ID: 922766829

View in Genome Browser
Species Human (GRCh38)
Location 1:228160356-228160378
Sequence AGAGGGGTGTGCAGCCCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 418
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 380}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922766829_922766837 13 Left 922766829 1:228160356-228160378 CCTCCTGGGCTGCACACCCCTCT 0: 1
1: 0
2: 2
3: 35
4: 380
Right 922766837 1:228160392-228160414 CTCAGCCAAGACTCAAGCCCAGG 0: 1
1: 1
2: 2
3: 67
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922766829 Original CRISPR AGAGGGGTGTGCAGCCCAGG AGG (reversed) Intergenic
900213527 1:1468758-1468780 AGAGGGGTGGGCTTCACAGGAGG + Exonic
900221089 1:1509574-1509596 AGAGGGGTGGGCTGCACAGGAGG + Intergenic
900289178 1:1916632-1916654 AGTGGGGTGGGCAGCCTCGGGGG + Intronic
900293955 1:1939365-1939387 AGAGGGATCTGGAGCGCAGGAGG + Intronic
900307990 1:2020169-2020191 AGAGGGGGCTCCAGCCCCGGGGG - Intronic
900402167 1:2477035-2477057 AGTGGTGCTTGCAGCCCAGGCGG + Intronic
900435182 1:2627842-2627864 AGAGGGCTCTGCCGCCCTGGAGG + Intronic
900522568 1:3112822-3112844 AAAGGGGTGGGCAGCCCCGAGGG + Intronic
900750833 1:4396249-4396271 AGAGGAGTGTGGAGCTCAGGAGG + Intergenic
900951494 1:5860477-5860499 GGATGGGTGGGCTGCCCAGGTGG + Intergenic
901633021 1:10657022-10657044 AGACAGGTGGGCAGCCGAGGGGG - Intronic
901760923 1:11470987-11471009 AAAGGGGCGTGCAGAGCAGGTGG - Intergenic
901825516 1:11858676-11858698 AGAGCGGAGGGCAGCTCAGGGGG - Intronic
901847590 1:11993644-11993666 AGAATGGTGTGAACCCCAGGGGG + Intronic
902466530 1:16621975-16621997 GGAGCAGTGGGCAGCCCAGGAGG - Intergenic
903138718 1:21326055-21326077 AGTGGGGTGTGGGGACCAGGGGG + Intronic
903995628 1:27303810-27303832 AGAGGAGGGTGCAGCCCAGTTGG + Intronic
904748459 1:32725709-32725731 ATGTGGGTATGCAGCCCAGGAGG - Intergenic
904984629 1:34534793-34534815 AGAAGGGTGTGAATTCCAGGAGG - Intergenic
905150430 1:35922752-35922774 TGAGGGCAGTCCAGCCCAGGTGG - Exonic
905337185 1:37253111-37253133 AGAAGGGTGCTCAGCCTAGGAGG - Intergenic
905657196 1:39692386-39692408 AGACGCCAGTGCAGCCCAGGCGG - Intronic
905807564 1:40887965-40887987 AGAGGGGTGAGAAGACCAGAAGG - Intergenic
906136842 1:43506010-43506032 AGAGGAGTGTGCAGCCGCTGTGG - Intergenic
906730947 1:48080610-48080632 AGAGGGGTCTGCAGCCAAGCTGG + Intergenic
907679525 1:56550590-56550612 AGAGGGTTGCGAAGCCCAAGGGG + Intronic
907877356 1:58504471-58504493 AGAGGGGTGGGCAGCAGAGAAGG - Intronic
909775871 1:79484019-79484041 AGATGGCAGTGCAGACCAGGAGG + Intergenic
911148694 1:94576443-94576465 AGAGTGGAGTGAACCCCAGGGGG - Intergenic
911413937 1:97546879-97546901 AGAGGGGGATGAAGACCAGGAGG + Intronic
912474928 1:109929137-109929159 AGAGGAGGGTGCAGCCCCTGAGG - Exonic
912576372 1:110675349-110675371 CTAGGGGTGTGGAGGCCAGGGGG - Intergenic
913129841 1:115829257-115829279 AGATGGGTGTGCGACCCCGGAGG + Intergenic
913211982 1:116589674-116589696 GGAAGGGTATGGAGCCCAGGGGG - Intronic
913326808 1:117634926-117634948 AGAGGGCAGTGAAGCCCACGTGG - Intergenic
915434493 1:155893630-155893652 AGAGGAGTGTGCAGGTGAGGGGG - Intergenic
915519309 1:156432144-156432166 AGAGGGGGTTGTAGCCCTGGAGG + Intergenic
917928120 1:179805846-179805868 AGAGAGGGGTCCAGCCCAGCAGG - Intronic
918052555 1:180987196-180987218 TGTGGGGTGTGTAGACCAGGAGG - Intronic
920376317 1:205510285-205510307 TGCGGGGTGACCAGCCCAGGAGG + Intronic
921584741 1:216933874-216933896 AGATGGGGGAGCAGACCAGGAGG - Intronic
922766829 1:228160356-228160378 AGAGGGGTGTGCAGCCCAGGAGG - Intergenic
923359680 1:233198713-233198735 AGAGGGGAGGCCAGGCCAGGAGG + Intronic
1062947826 10:1474473-1474495 GGAGGGGGATGCATCCCAGGAGG + Intronic
1064384326 10:14877909-14877931 GGAGGGGGGTGGAGACCAGGTGG + Intergenic
