ID: 922762128

View in Genome Browser
Species Human (GRCh38)
Location 1:228139849-228139871
Sequence CCTGCAGTGTAGATGGAGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 565
Summary {0: 1, 1: 0, 2: 4, 3: 70, 4: 490}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922762122_922762128 19 Left 922762122 1:228139807-228139829 CCGGTTTGGAACGGGCTAGCGGA 0: 1
1: 0
2: 1
3: 0
4: 15
Right 922762128 1:228139849-228139871 CCTGCAGTGTAGATGGAGGACGG 0: 1
1: 0
2: 4
3: 70
4: 490

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922762128 Original CRISPR CCTGCAGTGTAGATGGAGGA CGG Intergenic
900506906 1:3033948-3033970 GCTGCAGCACAGATGGAGGATGG + Intergenic
900805391 1:4764006-4764028 CCTGTGGTGTAGATGGAGCTGGG + Intronic
900851307 1:5145112-5145134 CCTGCAGTCTACTTGGAGGGGGG - Intergenic
901407481 1:9059097-9059119 CCATCAGAGTAGATGGAAGAAGG - Intronic
902247384 1:15129744-15129766 CTGGCTGTGGAGATGGAGGAAGG + Intergenic
905751858 1:40472222-40472244 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
905875025 1:41427040-41427062 TCTGCAGTGGGCATGGAGGAGGG - Intergenic
905921213 1:41720136-41720158 TCTGCGATGTAGATGGAGGGTGG - Intronic
907254546 1:53168752-53168774 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
907393557 1:54174400-54174422 CCTACTATGTAGAAGGAGGATGG - Exonic
907515415 1:54990559-54990581 CCTGCTGTCTAGACCGAGGAGGG - Intronic
907932271 1:59011609-59011631 CTGGCTGTGAAGATGGAGGAAGG + Intergenic
908022699 1:59914831-59914853 CTTGCAGTTGAGATAGAGGAAGG + Intronic
908024723 1:59938669-59938691 CCTGCAGTTGAGATAGAGGAAGG - Intergenic
908090771 1:60683561-60683583 CAGGCAGTGGTGATGGAGGAGGG - Intergenic
908671831 1:66556534-66556556 CTTGCAATGGAGCTGGAGGAGGG + Intronic
908981418 1:69963577-69963599 GCTACAGTGTAGATAGAAGATGG + Intronic
910802433 1:91159574-91159596 CCAGCTTTGAAGATGGAGGAAGG + Intergenic
912968181 1:114255604-114255626 CCTTCAGTGAAGCTGGAGGCAGG + Intergenic
913323711 1:117607775-117607797 CCTGCAGTGGAAAAGGGGGAGGG + Intronic
914339165 1:146743573-146743595 GCTGCAATGGAGATGGAGAAAGG - Intergenic
914441310 1:147709920-147709942 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
914773141 1:150709678-150709700 CTTGCAGTTGAGATAGAGGAAGG + Intronic
915052332 1:153088762-153088784 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
915358052 1:155268445-155268467 CCTGGGGTGGAGATGAAGGAAGG + Intronic
915595681 1:156895143-156895165 CCTCCAGTGGAGAGAGAGGAAGG - Intronic
915837252 1:159187827-159187849 CCTTCTGTGCACATGGAGGATGG - Intronic
916472085 1:165133998-165134020 CTGGCTTTGTAGATGGAGGAAGG + Intergenic
917431590 1:174975046-174975068 CATGCAGTGGAGATGGCAGAAGG - Intronic
919182357 1:194103182-194103204 CCTACACTGGAGATGGATGATGG - Intergenic
919484502 1:198130197-198130219 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
919736808 1:200957762-200957784 CTTACAGTGTAGTGGGAGGAGGG + Intergenic
922484912 1:225966321-225966343 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
922606316 1:226891913-226891935 CCTGCAGCCTGGGTGGAGGAGGG + Intronic
922762128 1:228139849-228139871 CCTGCAGTGTAGATGGAGGACGG + Intergenic
922880900 1:228979582-228979604 CCTGCAGGGGAAGTGGAGGAAGG + Intergenic
923286242 1:232498647-232498669 CTTGCTGTGAAGATGGAGGAAGG - Intronic
923440310 1:234012325-234012347 CTTGCAGTTGAGATAGAGGAAGG - Intronic
923465387 1:234243754-234243776 CCTGCACTGTAGCAGGAGCAGGG - Intronic
923725878 1:236504990-236505012 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1062968432 10:1627939-1627961 TCTGCAGTGTGAGTGGAGGAGGG - Intronic
1063424824 10:5942690-5942712 CCTGCAGGGTTGAGGCAGGAGGG - Intronic
1064143280 10:12807786-12807808 CCTGCAGTGGAGCTGGACGGAGG - Intronic
1064299590 10:14111850-14111872 CCTGCAGGGCAGGTGGAGGAGGG + Intronic
1065453384 10:25881615-25881637 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
1065809358 10:29427203-29427225 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1066175078 10:32894948-32894970 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1067776970 10:49170927-49170949 TCTGCAAAGTAGCTGGAGGATGG + Intronic
1068440567 10:57050089-57050111 TGTCCAGTGTAGATGGAAGAAGG - Intergenic
1068786995 10:60987564-60987586 CCTACATGGGAGATGGAGGATGG - Intronic
1069677320 10:70257683-70257705 CTTGCAGTTGAGATAGAGGAAGG + Intronic
1070998328 10:80806373-80806395 CTTGCAGTTGAGATGGAGGAAGG + Intergenic
1071855273 10:89618146-89618168 CCTGCCTTGTAGGTGGAGAAGGG - Intronic
1072410494 10:95197708-95197730 CTTGCAGTTGAGATAGAGGAAGG - Intronic
1072708587 10:97700309-97700331 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1073106287 10:101034048-101034070 CTTGCAGTTGAGATAGAGGAAGG - Intronic
1074615503 10:115063565-115063587 CCTGCACTGAAAATGGAGCAAGG - Intergenic
1076941223 10:133610470-133610492 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1077500051 11:2905253-2905275 CTGGCAGTGGTGATGGAGGAGGG + Intronic
1077585419 11:3447938-3447960 CTTGCAGTTGAGATGGAGGAAGG - Intergenic
1077586331 11:3456465-3456487 CTTGCAGTTGAGATGGAGGAAGG - Intergenic
1077597396 11:3545843-3545865 CTTGCAGTTGAGATGGAGGAAGG + Intergenic
1077708424 11:4511429-4511451 CCTGCAGTCACGATGAAGGATGG + Intergenic
1078134138 11:8638405-8638427 CATGCAGAGTGGAAGGAGGAAGG - Intronic
