ID: 922774393

View in Genome Browser
Species Human (GRCh38)
Location 1:228208136-228208158
Sequence CGCAGGCTGGGGGCACAGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 679
Summary {0: 1, 1: 0, 2: 4, 3: 83, 4: 591}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922774393_922774403 10 Left 922774393 1:228208136-228208158 CCAGCCTGTGCCCCCAGCCTGCG 0: 1
1: 0
2: 4
3: 83
4: 591
Right 922774403 1:228208169-228208191 AGCCCCCATAGAGAGAGGTGAGG 0: 1
1: 0
2: 0
3: 16
4: 175
922774393_922774401 5 Left 922774393 1:228208136-228208158 CCAGCCTGTGCCCCCAGCCTGCG 0: 1
1: 0
2: 4
3: 83
4: 591
Right 922774401 1:228208164-228208186 CCCAGAGCCCCCATAGAGAGAGG 0: 1
1: 0
2: 1
3: 12
4: 248
922774393_922774410 27 Left 922774393 1:228208136-228208158 CCAGCCTGTGCCCCCAGCCTGCG 0: 1
1: 0
2: 4
3: 83
4: 591
Right 922774410 1:228208186-228208208 GTGAGGAGACAGAGCCGGGCAGG 0: 1
1: 0
2: 1
3: 43
4: 417
922774393_922774411 28 Left 922774393 1:228208136-228208158 CCAGCCTGTGCCCCCAGCCTGCG 0: 1
1: 0
2: 4
3: 83
4: 591
Right 922774411 1:228208187-228208209 TGAGGAGACAGAGCCGGGCAGGG 0: 1
1: 0
2: 5
3: 57
4: 563
922774393_922774408 22 Left 922774393 1:228208136-228208158 CCAGCCTGTGCCCCCAGCCTGCG 0: 1
1: 0
2: 4
3: 83
4: 591
Right 922774408 1:228208181-228208203 GAGAGGTGAGGAGACAGAGCCGG 0: 1
1: 1
2: 10
3: 109
4: 955
922774393_922774409 23 Left 922774393 1:228208136-228208158 CCAGCCTGTGCCCCCAGCCTGCG 0: 1
1: 0
2: 4
3: 83
4: 591
Right 922774409 1:228208182-228208204 AGAGGTGAGGAGACAGAGCCGGG 0: 1
1: 0
2: 11
3: 96
4: 798

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922774393 Original CRISPR CGCAGGCTGGGGGCACAGGC TGG (reversed) Exonic
900015804 1:148573-148595 CTAAGGCTGGGGGCAAAGGTAGG + Intergenic
900046067 1:507170-507192 CTAAGGCTGGGGGCAAAGGTAGG + Intergenic
900068269 1:748882-748904 CTAAGGCTGGGGGCAAAGGTAGG + Intergenic
900229824 1:1550995-1551017 GGCAGCCTGGGGGCGCTGGCAGG - Intronic
900311467 1:2035503-2035525 GGTGGGCTGTGGGCACAGGCGGG - Intergenic
900760306 1:4466086-4466108 CTGAGGCTGGGGGCAGAGGGTGG + Intergenic
900824237 1:4913492-4913514 CCCTGGCTGGGGGCCCAGGGTGG - Intergenic
901587721 1:10312090-10312112 CTCAGGGTAGGGGCCCAGGCTGG - Intronic
901642539 1:10700167-10700189 CCCGGGCTGGGGCCACAGGCTGG - Intronic
901701582 1:11047283-11047305 GGGAGGCTGGGGGCAGGGGCAGG - Intergenic
901816421 1:11796123-11796145 CACAGGCTGGGGGCTCTGGGTGG - Intronic
901816985 1:11799965-11799987 AGCAGGCTAAGGGCACAGCCAGG + Intronic
902348577 1:15836772-15836794 CCCAGGCTGGGGGCAAAGCCGGG - Intergenic
902372446 1:16014986-16015008 AGCTGGCTGGGGGCACGGGGTGG + Exonic
902807705 1:18871515-18871537 GGCTGGGTGGGGGCACAGGCTGG - Exonic
903226476 1:21896685-21896707 CGCAGATGGGGGGCACAGGCAGG + Intronic
903261461 1:22133828-22133850 CGCAGGCTGTAGGCACGGGCCGG - Intronic
904287370 1:29461140-29461162 AGGAGGCTGGGGGCAGAGGAGGG + Intergenic
