ID: 922771402

View in Genome Browser
Species Human (GRCh38)
Location 1:228185603-228185625
Sequence AACAAAACACACCTAAAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922771402_922771405 8 Left 922771402 1:228185603-228185625 CCTTGCTTTAGGTGTGTTTTGTT No data
Right 922771405 1:228185634-228185656 CCTGGTTTAATACAGATTGCTGG No data
922771402_922771403 -10 Left 922771402 1:228185603-228185625 CCTTGCTTTAGGTGTGTTTTGTT No data
Right 922771403 1:228185616-228185638 GTGTTTTGTTTGAAGATACCTGG No data
922771402_922771406 21 Left 922771402 1:228185603-228185625 CCTTGCTTTAGGTGTGTTTTGTT No data
Right 922771406 1:228185647-228185669 AGATTGCTGGTGCGTTCACGTGG No data
922771402_922771407 30 Left 922771402 1:228185603-228185625 CCTTGCTTTAGGTGTGTTTTGTT No data
Right 922771407 1:228185656-228185678 GTGCGTTCACGTGGTGCTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922771402 Original CRISPR AACAAAACACACCTAAAGCA AGG (reversed) Intergenic