1079137592 11:17784754-17784776 ACTGCAGTGCGGAGGGAGGAGGG - Intergenic
1079582626 11:22085113-22085135 TCTGCAGTATAAATGGGGGAGGG - Intergenic
1079664908 11:23093018-23093040 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
1079851466 11:25541193-25541215 CTTGCAGTTGAGATGGAGGAAGG + Intergenic
1080547325 11:33333548-33333570 CATCCACTGGAGATGGAGGAAGG + Intronic
1081019778 11:37931058-37931080 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1082267173 11:50131653-50131675 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
1082288916 11:50346915-50346937 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1082706868 11:56503086-56503108 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
1082724513 11:56719145-56719167 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1083138924 11:60705429-60705451 CCTGCAGAGCAAAAGGAGGAAGG - Intronic
1083629171 11:64086987-64087009 GCTGCTGTGTAGGTGGAGGCCGG - Intronic
1083887712 11:65580970-65580992 CCTGCACTGTAGTTGGGGGAGGG + Intronic
1084242323 11:67830497-67830519 CTTGCAGTTGAGATGGAGGAAGG - Intergenic
1084253499 11:67921751-67921773 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1085463920 11:76711576-76711598 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1086464458 11:87038371-87038393 CCTGCAAGGGAGAAGGAGGAGGG + Intronic
1086861712 11:91932242-91932264 CATCCAGTGCAGCTGGAGGAGGG - Intergenic
1088360851 11:108988257-108988279 CTTGCAGTGTATATGGAGGAAGG + Intergenic
1088737533 11:112740119-112740141 CCTGCTCTGGAGATGGAGGGAGG + Intergenic
1088845665 11:113663917-113663939 CCTGCAGAGAAGATAGATGAGGG - Intergenic
1089178583 11:116565553-116565575 CATGCAGTGTAGGTGGAAGAGGG - Intergenic
1089420355 11:118328189-118328211 CTGGCTTTGTAGATGGAGGAAGG + Intergenic
1089512462 11:119008617-119008639 CTTGCAGGTGAGATGGAGGAAGG - Intronic
1089564873 11:119365380-119365402 CCAGCAGTGTGGTGGGAGGAGGG + Intronic
1091254431 11:134171706-134171728 AGTGCAGAGTACATGGAGGAAGG - Intronic
1091613559 12:2032072-2032094 GCTGCAAGGTAGAGGGAGGAGGG + Intronic
1091765749 12:3118978-3119000 CCTGGAGTATGGATGGAGTAGGG + Intronic
1091781514 12:3216978-3217000 CCTGAACTGCAGTTGGAGGAAGG + Intronic
1092405691 12:8220669-8220691 CTTGCAGTTGAGATGGAGGAAGG + Intergenic
1092412564 12:8265199-8265221 CTTGCAGTTGAGATGGAGGAAGG - Intergenic
1092995010 12:13941408-13941430 CCTGCTGTGAAGATGGACAAAGG + Intronic
1093233186 12:16574097-16574119 TCGGCAGAGTAGGTGGAGGAAGG - Intronic
1094815630 12:34180788-34180810 CTTGCAGTTGAGATGAAGGAAGG - Intergenic
1095080686 12:37996018-37996040 CTTGCAGTTGAGATAGAGGATGG + Intergenic
1095743383 12:45631114-45631136 GCTGCAGGGTAGATGGAAGTGGG - Intergenic
1096125456 12:49116136-49116158 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1096814381 12:54192574-54192596 CCTGAAGTAAAGATGTAGGAAGG + Intergenic
1097132459 12:56822600-56822622 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1098223259 12:68292717-68292739 CCTGGGGTGAAGATGGGGGAGGG + Intronic
1098306345 12:69106653-69106675 CCTGGAGTGGAGTTGGAGGGTGG - Intergenic
1098532698 12:71558588-71558610 CCTGCAGTATAGCTTAAGGATGG + Intronic
1098685376 12:73412905-73412927 CTTGCTTTGGAGATGGAGGAAGG + Intergenic
1098873994 12:75847838-75847860 CCTGCAGGGTGAATGGATGATGG - Intergenic
1099494062 12:83322882-83322904 TCTGATGAGTAGATGGAGGAAGG + Intergenic
1101301704 12:103489665-103489687 GCTGCAGTGTGGATGGGGGAGGG - Intronic
1101798235 12:107997551-107997573 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
1103041686 12:117701045-117701067 CCTATTGTGCAGATGGAGGATGG - Intronic
1103962554 12:124618001-124618023 CCTGCGGTGGAGAAGGAAGAGGG + Intergenic
1104060584 12:125264531-125264553 GCTGGAGTGTTGATGGGGGATGG + Intronic
1104238077 12:126959187-126959209 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
1104248414 12:127065093-127065115 CTTGCCATGGAGATGGAGGAAGG - Intergenic
1104695178 12:130858055-130858077 CTGGCACTGAAGATGGAGGATGG - Intergenic
1104984141 12:132587185-132587207 ACTGCAGTGTGGCTGGAGGACGG + Intergenic
1105055069 12:133091047-133091069 CTTGCAGTTGAGATAGAGGAAGG - Intronic
1105055601 12:133095982-133096004 CTTGCAGTTGAGATAGAGGAAGG - Intronic
1105633828 13:22198218-22198240 CCAGCAGTGGAAATAGAGGAGGG - Intergenic
1107667855 13:42711266-42711288 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1107741956 13:43460218-43460240 TCTGCAGTTAAGATGAAGGAGGG - Intronic
1108313624 13:49218476-49218498 ACTGAAGTGGAGGTGGAGGAAGG + Intergenic
1108484583 13:50910590-50910612 CCTGCAGTGGCGAGGCAGGAGGG + Intronic
1108715263 13:53072380-53072402 CCTGGTGTGGAGATTGAGGAAGG + Intergenic
1110802945 13:79721387-79721409 CTGGCAGTGAGGATGGAGGAAGG + Intergenic
1111598951 13:90447175-90447197 GCTGGAGTGGAGAAGGAGGATGG - Intergenic
1112257927 13:97851662-97851684 CTGGCTGTGAAGATGGAGGAGGG + Intergenic
1112367133 13:98764814-98764836 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1113359263 13:109613838-109613860 ACAGCATTGTAGATGGAGGCTGG - Intergenic
1113970154 13:114182424-114182446 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
1113991724 14:16032994-16033016 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1114006567 14:18319940-18319962 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1114089301 14:19270088-19270110 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