1064424925 10:15222153-15222175 AGAGAGGTGAGCTGCACAGGAGG - Intronic
1065666742 10:28071285-28071307 AGTAGGGTGGGCATCCCAGGTGG + Intronic
1066449036 10:35511386-35511408 AGAGGGGTACCCAGCCCAGGTGG + Intronic
1067288331 10:44923706-44923728 AGAGGTGTGGGCTGGCCAGGAGG - Intronic
1069523908 10:69150484-69150506 AGAATGGTGTGAAACCCAGGAGG - Intronic
1070038837 10:72754738-72754760 ACAGGCATGAGCAGCCCAGGAGG + Intronic
1070626574 10:78055138-78055160 AGAGAGATGTGGAGCCCTGGAGG - Exonic
1070668553 10:78362347-78362369 GGAGGTGTGGGCTGCCCAGGTGG - Intergenic
1070810319 10:79294348-79294370 AGCTGGCTGTGCAGCCCAAGAGG - Intronic
1071040870 10:81308047-81308069 AGAATGGTGTGAACCCCAGGGGG - Intergenic
1073293315 10:102424007-102424029 AGAGGGGCCTGCAGCCTGGGAGG - Exonic
1075377915 10:121994472-121994494 AGAAGGCTCTGCAGCCCAGAGGG - Intronic
1075399602 10:122151501-122151523 AGCAGGGTGAGCAGCCAAGGTGG + Intronic
1075431343 10:122384517-122384539 AGAATGGTGTGAACCCCAGGGGG + Intronic
1075844421 10:125534095-125534117 AGAAGGGTCTGCAGGCCAGCTGG - Intergenic
1076047030 10:127302303-127302325 AGAGTCGTGTGCAGACCAGGTGG + Intronic
1076446218 10:130516078-130516100 ACAGGGGTTTGCAGGACAGGAGG - Intergenic
1076510927 10:131013053-131013075 AGAGGGCTGAGGAGCCCAGCAGG - Intergenic
1076645950 10:131954456-131954478 ACAGGGGTATGCAGCCAAGTTGG - Intronic
1076672382 10:132130476-132130498 AGAGGAGTCTGCACCTCAGGGGG - Intronic
1077145014 11:1040836-1040858 AGAGGGGTCTGCAGGGCTGGTGG - Intergenic
1077439431 11:2561111-2561133 AGAATGGTGTGAACCCCAGGGGG + Intronic
1077521528 11:3038313-3038335 AGAGAAGTGTGCAACCCAAGTGG + Intronic
1077533352 11:3107510-3107532 CGAGGGGTGGGCAGCCCAGAGGG - Intronic
1077533884 11:3109898-3109920 AGAGGTGTCTGCAGCCCCTGTGG - Intronic
1077697436 11:4406922-4406944 AGAGGGGGGTGGAGCCAAGATGG - Intergenic
1078265727 11:9755262-9755284 ACAGGCGTGTGCAGCACAGCCGG + Intergenic
1078521751 11:12069212-12069234 GGAGGGGTGTTCCTCCCAGGAGG + Intergenic
1081675572 11:44967103-44967125 ACAGGGGTCTGGAGCCCTGGAGG + Intergenic
1082096898 11:48138259-48138281 AGATGGGTGTCTAGACCAGGTGG - Intronic
1083265882 11:61546654-61546676 AGCGGGCTGTCCAGGCCAGGAGG + Intronic
1083854452 11:65385882-65385904 AGAATGGTGTGAACCCCAGGGGG - Intergenic
1084569800 11:69952365-69952387 AGTGAGGTCTGCAGCCCAGCAGG + Intergenic
1084709884 11:70837327-70837349 AGAGGTGTGTCCAGGCCAGTGGG - Intronic
1085016850 11:73179307-73179329 TGGGGGGTAGGCAGCCCAGGTGG - Intergenic
1085397301 11:76213132-76213154 AGAGGAGCCTGCAGCCCAGGTGG - Intergenic
1085403213 11:76246712-76246734 TGGGGGGTGGGAAGCCCAGGTGG + Intergenic
1086161300 11:83724961-83724983 GGAGGTGTGTGCTGGCCAGGCGG - Intronic
1087717496 11:101625383-101625405 AGAGGGATGTGCTCCCCAAGTGG - Intronic
1088812254 11:113399739-113399761 GCAGGGGTGTCCAGCCCTGGTGG - Exonic
1089117591 11:116108789-116108811 ACAGGGTGGTGCAGCCCATGGGG - Intergenic
1089649589 11:119904047-119904069 AAGGCGGTGTCCAGCCCAGGTGG - Intergenic
1091976186 12:4827460-4827482 GCAGGGGAGTGCAGCCCAGCAGG + Intronic
1093994404 12:25625863-25625885 AGGGCTGTGTACAGCCCAGGTGG - Intronic
1094675240 12:32613294-32613316 AGAGGGGTGTTCAGTACAAGGGG + Intronic
1095944619 12:47746804-47746826 GGAGGGGCCTGCAGTCCAGGAGG + Intronic
1096080321 12:48828412-48828434 AGATGGGTGTGCCACCCTGGGGG - Exonic
1096372902 12:51083490-51083512 AGGGCGGTGGGCAGCCCAGCCGG + Exonic
1096648951 12:53052676-53052698 GGAGGGCTGGCCAGCCCAGGCGG + Intronic
1096868218 12:54577716-54577738 AGAAGGGTGCCCAGCCAAGGGGG - Intronic
1097194183 12:57234829-57234851 AGAGGAGGCTGCAGCCCCGGGGG - Exonic
1101029134 12:100642949-100642971 AGAGGGGGGTGGAGCCAAGATGG - Intergenic
1102646865 12:114409273-114409295 AAAGGGGTCTGCGGCCCAGCTGG - Intergenic
