ID: 922771405 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:228185634-228185656 |
Sequence | CCTGGTTTAATACAGATTGC TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
922771402_922771405 | 8 | Left | 922771402 | 1:228185603-228185625 | CCTTGCTTTAGGTGTGTTTTGTT | No data | ||
Right | 922771405 | 1:228185634-228185656 | CCTGGTTTAATACAGATTGCTGG | No data | ||||
922771400_922771405 | 24 | Left | 922771400 | 1:228185587-228185609 | CCTAATCAATGCATAACCTTGCT | No data | ||
Right | 922771405 | 1:228185634-228185656 | CCTGGTTTAATACAGATTGCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
922771405 | Original CRISPR | CCTGGTTTAATACAGATTGC TGG | Intergenic | ||