ID: 922759018

View in Genome Browser
Species Human (GRCh38)
Location 1:228113558-228113580
Sequence ATGTCCTTTTAGAAAAGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922759015_922759018 18 Left 922759015 1:228113517-228113539 CCTATTTTATTCTAAACGATGGA No data
Right 922759018 1:228113558-228113580 ATGTCCTTTTAGAAAAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922759018 Original CRISPR ATGTCCTTTTAGAAAAGTGA AGG Intergenic
No off target data available for this crispr