1103312772 12:120025137-120025159 AGAATGGTGTGAACCCCAGGGGG - Intronic
1103462941 12:121119511-121119533 TGAGGGGTCTGCAGGTCAGGAGG - Intergenic
1103709512 12:122901305-122901327 AGAATGGTGTGAACCCCAGGGGG - Intergenic
1105215228 13:18280300-18280322 GGAAGGGTATGGAGCCCAGGGGG - Intergenic
1105250964 13:18698142-18698164 GTAGGGGGGTGCAGCCCAGGGGG - Intergenic
1106189826 13:27441872-27441894 AGTGGGTTGTACAGCCCAGTGGG - Intronic
1106469680 13:30043299-30043321 AGAAGGGTGTGAATGCCAGGAGG - Intergenic
1107049807 13:36035001-36035023 AGAGGGGGTTGCAGCAAAGGAGG - Intronic
1107811880 13:44208340-44208362 AGAAGGGTGTGCATGCCAAGAGG + Intergenic
1107895302 13:44956052-44956074 AGAATGGTGTGAACCCCAGGGGG + Intronic
1108287439 13:48922563-48922585 ATAGGGGTGGGCAAGCCAGGAGG - Intergenic
1109729557 13:66394005-66394027 AGAGGGTTGTGAAGCTGAGGAGG + Intronic
1115748447 14:36462432-36462454 AGAGGTGTGTGCACGCCAGGAGG + Intergenic
1116927060 14:50650485-50650507 ACAAGGGTGTGAATCCCAGGAGG - Intronic
1117124701 14:52609790-52609812 AGATGGGTGTGCCTCCCAGCAGG + Intronic
1118004676 14:61554616-61554638 AGAGTAGTGGGCAGCCCTGGGGG + Intronic
1118040163 14:61907780-61907802 AGAAGGGTGTGAGCCCCAGGGGG + Intergenic
1119779765 14:77270248-77270270 TGGGGGGTGTGCAGGCCGGGTGG - Intronic
1121234619 14:92383283-92383305 AGAGGGGTGTGCAGGAGGGGAGG - Intronic
1121289259 14:92761120-92761142 AGAGGGGTCTGCAGAAAAGGAGG - Intergenic
1122104482 14:99441761-99441783 AGAGGGCTGGGCTGCCCAGATGG - Intronic
1122745032 14:103892433-103892455 GGAGAGGCGTGCAGCCCAGCAGG - Intergenic
1122768722 14:104087565-104087587 AGAGGAGTGGGGAGCCCAGCAGG + Intronic
1122931733 14:104936233-104936255 CTAGGTGAGTGCAGCCCAGGGGG - Exonic
1122941518 14:104983496-104983518 GGAGGTGGGGGCAGCCCAGGTGG - Intergenic
1123830288 15:24129033-24129055 AGAATGGTGTGAACCCCAGGGGG + Intergenic
1124270297 15:28274495-28274517 TGAGGGGTGGGAAGCCCAGCGGG - Intronic
1126137122 15:45402949-45402971 CGAGGGGTGACCAGCCCAGCGGG - Exonic
1126193548 15:45904781-45904803 AGAGTGGCGTGAACCCCAGGGGG - Intergenic
1126222654 15:46232285-46232307 AGAGTGGTCTGCAGACCAGTTGG + Intergenic
1126425895 15:48526846-48526868 AGAGGGACTTGCTGCCCAGGAGG + Intronic
1128326921 15:66729823-66729845 AGAGTGGTGTGCATCAAAGGCGG + Intronic
1128770053 15:70275322-70275344 AGAAAGGTTTGCAGCCCTGGAGG + Intergenic
1129154103 15:73707016-73707038 AGAGAGGTGTGCAGAAAAGGAGG - Intronic
1129277700 15:74457961-74457983 AGTGGCGTGGGCAGTCCAGGTGG - Intronic
1130048669 15:80465413-80465435 AGAGGGGTGTGGACCTCAGGAGG + Intronic
1130109003 15:80949688-80949710 TGAGGGGTCTGCAGTCCAGTAGG + Exonic
1130910547 15:88267806-88267828 AGAGAGGTGTGTGGTCCAGGAGG - Intergenic
1131511249 15:93050735-93050757 AGAGGGATGTGGACCCCAGGTGG - Intronic
1132478658 16:154642-154664 AGAGGGATGTGCAGCTCCCGGGG + Intronic
1132496013 16:263841-263863 AGACGGGGCTGCGGCCCAGGAGG + Intronic
1132641575 16:980782-980804 GGCGGGGTGTGCCGCCCTGGTGG - Intronic
1132659279 16:1054317-1054339 AGGAGGGTGTGCAGGCCAGGAGG - Intergenic
1132659284 16:1054334-1054356 AGGAGGGTGTGCAGGCCAGGAGG - Intergenic
1132659289 16:1054351-1054373 AGGAGGGTGTGCAGGCCAGGAGG - Intergenic
1132743216 16:1426221-1426243 ATCCTGGTGTGCAGCCCAGGGGG + Intergenic
1132841785 16:1981568-1981590 AGAGAGGTGGGCAGGACAGGTGG - Exonic
1133019950 16:2963010-2963032 GGAGGGGCGTGGAGCCGAGGTGG - Intergenic
1133228283 16:4353742-4353764 AGAGGAATGTGGAGGCCAGGAGG - Intronic
1133271567 16:4613193-4613215 TGAGGGCTGTGGAGACCAGGAGG + Intronic
1133406149 16:5526111-5526133 AGAGGCCTGAGCAGCCAAGGAGG - Intergenic
1133818079 16:9213345-9213367 AGAGGGATGTGCAGAGCTGGAGG - Intergenic
1133972886 16:10580109-10580131 AGAGGGGTACGCAGCCCAGGAGG + Intronic
