ID: 922758397

View in Genome Browser
Species Human (GRCh38)
Location 1:228109371-228109393
Sequence AGATATACGCCCCTGTTGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 34
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 32}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922758391_922758397 16 Left 922758391 1:228109332-228109354 CCATGGCAGGGAGAGGCAAGAGT 0: 1
1: 0
2: 4
3: 49
4: 450
Right 922758397 1:228109371-228109393 AGATATACGCCCCTGTTGGGCGG 0: 1
1: 0
2: 0
3: 1
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922758397 Original CRISPR AGATATACGCCCCTGTTGGG CGG Intergenic
908915888 1:69126045-69126067 AGATATAGGCCCCAAATGGGTGG + Intergenic
909674255 1:78221539-78221561 AGATGTACACCACTGTTGGAAGG - Intergenic
911147746 1:94568824-94568846 AGGTATATGCCCCAGGTGGGAGG + Intergenic
917881147 1:179337164-179337186 AGTTTTATGCCCCTGTTTGGAGG + Intronic
920964226 1:210688963-210688985 AAATATATGCCCCTGTGGGCTGG - Intronic
922758397 1:228109371-228109393 AGATATACGCCCCTGTTGGGCGG + Intergenic
1076222204 10:128743281-128743303 AGACATATGCCACTGCTGGGGGG - Intergenic
1080287504 11:30632576-30632598 AGATATAAGCCCTTGTTGCATGG + Intergenic
1091356624 11:134942411-134942433 AGTCCTACGCCCCTGCTGGGAGG - Intergenic
1095620460 12:44248071-44248093 GGATATAGCCCCCAGTTGGGCGG + Intronic
1125710092 15:41777847-41777869 AGGTACATGCCCCTTTTGGGGGG + Intronic
1132061146 15:98693317-98693339 AGATTTACCACCCTGTTGTGGGG + Intronic
1150804863 17:68310740-68310762 AGATACGCGCCCTTGGTGGGTGG + Intronic
1151099688 17:71542736-71542758 AGAGACACCCCCCTCTTGGGTGG - Intergenic
1154498034 18:14976891-14976913 AATCATACGCCCCTGCTGGGAGG + Intergenic
1157820064 18:50760631-50760653 AGCTGTACTCCCCTATTGGGAGG - Intergenic
1157944142 18:51959673-51959695 AGATATAGGCCCCTATCGTGTGG - Intergenic
1161748619 19:6077423-6077445 AGGCACACGCCCCTCTTGGGTGG - Intronic
933041284 2:77470107-77470129 AAATATATGCCCCTGCTGGTCGG - Intronic
936474998 2:112832178-112832200 AGATATAAGTTCCTGCTGGGCGG + Intronic
1170367722 20:15616044-15616066 AGGTATACACCCCTGGTGGGTGG + Intronic
1179911071 21:44449160-44449182 AGAGAGACGCGCCTGCTGGGTGG - Intergenic
1184322383 22:43752464-43752486 AGACATCCGCCCTTCTTGGGTGG + Intronic
978389810 4:108213631-108213653 AGATACAGGCCCCTCTTAGGAGG + Intergenic
991642405 5:68768186-68768208 AGATATCTGCACCAGTTGGGTGG + Intergenic
1003957345 6:11176027-11176049 AGTTATACACACCTGGTGGGTGG - Intergenic
1027932657 7:84558262-84558284 ATATATATGCTACTGTTGGGTGG - Intergenic
1032521166 7:132546364-132546386 AAATATGCTACCCTGTTGGGAGG + Intronic
1047361202 8:124171139-124171161 AGATTTTCGCTTCTGTTGGGGGG + Intergenic
1049204814 8:141358808-141358830 AGACAGAGGCCCCTGTGGGGTGG + Intronic
1051473927 9:17481535-17481557 AGATGTACGCTGCAGTTGGGTGG - Intronic
1052311769 9:27075713-27075735 AGCTAGAGGCCCCTGCTGGGAGG + Intergenic
1199079573 X:143561582-143561604 ATCTAGAGGCCCCTGTTGGGAGG - Intergenic
1200731977 Y:6752540-6752562 AGATATCAGCCCCTATTAGGAGG - Intergenic