1114168032 14:20242071-20242093 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
1114603227 14:23973085-23973107 CTTGCAGTCGAGATAGAGGAAGG - Intronic
1114604072 14:23982006-23982028 CTTGCAGTTGAGATAGAGGAAGG - Intronic
1114607593 14:24010206-24010228 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
1114608206 14:24015568-24015590 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
1114609095 14:24024803-24024825 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
1114746318 14:25151708-25151730 GCTGCAGGGGAGAAGGAGGAGGG + Intergenic
1117335400 14:54753108-54753130 CTTGCAGTTGAGATAGAGGAAGG - Intronic
1117465185 14:55986226-55986248 GCTGAAGTGTATGTGGAGGAGGG - Intergenic
1121311841 14:92939538-92939560 CCAAGAGTGGAGATGGAGGATGG - Exonic
1121506635 14:94482666-94482688 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1121527084 14:94626612-94626634 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1122646007 14:103194666-103194688 CTTGTGGAGTAGATGGAGGAAGG + Intergenic
1123052870 14:105555283-105555305 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1123077452 14:105675671-105675693 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1123390493 15:19866578-19866600 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1125562298 15:40644457-40644479 CTTGCAGTTGAGATAGAGGAAGG - Intronic
1125600640 15:40913777-40913799 CCCACTGTGTAGATAGAGGAAGG + Intergenic
1126861935 15:52893424-52893446 AGTGCAGCGGAGATGGAGGAAGG + Intergenic
1127998841 15:64172103-64172125 CGTGCACTGTAGATGGTGGGTGG - Intronic
1128645179 15:69373061-69373083 GCTGATGTGAAGATGGAGGAAGG - Intronic
1130070089 15:80639830-80639852 CTTGTAGTGAAGAGGGAGGATGG + Intergenic
1130353166 15:83108548-83108570 CCTGCAGTGGAGTGGGAGGCAGG - Intronic
1130619946 15:85452511-85452533 ACTGCAGTGTAGATTGAGTATGG + Intronic
1130953865 15:88613046-88613068 TCTGCTGTATGGATGGAGGAGGG - Intergenic
1131194802 15:90347076-90347098 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
1131946664 15:97629617-97629639 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
1133476296 16:6125078-6125100 CCAGCAGTGGATGTGGAGGATGG - Intronic
1133904068 16:10004641-10004663 CTTGCTTTGAAGATGGAGGAAGG - Intronic
1134183215 16:12063927-12063949 GCGGCAGTGTAGATGCAGGCAGG + Intronic
1134310172 16:13068525-13068547 CCTGGAGTTTAGATGGAGAGAGG + Intronic
1134783026 16:16916103-16916125 ACTCCAGTGTAGAGGGAGAAAGG - Intergenic
1135718529 16:24794398-24794420 CCTTCTGTGCAGATGCAGGAAGG + Intronic
1136911040 16:34144562-34144584 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1136991489 16:35153919-35153941 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1137525988 16:49236756-49236778 CCGGCTATGAAGATGGAGGAGGG + Intergenic
1138350194 16:56342216-56342238 CCTGGAGTGGGGAAGGAGGAGGG + Intronic
1138756366 16:59490942-59490964 CCTGCAGGGGAGGGGGAGGAAGG - Intergenic
1139995113 16:70973779-70973801 GCTGCAATGGAGATGGAGAAAGG + Intronic
1140014527 16:71168702-71168724 GCTGCAGGGCAGAAGGAGGAGGG + Intronic
1141126550 16:81404632-81404654 GCTGCAGAGTGGATGGTGGAAGG - Intergenic
1141264967 16:82488476-82488498 CCGGCAGTGTTGAAGTAGGAGGG - Intergenic
1141341732 16:83209892-83209914 CCAGCAGAGTAGGTGGGGGATGG + Intronic
1141413106 16:83849655-83849677 CCTGGGGTGCAGATGGAAGAGGG + Intergenic
1141709663 16:85690591-85690613 CCTGCAGTGTTCAGGGAGGAGGG + Intronic
1141774773 16:86115974-86115996 CCTGCAAAGCAGAGGGAGGATGG - Intergenic
1141863126 16:86731551-86731573 CTTGGAGTTTTGATGGAGGAGGG + Intergenic
1142376304 16:89708732-89708754 GCTGCACTGTAGAAGCAGGAGGG - Intronic
1142470842 17:162486-162508 CCCGCTGTGAAGGTGGAGGAAGG + Intronic
1143476615 17:7206964-7206986 CCAGAAGAGGAGATGGAGGAAGG + Intronic
1143861891 17:9897261-9897283 GCTGGAGGGTAGAAGGAGGAGGG - Exonic
1144571236 17:16400594-16400616 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1145363329 17:22230129-22230151 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1147343618 17:39771669-39771691 CCTGGAGTGCAGAGGGAGGATGG + Intronic
1148050811 17:44769234-44769256 CCTCCTATGTAGATGGAGGCTGG + Intronic
1148787468 17:50152294-50152316 CCTGCAGTGGAGTGGTAGGAGGG - Intergenic
1148849625 17:50548361-50548383 TCTGGGGTGTAGATGAAGGATGG - Exonic
1150905552 17:69333013-69333035 CTGGCAGTGAAGATGGAGGAAGG + Intergenic
1151656844 17:75500163-75500185 CCACCCGCGTAGATGGAGGAAGG - Intergenic
1151890821 17:76949501-76949523 CCTCAAGTGTAGAGGGAGGGTGG - Exonic
1152491725 17:80639515-80639537 CCAGCAGTGCAGCTGGGGGAGGG - Intronic
1153276910 18:3376553-3376575 CTAGCTGTGAAGATGGAGGAAGG - Intergenic
1153706023 18:7746871-7746893 TCTGAAGGGTGGATGGAGGAAGG + Intronic
1153999103 18:10468487-10468509 CCTGCTGTCTGGATGAAGGAGGG - Exonic
1154461791 18:14597230-14597252 CTTGGAGTGGAGATGCAGGAAGG + Intergenic
1154530903 18:15344260-15344282 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1156364899 18:36416716-36416738 CCTGCAAAGCATATGGAGGAAGG - Intronic
1156749268 18:40430731-40430753 ACTGCAGCATTGATGGAGGAAGG - Intergenic
1156829716 18:41477273-41477295 CCGGCATTGAAGATGGAAGAAGG - Intergenic