1134700835 16:16263835-16263857 AGTGGGCTGTGCAGACAAGGTGG - Intronic
1134970990 16:18530824-18530846 AGTGGGCTGTGCAGACAAGGTGG + Intronic
1135741407 16:24978417-24978439 AGGGGGCTGTGCATCCCAGCGGG - Intronic
1136091076 16:27920476-27920498 AGAGGGCTGTGCAGCCATGGTGG - Intronic
1137877791 16:52013743-52013765 ACAGGGGGGTGGAGCCCAGATGG - Intronic
1138556291 16:57772897-57772919 AAGGGGGTGTGCACCCCATGAGG + Intronic
1139163092 16:64534956-64534978 AGAGGAGTGAGCAGCAAAGGGGG - Intergenic
1139452674 16:67043176-67043198 ACAGGGGTGTGAATACCAGGAGG + Intronic
1139647049 16:68338918-68338940 AGAGGGCTGGGCAGCTGAGGGGG + Intronic
1139997619 16:70995737-70995759 GGAGGGGTGGGCAGCCCTGCAGG + Intronic
1140171955 16:72614730-72614752 ATATGGGTGAGCAGACCAGGAGG - Intergenic
1142136452 16:88453877-88453899 ACCGGGGGGTTCAGCCCAGGAGG + Intronic
1143264180 17:5623415-5623437 CCAGGGGAGTGCAGCCCAGGGGG + Intergenic
1143370274 17:6435118-6435140 AGGGAGGTGTCCAGCACAGGCGG + Exonic
1143745611 17:8991955-8991977 AGAGGGGTGTACGGCCCAGTGGG + Intergenic
1143832757 17:9665445-9665467 AGAGGAGTGAGCAGCAAAGGGGG + Intronic
1144004611 17:11088781-11088803 AGAGGGTTGTGGGGCCGAGGGGG - Intergenic
1144065678 17:11622131-11622153 AGAGGGGTCTCTAGCCCAGTAGG + Intronic
1144166280 17:12614022-12614044 AGAGGAGTGGGTAGCCCAGGTGG - Intergenic
1147339937 17:39747175-39747197 AGAAGTGGGGGCAGCCCAGGCGG + Exonic
1148158532 17:45436986-45437008 AGAGGGGTGAGGAGCGCACGGGG + Exonic
1148454559 17:47804082-47804104 GGAGGGGTGTTCAGGGCAGGAGG - Intergenic
1150247611 17:63688269-63688291 AGAGGGCTGTGCAGCCAGGCTGG + Intronic
1151202014 17:72475667-72475689 GGAGGGTTGAGCAACCCAGGAGG - Intergenic
1151508857 17:74546147-74546169 AGAGGGTGGAGCAGCCCATGTGG - Intergenic
1151523209 17:74645898-74645920 AGAATGGTGTGAACCCCAGGGGG + Intergenic
1151727501 17:75893276-75893298 AGAGGGGTCAGTGGCCCAGGAGG + Intronic
1152279018 17:79374311-79374333 AGAGGGGTTTCCAGGCGAGGGGG + Intronic
1152612724 17:81323515-81323537 AGGAGGGTTTGGAGCCCAGGTGG + Intronic
1153522181 18:5963514-5963536 AGAGGAGTGTGAAGCCGAGGAGG - Intronic
1153525483 18:5991079-5991101 AGAGGGGTGGGCATTCCAGGAGG - Intronic
1155166643 18:23237422-23237444 AGTGGTGTTTGCAGGCCAGGTGG - Intronic
1155195367 18:23469236-23469258 ACAGGGGTGTGCACACCAAGGGG + Intronic
1157153677 18:45244134-45244156 AGATTGGTGGGCTGCCCAGGGGG - Intronic
1157280032 18:46340925-46340947 AGAGGAGAGAGCACCCCAGGTGG + Intronic
1157405947 18:47423001-47423023 AGAGGAGGGTGCAGACCAAGGGG + Intergenic
1157572704 18:48723575-48723597 GGAGTGGTGGGCAGCTCAGGGGG + Intronic
1157681897 18:49613902-49613924 TGAGGCGTGTGCAGCCCAGCGGG + Intergenic
1158418772 18:57274000-57274022 AGAGGGGAGTGCTACCCAGAGGG + Intergenic
1158865363 18:61633020-61633042 AAAGGGATGTGCAGCACTGGGGG - Intergenic
1158874908 18:61724091-61724113 AGAAGGGTGTGAAGACCAAGCGG - Intergenic
1159143186 18:64421898-64421920 GGAGGGCTGTGCACTCCAGGGGG - Intergenic
1159675955 18:71284605-71284627 AGTTGGGAATGCAGCCCAGGTGG - Intergenic
1160026117 18:75217924-75217946 AAAGAGGTGTGCTACCCAGGGGG + Intronic
1160187382 18:76686146-76686168 AGAGGCCTGTGCAGCACTGGTGG - Intergenic
1160375077 18:78405626-78405648 AGTGGGAAGTGCAGCCAAGGGGG + Intergenic
1160688684 19:450091-450113 AGGGGTGTGTGCTGCCCTGGGGG + Intronic
1161652986 19:5496621-5496643 TGGGGGATGTACAGCCCAGGGGG - Intergenic
1162217324 19:9147427-9147449 AGAATGGTGTGAAACCCAGGAGG - Intronic
1162362130 19:10226861-10226883 GAAGGGGTGTGCAGCCCCGCCGG + Intronic
1162647077 19:12057629-12057651 GGAGGGATGTGCAGCCCAGGAGG + Intergenic
1163163479 19:15479656-15479678 AGAGGGGCCTGGAGACCAGGTGG + Exonic
1163209489 19:15830067-15830089 AGAGGGGTCTGCAGAAAAGGGGG - Intergenic
