ID: 922771407

View in Genome Browser
Species Human (GRCh38)
Location 1:228185656-228185678
Sequence GTGCGTTCACGTGGTGCTCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922771404_922771407 -1 Left 922771404 1:228185634-228185656 CCTGGTTTAATACAGATTGCTGG No data
Right 922771407 1:228185656-228185678 GTGCGTTCACGTGGTGCTCACGG No data
922771402_922771407 30 Left 922771402 1:228185603-228185625 CCTTGCTTTAGGTGTGTTTTGTT No data
Right 922771407 1:228185656-228185678 GTGCGTTCACGTGGTGCTCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922771407 Original CRISPR GTGCGTTCACGTGGTGCTCA CGG Intergenic
No off target data available for this crispr