1157502531 18:48201569-48201591 CCTGGAGTGTAGGTGGAGGGAGG - Intronic
1159230675 18:65604689-65604711 CCTGGATTGTATTTGGAGGATGG - Intergenic
1159606472 18:70479613-70479635 CTTGCAGTTGAGATGGAGGAAGG + Intergenic
1160198899 18:76779885-76779907 CTGGCTGTGCAGATGGAGGAAGG + Intergenic
1160246598 18:77164817-77164839 CATGCAGTGTGGACGCAGGAAGG + Intergenic
1160495449 18:79371723-79371745 ACAGCAGGGAAGATGGAGGATGG - Intronic
1161420560 19:4174236-4174258 CCTGCAGGGCCCATGGAGGAGGG + Exonic
1161761940 19:6180064-6180086 CTGGCTGTGAAGATGGAGGAAGG - Intronic
1163092917 19:15033688-15033710 CCTGCAGCACAGAGGGAGGAGGG - Intergenic
1163849876 19:19656766-19656788 CCTGCAGGGCAGAGGCAGGAGGG + Exonic
1164069773 19:21756825-21756847 CCTGTAGTGTAGTTTGAAGAGGG - Intronic
1165051180 19:33142513-33142535 CCTGCATTGTGGATGGGGCATGG + Intronic
1165346971 19:35254573-35254595 GCTGCAGTGCAGCTGGAGGTGGG - Intronic
1166195731 19:41204507-41204529 TCTGCAGTGAAGGTGGAGGAGGG - Intronic
1166248052 19:41545070-41545092 CTTGCAGTCGAGATGGAGGAAGG + Intergenic
1166430585 19:42723279-42723301 TCTGCAGTGCAGATGGTAGAGGG + Intronic
1166443607 19:42838639-42838661 TCTGCAGTGCAGATGGTGGAAGG + Intronic
1166463300 19:43009301-43009323 TCTGCAGTGCAGATGGTGGAAGG + Intronic
1166469442 19:43065859-43065881 TCTGCAGTGCAGATGGTTGAAGG + Intronic
1166480574 19:43169397-43169419 TCTGCAGTGCAGATGGTGGAGGG + Intronic
1167404325 19:49294449-49294471 CAGGCATTGTAGATGGAGGTTGG + Exonic
924967863 2:94524-94546 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
925037640 2:703064-703086 CTTGCAGTTGTGATGGAGGAAGG - Intergenic
926125736 2:10270614-10270636 CTTCCAGTGTAAATGGAGGTAGG - Intergenic
926808758 2:16737857-16737879 CTTGATGTATAGATGGAGGAAGG - Intergenic
927922216 2:26981794-26981816 ACTGGAGTGTAGGTGGAGGAGGG - Intronic
928445335 2:31329084-31329106 CCAGCAGTGGGGATGGAGAATGG + Intergenic
929046648 2:37797119-37797141 GCTGAAGTGTAGAGGGAGGGAGG - Intergenic
929818995 2:45258504-45258526 CCTGGAGATTAGAAGGAGGAAGG - Intergenic
930057884 2:47265726-47265748 ACTGGAGTGGAGGTGGAGGAGGG + Intergenic
930656718 2:54014260-54014282 CCTGCAGTGAAGATGAGGGTGGG + Intronic
931837580 2:66115025-66115047 CATGCAGTGTGGATGGAGCAGGG - Intergenic
932600316 2:73119694-73119716 CTTGCAGTTGAGATAGAGGAAGG - Intronic
932957536 2:76371933-76371955 CCTGCAGGGTAGATCATGGAAGG - Intergenic
933773647 2:85758990-85759012 CCCTCAGGGTTGATGGAGGATGG + Intronic
934542992 2:95191832-95191854 CTTGCAGGTGAGATGGAGGAAGG + Intergenic
934592406 2:95567657-95567679 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
934937027 2:98472950-98472972 GGTGCAGTGTAGAGTGAGGAGGG + Intronic
934937032 2:98472980-98473002 GGTGCAGTGTAGAGTGAGGAGGG + Intronic
934937053 2:98473100-98473122 GGTGCAGTGTAGAGTGAGGAGGG + Intronic
935656176 2:105425519-105425541 CTTGCAGTTGAGATGGAGGAAGG + Intronic
936107473 2:109637351-109637373 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
937426793 2:121806648-121806670 CTGGCATTGAAGATGGAGGAAGG + Intergenic
937445184 2:121951384-121951406 GCTGCAGTGTAGATGAGGAAGGG + Intergenic
937693465 2:124781671-124781693 AGTGCAGTGTAGATGGCGGCGGG - Intronic
938214621 2:129500681-129500703 CCTGCAGTGCAGATGGAGATAGG - Intergenic
938235387 2:129701842-129701864 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
938487017 2:131721686-131721708 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
938529994 2:132175532-132175554 CTTGCAGTTGAGATAGAGGAAGG - Intronic
938895262 2:135742577-135742599 ACTGCTGTTTAGATGGAGGTAGG + Intronic
940678876 2:156759239-156759261 CCTGCAGTATAGTTCGAGGTTGG - Intergenic
941714986 2:168754471-168754493 CCTGCAGTGCAGATGAGGTAAGG + Intronic
942792631 2:179778208-179778230 CATGCAGGGCAGATGGAGAATGG - Intronic
946051110 2:216863292-216863314 CCTGGAGTGAGGATGGAGCAGGG + Intergenic
947228918 2:227866113-227866135 CCTGCTGTGGGGATGGAGGCAGG + Intergenic
948047179 2:234952935-234952957 CCTGCGGTGTAGACGGGGGTTGG + Intronic
948145563 2:235705550-235705572 CCTGTAGTGGAGTAGGAGGAAGG + Intronic
948273519 2:236691569-236691591 CCGGCTTTGAAGATGGAGGAAGG + Intergenic
948295237 2:236855663-236855685 CTGGCTGTGCAGATGGAGGAAGG - Intergenic
948305414 2:236943795-236943817 CCTCCAGGGTAGACTGAGGATGG + Intergenic
948510516 2:238461226-238461248 CTGGCTGTGAAGATGGAGGAGGG - Intergenic
948843476 2:240671837-240671859 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1169119760 20:3088192-3088214 CCTGCAGTGAAGAAGGGGTAAGG - Intergenic
1169392580 20:5202511-5202533 ACTGCAGGGTGGATGGAGCAGGG + Intergenic
1169757263 20:9056059-9056081 GCTGCATTGAAGACGGAGGAAGG + Intergenic
1170397842 20:15947179-15947201 CTTGCAGTTGAGATTGAGGAAGG - Intronic
1170866460 20:20162131-20162153 CCAGCTCTGAAGATGGAGGAAGG - Intronic
1170934329 20:20796715-20796737 CCTGCAGGGTATGTGGAGGCAGG + Intergenic
1171272852 20:23829835-23829857 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
1172013510 20:31860235-31860257 CCAGCACTGGAGTTGGAGGATGG - Intronic
1172852303 20:37975371-37975393 CATGGAGTGGAGAGGGAGGAAGG + Intergenic
1173149853 20:40557656-40557678 CCGGCTTTGAAGATGGAGGAAGG - Intergenic
1173439496 20:43063414-43063436 CATGGAGTGGTGATGGAGGAAGG - Intronic
1173573664 20:44095981-44096003 CCGGCTTTGAAGATGGAGGAAGG - Intergenic