1163313098 19:16525629-16525651 AGTGGGGTGGGCCGCCCTGGTGG + Exonic
1163822939 19:19506479-19506501 ACAGGTGTGTGCAGGTCAGGAGG + Exonic
1164297559 19:23926522-23926544 AGGCTGGAGTGCAGCCCAGGTGG - Intronic
1164762148 19:30736207-30736229 AGAGGGGTGAGCAGGTCAAGGGG - Intergenic
1165063097 19:33214383-33214405 AGAGGTGGGTGCAGCGGAGGTGG - Intronic
1165092630 19:33394921-33394943 CAAGGGGTGTGCAGCGGAGGAGG - Intronic
1166370398 19:42297161-42297183 AAACAGGTGTGTAGCCCAGGCGG + Exonic
1166693019 19:44835445-44835467 AGAGAGGTTTGGGGCCCAGGTGG + Intergenic
1167096584 19:47377811-47377833 AGAGGAGGGTGCTGCCCCGGTGG + Intronic
1167284500 19:48591521-48591543 AGAGGGGTCTCCAGGGCAGGAGG + Intronic
1167391809 19:49200318-49200340 AGAGGACAGTGCGGCCCAGGTGG - Exonic
1168110444 19:54189089-54189111 AGAGGGGTGTGGAGCTCCGAAGG - Intronic
1168346597 19:55652937-55652959 ACAGGGCTGGGCAGCCCAAGCGG - Exonic
925296551 2:2781008-2781030 TGCAGGGTGTGAAGCCCAGGAGG - Intergenic
925306641 2:2851494-2851516 AGAGGAGGGTGAAACCCAGGAGG - Intergenic
926144238 2:10386981-10387003 AGCGGGGCTTGCAGGCCAGGTGG + Intronic
927847392 2:26478589-26478611 AGAGGGGTGGGCAGAGGAGGAGG + Intronic
928406150 2:31016551-31016573 AGATGGGTGTGCAGGCCCAGTGG - Intronic
928440723 2:31289757-31289779 AAAGGAGTATGCAGACCAGGAGG - Intergenic
928501043 2:31895930-31895952 AGAGTGGTGTGAACCCCGGGGGG - Intronic
931055225 2:58461842-58461864 AGAGGTAGGTGCAGCCCTGGGGG + Intergenic
932411203 2:71549091-71549113 AGAGTGATGGGCAGGCCAGGTGG + Intronic
933839723 2:86276619-86276641 AGATTGGTGTGCAGTCCTGGAGG + Intronic
934299092 2:91766437-91766459 GGAAGGGTATGGAGCCCAGGGGG + Intergenic
934550897 2:95260937-95260959 AGGGCGGCCTGCAGCCCAGGTGG + Intergenic
934950718 2:98573551-98573573 AGAGGGATGGTGAGCCCAGGAGG + Intronic
936373521 2:111922159-111922181 AGAGGGTTGAGCAGGGCAGGTGG - Intronic
936407022 2:112214033-112214055 AGAATGGTGTGAACCCCAGGGGG - Exonic
937078322 2:119123326-119123348 AGAGGGCTGAGCAGCCTGGGTGG + Intergenic
937378796 2:121356906-121356928 AGAGGGGCTGGGAGCCCAGGAGG + Intronic
937839608 2:126512157-126512179 ACAGGGGTTCCCAGCCCAGGCGG + Intergenic
937979572 2:127607128-127607150 AGAGAGGGGTGCTCCCCAGGAGG - Intronic
938124633 2:128663118-128663140 AGAGAGATGTGCATTCCAGGCGG + Intergenic
938413699 2:131086974-131086996 AGAATGGTGTGAACCCCAGGGGG + Intronic
940907389 2:159181383-159181405 AGAATGGTGTGAACCCCAGGGGG - Intronic
941096394 2:161243326-161243348 AGATGGCTGTGCAGCTCAGAAGG + Intergenic
946123359 2:217536630-217536652 AGCTGGGTGTGCACACCAGGGGG + Intronic
946400562 2:219466273-219466295 ACATGGCTGTGCAGGCCAGGAGG + Intronic
947501544 2:230674792-230674814 AGAGGGGTCTTCAGCCCCAGTGG + Intergenic
947820034 2:233063122-233063144 TGAGGGGTGTGCAGGGCAGCCGG + Intronic
948354666 2:237368577-237368599 GGAGGGGTGTCCACCCCTGGAGG + Exonic
1168803693 20:660742-660764 AGAGGGGTGTGAAGGGAAGGCGG + Intronic
1170082291 20:12490423-12490445 ACAAGGGTGTGAAGACCAGGAGG - Intergenic
1170198039 20:13711247-13711269 AGAGGGGTATACATACCAGGAGG - Intergenic
1170728228 20:18948634-18948656 AGTGGGGTCTGCAGTGCAGGTGG + Intergenic
1170801806 20:19596606-19596628 AGAGGGTTGGGCGGCTCAGGAGG - Intronic
1170847874 20:19977191-19977213 AGAGGGGGGTGCAGCCAGGCAGG + Intronic
1171180538 20:23087745-23087767 AGAGGGCAGTGCACCCCACGGGG + Intergenic
1171276101 20:23857735-23857757 AGAGAGACGTGCAGGCCAGGAGG + Intergenic
1171410488 20:24943725-24943747 AGAACAGTATGCAGCCCAGGAGG - Intergenic
1172776966 20:37413524-37413546 TGATGGGTGTGGGGCCCAGGAGG - Intergenic
1173833826 20:46112213-46112235 ATAAGGGTGTGAAGACCAGGAGG + Intergenic
1175045970 20:56106075-56106097 AGGGTGGTGTCCAGGCCAGGAGG + Intergenic
1175339429 20:58218761-58218783 GCAGGGGTGTCCTGCCCAGGGGG + Exonic
