ID: 922771404

View in Genome Browser
Species Human (GRCh38)
Location 1:228185634-228185656
Sequence CCAGCAATCTGTATTAAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922771404_922771408 4 Left 922771404 1:228185634-228185656 CCTGGTTTAATACAGATTGCTGG No data
Right 922771408 1:228185661-228185683 TTCACGTGGTGCTCACGGCCTGG No data
922771404_922771410 6 Left 922771404 1:228185634-228185656 CCTGGTTTAATACAGATTGCTGG No data
Right 922771410 1:228185663-228185685 CACGTGGTGCTCACGGCCTGGGG No data
922771404_922771406 -10 Left 922771404 1:228185634-228185656 CCTGGTTTAATACAGATTGCTGG No data
Right 922771406 1:228185647-228185669 AGATTGCTGGTGCGTTCACGTGG No data
922771404_922771407 -1 Left 922771404 1:228185634-228185656 CCTGGTTTAATACAGATTGCTGG No data
Right 922771407 1:228185656-228185678 GTGCGTTCACGTGGTGCTCACGG No data
922771404_922771409 5 Left 922771404 1:228185634-228185656 CCTGGTTTAATACAGATTGCTGG No data
Right 922771409 1:228185662-228185684 TCACGTGGTGCTCACGGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922771404 Original CRISPR CCAGCAATCTGTATTAAACC AGG (reversed) Intergenic