1175610526 20:60347506-60347528 ACTGCAGAGTAGATGTGGGAAGG + Intergenic
1176163407 20:63660199-63660221 CTTGCAGTCGAGATAGAGGAAGG - Intronic
1176766510 21:13024202-13024224 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1176812763 21:13561360-13561382 CTTGGAGTGGAGATGCAGGAAGG - Intergenic
1179123774 21:38573345-38573367 CTTGCAGTTGAGATAGAGGAAGG + Intronic
1179147252 21:38778929-38778951 CTGGCATTGAAGATGGAGGATGG + Intergenic
1180315546 22:11274533-11274555 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
1180339800 22:11608958-11608980 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1180431076 22:15250751-15250773 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1180491406 22:15852259-15852281 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1180513633 22:16118651-16118673 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1180606039 22:17059625-17059647 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1181536976 22:23551396-23551418 GATGAAGTGTGGATGGAGGATGG - Intergenic
1182090786 22:27593235-27593257 CCTACAGTGTGGATGTAGGAGGG + Intergenic
1182321731 22:29482211-29482233 CTTGCTGCGGAGATGGAGGAGGG - Intronic
1183453885 22:37911072-37911094 CCTGGAGTGGGGAGGGAGGAGGG + Intronic
1184191787 22:42899774-42899796 CCAGCAGTGCAGCGGGAGGAAGG + Intronic
1184323357 22:43761134-43761156 CTTGCAGAGTGGAAGGAGGAAGG - Intronic
1184473629 22:44709408-44709430 CTGGCTGTGAAGATGGAGGAAGG + Intronic
1184815716 22:46868005-46868027 CCAGCACTGTAGATGGAGACTGG + Intronic
1184851544 22:47124222-47124244 ACTGCAGGGTAAATGCAGGAAGG + Intronic
1185181696 22:49367242-49367264 CCTGCAGTGCAGGGGCAGGAAGG - Intergenic
949566717 3:5252039-5252061 CCTGCTTTGTAGATGAAGAAAGG - Intergenic
949804695 3:7942166-7942188 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
950367336 3:12496894-12496916 CCTACAGTGTAGCTGGAGGAAGG - Intronic
950484727 3:13266431-13266453 CCTGCAGTGCAGCTGGGTGACGG + Intergenic
951886705 3:27531733-27531755 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
952253781 3:31678329-31678351 CATGCTGTGTAGAGGGAAGAAGG + Intronic
952529252 3:34246290-34246312 TCTGCAGTGTGGAATGAGGACGG + Intergenic
953422600 3:42766037-42766059 GTAGCAGTGGAGATGGAGGAGGG + Intronic
953711386 3:45273893-45273915 CATGCACTGCAGATGGGGGATGG + Intergenic
953981432 3:47415089-47415111 CCTGCAGTTTAGAGGTCGGAGGG - Exonic
954267642 3:49482368-49482390 CTTGCAGTTGAGATAGAGGAAGG + Intronic
954592960 3:51799694-51799716 CCTGCAATGCAGAGGGAAGATGG + Intergenic
954986645 3:54800203-54800225 GCGGCAGTGTAGATTAAGGAGGG - Intronic
954989235 3:54825255-54825277 CCTTCTGTGTAGAAGGAAGAAGG - Intronic
955199578 3:56838594-56838616 GCTGCAGTTTAGATGTGGGAAGG + Intronic
955257128 3:57343676-57343698 CTTGCAGTTGAGATAGAGGAAGG + Intronic
956775518 3:72562230-72562252 TGTGCTGTGAAGATGGAGGAAGG + Intergenic
957038067 3:75313169-75313191 CATGAAATGTAGATGGAGGTGGG - Intergenic
957069905 3:75559461-75559483 CTTGCAGGTGAGATGGAGGAAGG + Intergenic
957490753 3:80923787-80923809 CATGCAGTGAGGGTGGAGGAAGG - Intergenic
957763332 3:84588529-84588551 CCTGCAGTGTAGTTTGAAGTTGG + Intergenic
957923881 3:86782560-86782582 GAAGCAGTGAAGATGGAGGAAGG - Intergenic
958765563 3:98363071-98363093 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
959258363 3:104043277-104043299 GCTGCAGATTGGATGGAGGATGG - Intergenic
959452273 3:106518163-106518185 ACTGCAGTGTACATTGAGTATGG - Intergenic
960809116 3:121611619-121611641 CTTGCAGTTGAGATAGAGGAAGG - Intronic
960999973 3:123367622-123367644 CCAGCCGTGTAGGTGGAGGGAGG + Intronic
961709981 3:128820652-128820674 CCTGCAGTGTGAATGGAGGAAGG - Intergenic
961816362 3:129552705-129552727 GCTGCAGGGTAGATGGCGGCTGG + Intergenic
961890128 3:130123851-130123873 CTTGCAGTTGAGATGGAGGAAGG - Intergenic
962128645 3:132649257-132649279 CTTGCAGTGGAGATACAGGAAGG + Intronic
962456618 3:135570879-135570901 CCTGCAGGGAAGATGGCAGAGGG - Intergenic
962982284 3:140501392-140501414 CCTGAAGGCTAGATGCAGGAAGG + Intronic
963216304 3:142752560-142752582 CTTGCAGTTGAGATGGAGGAAGG - Intronic
963757902 3:149255341-149255363 TCTGCAGTGTAGAGGTGGGAGGG + Intergenic
964095101 3:152922205-152922227 CTTGCTTTGTAGATGAAGGAAGG - Intergenic
964312706 3:155411590-155411612 CCTGCAGTGTTAAGGGAAGATGG - Intronic
964515268 3:157500857-157500879 CCTGCAGTGTAAATGTGGGCAGG + Intronic
966152459 3:176878810-176878832 ACTGCAGTGTAGATTGAGTATGG - Intergenic
966771889 3:183511437-183511459 CTTGCAGTTGAGATAGAGGAAGG - Intronic
967288945 3:187900712-187900734 TATGCATTGAAGATGGAGGAAGG - Intergenic
968061382 3:195728614-195728636 CTTGCAGTTGAGATAGAGGAAGG - Intronic
968373731 4:19494-19516 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
968462730 4:733379-733401 CCTGCAGTGAGGACTGAGGAGGG - Intronic
968815309 4:2818632-2818654 CCCGCAGTGGGGATGGAGGAGGG - Intronic
969000599 4:3977839-3977861 CTTGCAGTTGAGATGGAGGAAGG - Intergenic
969001523 4:3986416-3986438 CTTGCAGTTGAGATGGAGGAAGG - Intergenic
969753417 4:9130834-9130856 CTTGCAGTTGAGATGGAGGAAGG + Intergenic
969760428 4:9177314-9177336 CTTGCAGTTGAGATGGAGGAAGG - Intergenic
969801317 4:9567827-9567849 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
969812394 4:9658444-9658466 CTTGCAGTTGAGATGGAGGAAGG + Intergenic