1175372076 20:58498950-58498972 AAAGGGTTCTGCAGCCAAGGGGG - Intronic
1175782000 20:61688830-61688852 ACAGGAGTGTGCAACCCAGCAGG + Intronic
1175904467 20:62372640-62372662 TGAGGGGTTCTCAGCCCAGGAGG - Intergenic
1175922500 20:62456745-62456767 AGAAGGGTGTGCAGCCTGTGCGG + Intergenic
1175947513 20:62565714-62565736 AAGGGGGTCTGCAGGCCAGGTGG + Intronic
1176135148 20:63519304-63519326 GGAGAGGTGTGCAGCCCCGAGGG - Intergenic
1176266146 20:64210389-64210411 ACAGGGGTGGCAAGCCCAGGAGG + Intronic
1179016230 21:37596206-37596228 AGTGGGGAGTGCAACCCAGATGG + Intergenic
1180799161 22:18623802-18623824 GGAGGGAAGTGCAGGCCAGGGGG - Intergenic
1180942126 22:19666344-19666366 AGAGGGGTGCCCAGCACTGGGGG - Intergenic
1181083869 22:20430359-20430381 AGAGGGGGGTCCAGCCGACGAGG - Intronic
1181222557 22:21371464-21371486 GGAGGGAAGTGCAGGCCAGGGGG + Intergenic
1181419092 22:22785607-22785629 GCAGGGGTGTGGAGGCCAGGGGG - Intronic
1182447626 22:30398627-30398649 AGAGAGGTGGGCAACTCAGGTGG - Intronic
1183370236 22:37427838-37427860 CGCGGGGTGAGCAGCGCAGGGGG - Intergenic
1183655377 22:39181475-39181497 AGAGGGGTGTGCATGGCGGGAGG + Intergenic
1184267346 22:43356120-43356142 AGAGCTGCTTGCAGCCCAGGTGG - Intergenic
1184293531 22:43510209-43510231 AGGGAGGTGTGCAGGGCAGGGGG + Intergenic
1184308812 22:43628017-43628039 AGATGGGCCTGCACCCCAGGAGG - Intronic
1184552322 22:45210933-45210955 AGAGGGGAGGGCACCCCAAGAGG - Intronic
950725159 3:14912413-14912435 AGAGGAGAGTGGACCCCAGGGGG + Intronic
951663203 3:25093738-25093760 GGAGTGGTCTGCAGTCCAGGTGG - Intergenic
953547205 3:43872377-43872399 AGAGGGGGCAGCAGCCCAGGTGG - Intergenic
953925547 3:46980639-46980661 AGATGGGTGGGGAGCTCAGGAGG - Intronic
953931811 3:47009401-47009423 CCCGGGGTGGGCAGCCCAGGGGG + Exonic
954628033 3:52033370-52033392 GGAGAGGGGTGCAGGCCAGGTGG - Intergenic
954636337 3:52072881-52072903 AGTGTGGTGTGTAGCTCAGGGGG + Intergenic
955334158 3:58071239-58071261 ATAGGGGTGTGTAGGCCAGGCGG - Intronic
955992489 3:64642870-64642892 AGAGAGGTCTGAAGGCCAGGGGG + Intronic
959514413 3:107249295-107249317 ATAGAGCTGTGCAGCCCAAGGGG - Intergenic
960534522 3:118802039-118802061 AGATGGGTGTGCAGCCAAGCAGG - Intergenic
960638904 3:119809344-119809366 AGAGGGGTGTGCGGGCCCGTGGG + Intronic
961385016 3:126518298-126518320 AGAGTGGTGTGCCCCCCAGCGGG - Intergenic
962204430 3:133423476-133423498 AGAGGGCTGTGTAGTCCATGCGG - Intronic
963678671 3:148347269-148347291 AGAGGGGGGTGGAGCCAAGATGG + Intergenic
963934461 3:151037946-151037968 AGTGGGGTGTGCACACCAGCTGG + Intergenic
964360251 3:155888517-155888539 AGAGGTGAGAGGAGCCCAGGAGG - Intronic
964624637 3:158747592-158747614 AGAGGTGAGTGCAGGCCACGGGG - Intronic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
967423041 3:189294582-189294604 AGTGGGGTGTGTATCGCAGGGGG + Intronic
968737574 4:2305198-2305220 GGAGCGGAGGGCAGCCCAGGCGG - Exonic
968762938 4:2451665-2451687 ACAGGGGTTTGCAGCCCTGGTGG - Intronic
969230698 4:5828244-5828266 AGAGGGGTGTGCACCCGTGAGGG - Intronic
969307716 4:6335382-6335404 AGAGGGGTGTGCTGGGCAGAAGG + Intronic
969449745 4:7266205-7266227 ATAGGGCTGTGCAGGCCAGCGGG + Intronic
969577808 4:8046651-8046673 AGCGGTGCCTGCAGCCCAGGAGG + Intronic
969615896 4:8252444-8252466 AGAGGGGCTTGAAGCCCTGGTGG + Intergenic
969681009 4:8643512-8643534 GGAGGCATCTGCAGCCCAGGTGG - Intergenic
969928648 4:10609381-10609403 AGACAGGAATGCAGCCCAGGTGG - Intronic
970701688 4:18748764-18748786 AGAGGAGTGTGTTGTCCAGGAGG + Intergenic
973853375 4:54985006-54985028 GGAGGCATGTGCTGCCCAGGAGG - Intergenic
974451433 4:62066918-62066940 AGAGGAGACTGCAGCCCAGAGGG - Intronic
980771057 4:137373897-137373919 AGAAGGGTTTGCAGCAGAGGAGG + Intergenic
