGG + Intergenic
1041159060 8:55018622-55018644 ACTCCTGCCACTCCCAGCCAGGG + Intergenic
1042662936 8:71175708-71175730 TCTCTTGCCTGGCCCAGCCAAGG + Intergenic
1045103383 8:98867303-98867325 CCTCTTGCCCCAGCCTGCCATGG - Intronic
1047853368 8:128883189-128883211 GCTCTTTCCCCTCCCTGCCTGGG + Intergenic
1048203575 8:132397382-132397404 AGGCCTTCCTCTCCCTGCCAGGG + Intronic
1049334935 8:142079073-142079095 ACTGTGGCCTCTGCCTCCCAGGG - Intergenic
1050910765 9:11066537-11066559 ACTATTGCCTCTCCTTCACAAGG + Intergenic
1051902101 9:22054858-22054880 TCTCCTGCCTCTGCCTCCCAAGG + Intergenic
1053506448 9:38647668-38647690 TCTCCTGCCTCTGCCTCCCAAGG + Intergenic
1053669572 9:40346651-40346673 AGTCTTGGCCTTCCCTGCCAGGG + Intergenic
1053919367 9:42972891-42972913 AGTCTTGGCCTTCCCTGCCAGGG + Intergenic
1054380706 9:64486671-64486693 AGTCTTGGCCTTCCCTGCCAGGG + Intergenic
1054515042 9:66029640-66029662 AGTCTTGGCCTTCCCTGCCAGGG - Intergenic
1055303282 9:74904024-74904046 TCTCTTGCCTCAGCCTCCCAAGG + Intergenic
1056082976 9:83116070-83116092 ATTCTTGGAACTCCCTGCCAAGG + Intergenic
1056205980 9:84319841-84319863 ACTCATGACTCTGCCAGCCATGG + Intronic
1057069077 9:92080448-92080470 ACTCTTGCCTCTCTCTGTCTAGG + Intronic
1057139591 9:92718452-92718474 CCTCCTTCCTCCCCCTGCCACGG - Intronic
1057217628 9:93238212-93238234 ACTCTGCTCTCTCCCTGTCAGGG + Exonic
1057724396 9:97557784-97557806 TCTGTTTCCTCTCCCTGCCTTGG - Intronic
1057806163 9:98221228-98221250 ATTCTTCCCTCTCCCTGCCCAGG - Exonic
1057888899 9:98853087-98853109 ACTCTAGCCCTGCCCTGCCAGGG + Intergenic
1058039764 9:100290954-100290976 CCTCTTGCCTCAGCCTCCCAAGG + Intronic
1058140491 9:101352778-101352800 AATCTTGCCCTACCCTGCCAGGG + Intergenic
1058348327 9:103991213-103991235 TCTCTTGCCTCTCTCTTACAAGG + Intergenic
1058379068 9:104358860-104358882 ACTCTGGATTCTCCCTCCCAGGG - Intergenic
1060141270 9:121212441-121212463 ACCCTCTTCTCTCCCTGCCAGGG + Intronic
1060659604 9:125396788-125396810 TCTCTTGCCTCAGCCTCCCAGGG - Intergenic
1060929641 9:127480794-127480816 TCTCTTGCCTCAGCCTCCCAAGG + Intronic
1061379361 9:130244808-130244830 CTTCTGGCCTCTCCCTGCCAGGG + Intergenic
1061507959 9:131042646-131042668 ACCCTTGCCTTTCACAGCCATGG + Intronic
1061687327 9:132292197-132292219 GCTCTTGCCTCAGCCTCCCAAGG - Intronic
1061955540 9:133959498-133959520 ACCCCTGCCCCTCCCTACCAGGG + Intronic
1062613011 9:137383398-137383420 GCACCTGCCTCTCCCTCCCACGG - Intronic
1186025993 X:5313123-5313145 CCTCTTGCCTCAGCCTCCCAAGG - Intergenic
1186476756 X:9863444-9863466 CCTCGCGCCTCTCCTTGCCATGG + Intronic
1186652458 X:11575650-11575672 ACTCTTGCCTGTGTCTGACAAGG + Intronic
1186693502 X:12004735-12004757 TCTGCTGCCTCTCACTGCCAGGG + Intergenic
1187565331 X:20443963-20443985 CTTCTTCCCTCTCCTTGCCATGG - Intergenic
1187888598 X:23912517-23912539 ACTCCTGGCCCTCCCTGCCTTGG - Intronic
1189597519 X:42585046-42585068 ACCCCTGCCTCTCCCAGCCAGGG + Intergenic
1190038589 X:47050175-47050197 CCTCTTGCCTCAGCCTCCCAAGG + Intronic
1193300053 X:79879006-79879028 ACTCTTGTCTCCCCTTTCCAAGG - Intergenic
1193350385 X:80456933-80456955 ACTCTTGCCAATTCCTGCCCAGG + Intergenic
1193843435 X:86438330-86438352 TCTGTTGCCTCTGCCTCCCAAGG + Intronic
1195908171 X:109865403-109865425 CCTCTCGGCTCTCACTGCCACGG + Intergenic
1195931980 X:110087652-110087674 ACTCTTCCCTCACCCCGCCTTGG + Intronic
1195966499 X:110434461-110434483 CCTCTCGGCTCTCACTGCCACGG - Intronic
1196606023 X:117658038-117658060 AATCATGCCACTCCATGCCATGG - Intergenic
1196726336 X:118899323-118899345 ACACTTCCCTCTCTCTGCCCTGG - Intergenic
1196940031 X:120766482-120766504 ACTCTTGACTTTCCTTGCCTAGG - Intergenic
1198031466 X:132757436-132757458 TCTCTGGCCACTCTCTGCCAGGG + Intronic
1200109540 X:153733358-153733380 GCTTTTCTCTCTCCCTGCCATGG + Intronic