969813319 4:9667016-9667038 CTTGCAGTTGAGATGGAGGAAGG + Intergenic
970418096 4:15879019-15879041 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
971307519 4:25496603-25496625 CCTGAGGTGAAGATGGAGAATGG + Intergenic
971720049 4:30233399-30233421 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
972247915 4:37265593-37265615 CTGGCACTGAAGATGGAGGAAGG - Intronic
972692674 4:41414992-41415014 CCTGTAGTATATATGGAGGAGGG - Intronic
972742138 4:41897372-41897394 TATGCAAAGTAGATGGAGGATGG - Intergenic
972846918 4:43002147-43002169 CTTGCAGTTGAGATAGAGGAAGG - Intronic
972916372 4:43884888-43884910 CCTGGAATGAAGATGGAGAAAGG + Intergenic
973906867 4:55540727-55540749 CGTGGAGTGGAGAGGGAGGAAGG + Intronic
974621150 4:64356338-64356360 CTTGCAGTTGAGATAGAGGAAGG + Intronic
974945907 4:68528731-68528753 CTTGCAGTCGAGATAGAGGAAGG + Intergenic
975472262 4:74783504-74783526 CCTGCAGTGTAGTTTGAAGTTGG + Intronic
977464601 4:97368029-97368051 CTTGCTTTGAAGATGGAGGAAGG - Intronic
978048939 4:104171459-104171481 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
979497217 4:121397017-121397039 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
979501589 4:121446533-121446555 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
981344079 4:143655012-143655034 CCTGGTGTGGAAATGGAGGATGG - Intronic
982518777 4:156386868-156386890 CCTGCTGTTGAGATAGAGGAAGG - Intergenic
983212770 4:164975847-164975869 CTTGCAGTTGAGATGGAGGAAGG + Intronic
984709362 4:182872260-182872282 GCTGCTTTGCAGATGGAGGAAGG - Intergenic
984933991 4:184874064-184874086 CCTGCATTTTAGAGGCAGGAAGG + Intergenic
985461004 4:190106773-190106795 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
985461654 4:190113057-190113079 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
985855531 5:2421673-2421695 CCTGCAGTGCTCATGCAGGAAGG + Intergenic
986015186 5:3751479-3751501 TCTGCAGAGTTGATGAAGGAAGG + Intergenic
986614058 5:9598739-9598761 ACTGCAGTAAAGATGGGGGATGG - Intergenic
986648857 5:9944676-9944698 GCTGCAGGGTAGAAGGAGGTGGG + Intergenic
987263598 5:16228682-16228704 CTTGCATTCTGGATGGAGGAGGG + Intergenic
987579274 5:19767985-19768007 GCTGCAGTGGAGGTGGAGGGAGG - Intronic
987619401 5:20320836-20320858 CCTGCAGTGCAGTTGGCTGAAGG - Intronic
987936058 5:24466230-24466252 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
988063013 5:26197896-26197918 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
988381271 5:30499558-30499580 GCTGCAGTCTAGCTGGGGGAGGG - Intergenic
988988116 5:36640823-36640845 GTGGCAGTGTAGATGAAGGAGGG - Intronic
990124889 5:52502630-52502652 TCTGCAGCGTAGAAGGAGGCCGG + Intergenic
990619760 5:57547129-57547151 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
991212618 5:64123482-64123504 CCTGCAGTATAACTGGATGAAGG - Intergenic
991291404 5:65036631-65036653 TTTGCAGTGGAGATGGAGGCTGG + Intergenic
991581576 5:68161171-68161193 TCTCCAGTCTAGATGGATGAAGG - Intergenic
992397847 5:76384099-76384121 CCGGCATTGCAGATGGAGGCAGG - Intergenic
992591819 5:78303440-78303462 GCTGCCCTGGAGATGGAGGAAGG - Intergenic
992655966 5:78909828-78909850 CTTGCAGTTGAGATAGAGGAAGG + Intronic
994404608 5:99328885-99328907 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
994503219 5:100606515-100606537 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
995402713 5:111759814-111759836 CCTACAGGATAGATGGAAGAGGG - Intronic
995412404 5:111873572-111873594 CTTGCTTTGAAGATGGAGGAAGG - Intronic
995417434 5:111926251-111926273 CCAACAGTGCAGTTGGAGGAGGG + Intronic
995750484 5:115448846-115448868 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
996484156 5:124011837-124011859 CCAACATTGTAGAGGGAGGATGG - Intergenic
997624811 5:135324459-135324481 CCTGCAGGGGTGAGGGAGGATGG + Intronic
997654728 5:135546383-135546405 TCTGAAGTGGAGATGGGGGAGGG + Intergenic
998004095 5:138646004-138646026 CAAGCAGTGGTGATGGAGGAGGG + Intronic
998220200 5:140271613-140271635 CCTGGAGTGTGGGTGGAGGGTGG + Intronic
998822654 5:146070671-146070693 CCTGCAGAGGAGATGGAAGTGGG - Intronic
999361630 5:150990990-150991012 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
999560646 5:152797802-152797824 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
999767544 5:154753035-154753057 CCTGCTGTGTAGAGGGTGGAGGG - Intronic
999966568 5:156816580-156816602 CCAGCTTTGAAGATGGAGGAAGG + Intergenic
1000248272 5:159468468-159468490 CCGGCCTTGAAGATGGAGGAAGG + Intergenic
1000527029 5:162370594-162370616 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1001741743 5:174058578-174058600 CCTGGAGTGGAGACGGAGGAGGG + Intronic
1002268892 5:178056533-178056555 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
1002846648 6:952063-952085 CCTGCAGTACAGATGCATGATGG + Intergenic
1002917533 6:1541346-1541368 CCTGAAGTGTGAGTGGAGGAGGG + Intergenic
1005089746 6:22043818-22043840 CATGCTGTGCTGATGGAGGAGGG + Intergenic
1005494770 6:26378741-26378763 GCTGCTTTGAAGATGGAGGAAGG - Intergenic
1006836414 6:37001668-37001690 CCTGCAGCTCAGATGGGGGAAGG + Intergenic
1006920249 6:37623185-37623207 CCTGGGGTGTAGAGGCAGGAAGG + Intergenic
1007343613 6:41209730-41209752 CCTGCAGTGAGGAAGGAGAAAGG + Intergenic
1007346688 6:41236464-41236486 CCTGCAGGGAAGAAGGAGAAAGG - Exonic
1007391863 6:41553947-41553969 CCTGCATGGAAGATGGGGGAAGG + Intronic