981648676 4:147029749-147029771 AGAGGAGAGTGCAGCTCAGGTGG + Intergenic
985576377 5:675258-675280 GGCCGGGGGTGCAGCCCAGGGGG + Intronic
986417394 5:7543008-7543030 AGAGGGGTGTGCAGACTCTGTGG + Intronic
986502484 5:8415353-8415375 AGAGGGGTCTGCAGAAGAGGAGG - Intergenic
988372403 5:30388382-30388404 AGTGGGGTTGGCAGTCCAGGTGG - Intergenic
988688190 5:33546147-33546169 AGAGGAGTGTTCTGTCCAGGAGG - Exonic
989061269 5:37414277-37414299 AGAGGAGTGAGCAAGCCAGGGGG - Intronic
989505996 5:42228587-42228609 GCTGCGGTGTGCAGCCCAGGAGG - Intergenic
992085020 5:73270490-73270512 ACAGGGATGTGCAGCTCAGGAGG - Intergenic
998263807 5:140651755-140651777 AGAGGTAGGTGCAGCCCTGGGGG - Exonic
998561815 5:143179226-143179248 TGAGGAGTGTGCAGTCCAGTGGG - Intronic
999777119 5:154820354-154820376 AGAGCGGGGTGAAGCCCAGCAGG + Exonic
1000328231 5:160188168-160188190 AGAGGGGCGGGAAGCCCTGGTGG + Intronic
1001068261 5:168558247-168558269 AGAATGGTGTGAACCCCAGGGGG - Intronic
1001131024 5:169063510-169063532 AGAGGGGTGTGCCCCCGAGGCGG - Intronic
1001243445 5:170087655-170087677 AGAGGTCTGAGCAGCCCAGCAGG - Intergenic
1001575890 5:172763633-172763655 AGAGGGCTGTGCAGGCTGGGAGG + Intergenic
1002607055 5:180389736-180389758 GGACGGCTGTGCAGCCCAGGAGG + Intergenic
1004071396 6:12301107-12301129 ACAGGGGTGGGCAGCCAGGGTGG + Intergenic
1004669196 6:17779827-17779849 AGAATGGTGTGAACCCCAGGGGG - Intronic
1004928061 6:20434900-20434922 AGAGGGGTGGGGAGCCTAGAGGG + Intronic
1006284350 6:33081353-33081375 AGAAGGGTCTGCAGCCGGGGAGG + Intronic
1006424963 6:33958188-33958210 AGAGGGGGGTGGGCCCCAGGTGG + Intergenic
1006597517 6:35204150-35204172 AGAATGGTGTGAACCCCAGGAGG - Intergenic
1007210000 6:40185759-40185781 AGAAGGGGCTGGAGCCCAGGAGG + Intergenic
1007809489 6:44476061-44476083 TGAGGGGGGCGCAGCCCAGCAGG - Intergenic
1008985928 6:57543026-57543048 AGAATGGCGTGAAGCCCAGGGGG - Intronic
1010559535 6:77333056-77333078 TGCGGAGCGTGCAGCCCAGGCGG - Intergenic
1011103871 6:83757763-83757785 AGATGGGTGTGCCTCCCAGCAGG + Intergenic
1013198877 6:107871766-107871788 AGAGGGGGATGAAGACCAGGAGG - Exonic
1013545389 6:111151890-111151912 GGAGGGGTATCCAGCCCAGATGG - Intronic
1017043276 6:150324791-150324813 AGAGGTGTGGGCAGGCCAGGAGG + Intergenic
1017114829 6:150966936-150966958 ACAGGTGTCTGCAGCCCCGGGGG + Intronic
1017674320 6:156797740-156797762 AGAGGGATGTGCAGTTGAGGCGG + Intronic
1019187612 6:170229983-170230005 AGAGAGGTGTCCCGCCCAGCAGG + Intergenic
1019612953 7:1946094-1946116 GGTGGGCTCTGCAGCCCAGGAGG + Intronic
1019630230 7:2045153-2045175 AGAGGGGTGTGGAGGCCGGGTGG - Intronic
1019779585 7:2931424-2931446 ACAGAGGTGTGGAGACCAGGAGG - Intronic
1020127828 7:5542804-5542826 ACATGTCTGTGCAGCCCAGGTGG - Intronic
1021101022 7:16585922-16585944 AGAGCTGCGTGCAGCCCAGTTGG - Intergenic
1022410632 7:30136085-30136107 AGAGGTGTGTGTGGCCCGGGCGG + Intronic
1022522528 7:31017361-31017383 AAAATGGAGTGCAGCCCAGGAGG + Intergenic
1023594513 7:41814939-41814961 AGAAAGGAGGGCAGCCCAGGGGG + Intergenic
1023835630 7:44065696-44065718 AGGGGAGTGTGCAGGCCAAGAGG + Intronic
1025250178 7:57346638-57346660 AGAGGGGTGAGAAGCCCTGGAGG + Intergenic
1025850372 7:65239260-65239282 TGATGGGTGTGCACCCCATGGGG + Intergenic
1025993350 7:66512497-66512519 AGGAGGATGTGCACCCCAGGAGG - Intergenic
1027912881 7:84275472-84275494 TCAGGTGTGTGCATCCCAGGTGG - Intronic
1029519590 7:101051716-101051738 GGAGAGGTGGGGAGCCCAGGAGG + Intronic
1031959718 7:127977864-127977886 AGAGAGGTTTTCAGCCCAAGAGG + Intronic
1032225773 7:130030755-130030777 AGAATGGTGTGAACCCCAGGAGG - Intronic
1032441769 7:131947603-131947625 AGAGGGTGGGGCAGGCCAGGAGG + Intergenic
1032454623 7:132064021-132064043 GGAGGGGTCTGCAGCCCGGATGG - Intergenic
1033291052 7:140082984-140083006 AGAGGAGGGAGCAGCCCGGGTGG + Intergenic