1007605073 6:43112122-43112144 CATACAGTGTAGATGCAGGGTGG - Intronic
1008563890 6:52748791-52748813 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
1008578468 6:52883726-52883748 CTTGCAGTTGAGATAGAGGAAGG + Intronic
1008585851 6:52948213-52948235 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
1009045902 6:58237444-58237466 CCTCCAGTGTACCTAGAGGAGGG - Intergenic
1009193324 6:60655475-60655497 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1009494735 6:64332672-64332694 CCTCCAGTGTGGATGGAGCAGGG - Intronic
1009887853 6:69645548-69645570 CCTGCTTTGAAGATGTAGGAAGG - Intergenic
1010060284 6:71614847-71614869 CCTGGAGTAGAAATGGAGGATGG - Intergenic
1010423842 6:75704593-75704615 CTTGCAGTTGAGATAGAGGAAGG - Intronic
1010839747 6:80635133-80635155 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1011764558 6:90606181-90606203 ACTTGAGGGTAGATGGAGGATGG - Intergenic
1011983129 6:93410565-93410587 ACTGCAGTGCAGAAGGAGAATGG - Exonic
1012120583 6:95361715-95361737 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
1013399902 6:109783109-109783131 CCTGCAGTGGTGAGGGTGGAAGG + Intronic
1015640612 6:135327732-135327754 CCTCCAGGGTAGAGGGGGGAAGG - Intronic
1016177314 6:141096724-141096746 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
1017969313 6:159297817-159297839 GTTGCTTTGTAGATGGAGGAAGG - Intergenic
1018060092 6:160083427-160083449 CTTGCAGGTGAGATGGAGGAAGG - Intronic
1018336100 6:162791743-162791765 ACTGCATTCTAGAAGGAGGATGG + Intronic
1018581888 6:165315085-165315107 CCGGCTTTGCAGATGGAGGAAGG - Intergenic
1018601808 6:165552130-165552152 CTTGAAGTGTAGGAGGAGGAGGG - Intronic
1018707759 6:166475441-166475463 CGTGCAGAGTAGTGGGAGGAAGG - Intronic
1020155618 7:5721643-5721665 CATGCATTGCTGATGGAGGAAGG - Intronic
1021633695 7:22670576-22670598 CCTGCCCTGTAGATGGAGACTGG + Intergenic
1022104453 7:27188266-27188288 GCTGCCGTGAAGATGGATGAGGG + Intergenic
1022477173 7:30719093-30719115 CTTGCAGTTGAGATAGAGGAAGG - Intronic
1022962852 7:35446374-35446396 CCTGCAGTGTTGAGACAGGAGGG - Intergenic
1023640430 7:42251449-42251471 CCTGCTGTGCAGCTGGAGTAGGG + Intergenic
1023920098 7:44622301-44622323 CTTGGAGTGTAGTTGGAGGTAGG + Intronic
1024636229 7:51292710-51292732 TCTGGAGTGTGGAGGGAGGAGGG - Intronic
1024676417 7:51641709-51641731 CCTGCAGTGTCTATGGGGAAGGG - Intergenic
1026736417 7:72951662-72951684 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1027107316 7:75413400-75413422 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
1027192542 7:76005404-76005426 CCTGAAGTGTGGAGGGAGAAAGG + Exonic
1027360927 7:77408909-77408931 CCTGCACTGGAGCTGGAGGTGGG + Intronic
1028577738 7:92370790-92370812 CCAGCAGTGTAGTTGGAGGTGGG + Intronic
1030009178 7:105149128-105149150 CTTGCAGTTGAGATAGAGGAAGG + Intronic
1031427309 7:121621363-121621385 CCAGCTGTGCAGAGGGAGGACGG - Intergenic
1033831917 7:145265137-145265159 CACTCAGTGTAGTTGGAGGATGG + Intergenic
1034964556 7:155383152-155383174 CCTGCAGGGTAGAGGCTGGAGGG - Intronic
1035466114 7:159079028-159079050 CCTTCAGTGTCCATGGAGGAAGG + Intronic
1035518032 8:253246-253268 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1036111821 8:5911135-5911157 CATGGAGTGGAGAGGGAGGAAGG + Intergenic
1036247134 8:7127494-7127516 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
1036253657 8:7186868-7186890 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1036264061 8:7261056-7261078 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036265357 8:7268678-7268700 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036266658 8:7276300-7276322 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036267964 8:7283922-7283944 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036269268 8:7291544-7291566 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036270543 8:7299154-7299176 CTTGTAGTTGAGATGGAGGAAGG - Intergenic
1036297325 8:7547880-7547902 CTTGCAGTTCAGATGGAGGAAGG + Intergenic
1036298628 8:7555535-7555557 CTTGCAATTCAGATGGAGGAAGG + Intergenic
1036299933 8:7563185-7563207 CTTGCAATTCAGATGGAGGAAGG + Intergenic
1036301238 8:7570831-7570853 CTTGCAGTTCAAATGGAGGAAGG + Intergenic
1036302537 8:7578480-7578502 CTTGCAGTTCAAATGGAGGAAGG + Intergenic
1036316101 8:7719595-7719617 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036317410 8:7727243-7727265 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036318718 8:7734891-7734913 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036320025 8:7742538-7742560 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036321334 8:7750186-7750208 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036322643 8:7757834-7757856 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036323949 8:7765483-7765505 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036325254 8:7773139-7773161 CTTGCAGTTCAGATGGAGGAAGG - Intergenic
1036350808 8:8011190-8011212 CTTGTAGTTGAGATGGAGGAAGG + Intergenic
1036352092 8:8018824-8018846 CTTGCAGTTCAAATGGAGGAAGG + Intergenic
1036353391 8:8026470-8026492 CTTGCAGTTCAGATGGAGGAAGG + Intergenic
1036363835 8:8100612-8100634 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
1036375710 8:8197670-8197692 CTTGCAGTTGAGATGGAGGAAGG + Intergenic
1036493113 8:9246014-9246036 CTGGCTGTGAAGATGGAGGAAGG - Intergenic
1036846082 8:12171618-12171640 CTTGCAGTTGACATGGAGGAAGG + Intergenic
1036852908 8:12216973-12216995 CTTGTAGTTGAGATGGAGGAAGG - Intergenic
1036853820 8:12225474-12225496 CTTGCAGTTGAGATGGAGGAAGG - Intergenic
1036867447 8:12413937-12413959 CTTGCAGTTGACATGGAGGAAGG + Intergenic
1036874281 8:12459495-12459517 CTTGTAGTTGAGATGGAGGAAGG - Intergenic
1036875195 8:12467984-12468006 CTTGCAGTTGAGATGGAGGAAGG - Intergenic
1036887120 8:12566470-12566492 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1036894715 8:12624568-12624590 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1038892754 8:31745201-31745223 CCTGCTGAGTAGCTGGTGGAAGG + Intronic
1039674577 8:39647504-39647526 CTTGCAGTTGAGATAGAGGAAGG - Intronic
1040112213 8:43571604-43571626 CCTTCAGGGTAGATTGAGGCAGG - Intergenic
1040316638 8:46264545-46264567 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
1040339157 8:46431491-46431513 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
1040340927 8:46440431-46440453 CTTGCAGTGGAGATAGAGGAAGG - Intergenic
1040343216 8:46456021-46456043 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
1041006822 8:53503638-53503660 CCTGCATTCCAGATGGAGGGTGG - Intergenic
1041167780 8:55107446-55107468 GCTGCAGTTTAGATGGATTAGGG + Intronic
1042204375 8:66313567-66313589 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
1042216717 8:66435447-66435469 CCAGCTGTGAAGATGGAGGAAGG - Intronic
1043150434 8:76707822-76707844 CTTGCAGTGTAGCTGGAAGTTGG - Exonic
1043510695 8:80947399-80947421 GCTGCTTTGCAGATGGAGGAAGG - Intergenic
1044162329 8:88935313-88935335 ACTGCAGTGTAGATTGAGTACGG + Intergenic
1044859680 8:96510657-96510679 CCTACAATGGAGTTGGAGGAGGG + Intronic
1044892813 8:96855316-96855338 CCTGTTGTCTAGATGCAGGAAGG - Intronic
1047343915 8:124009209-124009231 GCTGGAGTGCAGAAGGAGGATGG - Intronic
1047370807 8:124254256-124254278 GCTGGAGTGAAGATGGAAGACGG + Intergenic
1048906739 8:139096198-139096220 CCTGCACTGTATTTGGAGCAAGG + Intergenic
1049297503 8:141850515-141850537 CCTGCAGTGTAGACTAGGGAGGG + Intergenic
1049506278 8:143001245-143001267 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1049697972 8:143992977-143992999 TCTGCAGTGTACATACAGGAGGG - Exonic
1049867739 8:144949918-144949940 CTTGCAGTTGAGATAGAGGAAGG + Intronic
1049876077 8:145021759-145021781 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
1049876756 8:145028339-145028361 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
1050073474 9:1840350-1840372 CGTGCAGAGGAAATGGAGGAAGG + Intergenic
1052469883 9:28880683-28880705 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1053467109 9:38316632-38316654 CCTGCAATGTGGCTGCAGGAAGG + Intergenic
1053708603 9:40782006-40782028 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
1054418514 9:64902801-64902823 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
1055540876 9:77303938-77303960 CTTGCAGTTGAGATAGAGGAAGG - Intronic
1055766066 9:79664741-79664763 GCTGAAGTCTAGAAGGAGGATGG - Intronic
1058082450 9:100714286-100714308 GCTGCACAGTAGATGGAGGGTGG - Intergenic
1059466120 9:114469909-114469931 CCAGCCTTGAAGATGGAGGATGG - Intronic
1059801544 9:117754123-117754145 CCTGCAGTCTAGTGGGAAGACGG - Intergenic
1059973622 9:119693007-119693029 GCTGCAGTGAAGATGGAGGTGGG + Intergenic
1060293115 9:122322693-122322715 TCTTCTGTGTAGATGGGGGAGGG - Exonic
1060344243 9:122802841-122802863 CATGCAGTGTGGATGAGGGAGGG + Intronic
1061025149 9:128043644-128043666 CCAGCAGAGTGGGTGGAGGAAGG - Intergenic
1061244844 9:129396243-129396265 GATGAAGTGTGGATGGAGGACGG + Intergenic
1061384401 9:130279995-130280017 GCTGCTTTGAAGATGGAGGAAGG + Intergenic
1062367530 9:136218382-136218404 CCTGGAGAGTAGATGGAGGAGGG - Intronic
1062681711 9:137785470-137785492 CCAGCAGTGGACATGGAGAATGG - Intronic
1203363829 Un_KI270442v1:240455-240477 CTTGCAGTTGAGATAGAGGAAGG - Intergenic
1186206772 X:7208920-7208942 CCAGCCTTGAAGATGGAGGAAGG - Intergenic
1186300917 X:8199000-8199022 TCTGCAGTCCAGATGAAGGAAGG + Intergenic
1187058907 X:15767113-15767135 CATGCAGAGTAAATGGATGAGGG - Intronic
1187887962 X:23907279-23907301 CCTGATGTGTGGATGGGGGAGGG - Intronic
1189973378 X:46439821-46439843 CCAGCATTGAAGGTGGAGGAGGG + Intergenic
1190246792 X:48696289-48696311 CCAGCAGTGTGGATGGGGGCCGG + Intronic
1191809836 X:65175015-65175037 CCTTCAGTGTAGGTGCATGAGGG + Intergenic
1192207762 X:69107454-69107476 GCTGCTGAGTAGGTGGAGGAGGG + Intergenic
1196265882 X:113646091-113646113 CCTACTGTGGAGGTGGAGGAGGG + Intergenic
1197509553 X:127354413-127354435 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1198333100 X:135640422-135640444 CCTGAAGAGAAGATGGAAGATGG - Intergenic
1198823401 X:140673570-140673592 CCTGCATAGTAGATGGAACACGG - Intergenic
1199666016 X:150097130-150097152 CTTGCCTTGAAGATGGAGGAAGG - Intergenic
1200076941 X:153555960-153555982 CCTGCAGATCTGATGGAGGAAGG + Intronic
1200245445 X:154521648-154521670 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1201074486 Y:10176382-10176404 CTTGCAGTTGAGATAGAGGAAGG + Intergenic
1201578643 Y:15488065-15488087 CCAGCTTTGAAGATGGAGGAAGG - Intergenic
1202036998 Y:20646009-20646031 CCTGCAGTGTGGGTGGGGGTGGG + Intergenic