1033854436 7:145541166-145541188 ACAGGGATGTGCAGTCCAGAGGG - Intergenic
1034333978 7:150308612-150308634 AGAGGGGTCTGCAGAAAAGGAGG - Intronic
1035564376 8:631384-631406 AGAGAGGTGTGCGGGGCAGGGGG + Intronic
1035584221 8:759506-759528 CCAGGAATGTGCAGCCCAGGAGG - Intergenic
1035748669 8:1979760-1979782 ACAGGGGTGTGTGGCCCACGCGG + Intronic
1035761622 8:2072965-2072987 ACAGGGGTGTGCAGCTGAAGGGG - Intronic
1035764084 8:2091798-2091820 TGTGGGGTGTGTGGCCCAGGTGG + Intronic
1037886900 8:22600066-22600088 AGAGGGGTCCGCAGCCACGGAGG - Intronic
1038270899 8:26074930-26074952 GGAGGTGTGTGCAGACCACGTGG + Intergenic
1038570459 8:28657868-28657890 AGGGAGGAGTGAAGCCCAGGAGG - Intronic
1038606995 8:29016944-29016966 ACGGAGGTGTGCAGACCAGGAGG + Intronic
1039856797 8:41422016-41422038 AGAATGGCGTGAAGCCCAGGGGG + Intergenic
1042858990 8:73294851-73294873 GGAGGGGTGCGCAGCGGAGGCGG - Exonic
1043338425 8:79206773-79206795 AGAATGGTGTGAACCCCAGGGGG - Intergenic
1046603135 8:116340927-116340949 GGTGGGGTGTGAGGCCCAGGTGG - Intergenic
1047028322 8:120848994-120849016 AGAAGAGAATGCAGCCCAGGAGG - Intergenic
1047151956 8:122273987-122274009 GGAGGGGTGTGCTGCGCTGGGGG - Intergenic
1047253900 8:123201355-123201377 AGCCTGATGTGCAGCCCAGGAGG + Intronic
1048357321 8:133664178-133664200 AGGGGTGTGAGCAGCCCTGGGGG - Intergenic
1048754360 8:137719655-137719677 AGGGGCGTGAGCAGCACAGGAGG + Intergenic
1048833381 8:138497087-138497109 AGAGGTGAGCGCAGCCCGGGAGG - Intergenic
1048893051 8:138964913-138964935 AGTGGCCTGAGCAGCCCAGGAGG - Intergenic
1048980526 8:139701573-139701595 ACAGGGGTGTGAAGCCCTGAGGG + Intronic
1049325883 8:142021236-142021258 AGAGGGTTGTTCAGTCCTGGGGG + Intergenic
1049358262 8:142199363-142199385 GGAAGTGTGGGCAGCCCAGGGGG - Intergenic
1049463060 8:142739005-142739027 AGAGGGGTGTGCAGACCGCAGGG - Intergenic
1049574828 8:143385177-143385199 AGAGGGCAGTGCAGCCCCTGGGG + Intergenic
1049643717 8:143726906-143726928 AGAGGGCTGTCCAGCCCTTGCGG + Exonic
1049819817 8:144626793-144626815 AGAGGGGTCTCTAGCCGAGGAGG - Intergenic
1050772151 9:9215654-9215676 AGGGGGCTGTACAACCCAGGAGG + Intronic
1052707374 9:32010333-32010355 TGTGGAGTGTGCAGCCCAGGTGG - Intergenic
1053173356 9:35906296-35906318 CGAGGGCTGTGCTCCCCAGGAGG - Exonic
1056380807 9:86055521-86055543 AGAGGCGAATGCAACCCAGGGGG + Intronic
1057214621 9:93220954-93220976 GGATGGGTGGGCAGCCCAGGAGG - Intronic
1059376730 9:113887720-113887742 AGGTGGGTGAGCGGCCCAGGCGG + Intronic
1059456220 9:114402007-114402029 GGAGGGGTGGGCAGGACAGGTGG - Intergenic
1060743076 9:126112321-126112343 ACAGGGGTGTGGATACCAGGAGG - Intergenic
1062044153 9:134417500-134417522 AGAGGAGAGTGCCGCCCAGCTGG - Intronic
1062344421 9:136108333-136108355 ACTGGGGTCTGCAGCCGAGGAGG - Intergenic
1203760962 EBV:12889-12911 AGAGGGGAGCGGAGACCAGGAGG - Intergenic
1203761891 EBV:15961-15983 AGAGGGGAGCGGAGACCAGGAGG - Intergenic
1203762820 EBV:19033-19055 AGAGGGGAGCGGAGACCAGGAGG - Intergenic
1203763749 EBV:22105-22127 AGAGGGGAGCGGAGACCAGGAGG - Intergenic
1203764678 EBV:25177-25199 AGAGGGGAGCGGAGACCAGGAGG - Intergenic
1203765607 EBV:28249-28271 AGAGGGGAGCGGAGACCAGGAGG - Intergenic
1203766536 EBV:31321-31343 AGAGGGGAGCGGAGACCAGGAGG - Intergenic
1203767465 EBV:34393-34415 AGAGGGGAGCGGAGACCAGGAGG - Intergenic
1186836708 X:13445607-13445629 ACAAGGGTGTGAATCCCAGGAGG + Intergenic
1189259874 X:39670688-39670710 GGAGGCTTGGGCAGCCCAGGTGG + Intergenic
1190451148 X:50581991-50582013 ACAGGGGTGTGAACACCAGGAGG - Intergenic
1197147027 X:123182993-123183015 AGAGGAGTCTATAGCCCAGGAGG + Intergenic
1197706856 X:129640258-129640280 AGAGGTGACTGCAGCCCTGGAGG + Intergenic
1198112487 X:133514009-133514031 ATTGTGGTGTGCAGCCAAGGTGG - Intergenic