904893768 1:33798885-33798907 TGCAGGCTTTGGGCACATGCTGG - Intronic
905435270 1:37951392-37951414 AGGAGGATGGGGGCACAGCCAGG + Intergenic
907011684 1:50969066-50969088 CGCAGCAAAGGGGCACAGGCCGG + Exonic
907223142 1:52921666-52921688 CGCAGCATCGGGGCGCAGGCTGG + Exonic
907412596 1:54293069-54293091 CACAGACTGGGGTCGCAGGCTGG - Intronic
908323202 1:62998323-62998345 AGCAGGCTTGGGGCTGAGGCAGG - Intergenic
909931086 1:81501587-81501609 CGCAGCCGGGGGCCACAGCCGGG - Intronic
910165978 1:84328129-84328151 CCCAGACTGGGGGCACACGATGG + Intronic
911088754 1:94001119-94001141 AGAAGGTTGGGGGCACAGGCTGG + Intronic
912089688 1:106055742-106055764 AGCAGGCTTGGTGCACAGCCAGG + Intergenic
912132368 1:106619204-106619226 TGCAGGAGGGAGGCACAGGCAGG + Intergenic
913963205 1:143354598-143354620 CGCCGGCTGGCTGCACCGGCTGG + Intergenic
914057561 1:144180184-144180206 CGCCGGCTGGCTGCACCGGCTGG + Intergenic
914121585 1:144786182-144786204 CGCCGGCTGGCTGCACCGGCTGG - Intergenic
915141781 1:153772504-153772526 GCCAGGCTGGGGGCAGGGGCAGG + Intronic
915300226 1:154947490-154947512 TGCAGGCTGGGGACACTGTCAGG + Exonic
915449955 1:155997883-155997905 GGCAGGCTGGGTGCCCAGGCTGG - Intronic
919913083 1:202123788-202123810 GGCAGGCCAGGGGGACAGGCGGG + Intronic
920066685 1:203274188-203274210 CCCAGGCTGAGGGTACAGACAGG + Intergenic
922516906 1:226214665-226214687 CCTAGGCTGGAGGCACAGACTGG - Intergenic
922751887 1:228073850-228073872 CCCAGGCCTTGGGCACAGGCAGG + Intergenic
922774393 1:228208136-228208158 CGCAGGCTGGGGGCACAGGCTGG - Exonic
922807752 1:228399316-228399338 GGCAGGTTGGGGGGACAGGAGGG + Intronic
923055973 1:230426127-230426149 CGCAGGCTGCGGGCCGCGGCGGG + Intergenic
924643631 1:245857208-245857230 GTCAGGCTGGTGGCACTGGCTGG + Intronic
924787195 1:247209875-247209897 CACAGGCTGGGGGGACAGGATGG + Intergenic
924946593 1:248850804-248850826 CACAGGGTGGGGGCAGATGCTGG - Intronic
1063160147 10:3412930-3412952 CCCAGGCTGGGGGCAGAGGCCGG - Intergenic
1063367117 10:5498382-5498404 GGCAGGCTGCGTGCAGAGGCTGG + Intergenic
1064635798 10:17365583-17365605 AGCAGGCAGGTGGCACAGACAGG - Intronic
1064641947 10:17424460-17424482 CACTGTGTGGGGGCACAGGCAGG - Intronic
1065599960 10:27358195-27358217 CGCAGGGTGGAGGGACAGGCAGG + Intergenic
1065625751 10:27626847-27626869 GGGAGGCTGGAGGCACAGCCAGG - Intergenic
1066086342 10:31975335-31975357 TGGAGCCTGGGGGCCCAGGCAGG + Intergenic
1067033744 10:42898290-42898312 CGCAGGGAGGGGGCGCAGTCCGG + Intergenic
1067700146 10:48565653-48565675 CTCAGCCTGGTGGAACAGGCTGG - Intronic
1067844821 10:49711153-49711175 GGCTGGCTGGGGGCAGAGTCAGG + Intergenic
1069335642 10:67346862-67346884 CTCAAGCTGAGGGCACAAGCAGG - Intronic
1069544386 10:69318477-69318499 CGCAGGCAGGAGGCACCGCCCGG - Intronic
1069622155 10:69844366-69844388 AGCAGGCAGGAGGCATAGGCAGG - Intronic
1069760519 10:70807878-70807900 TGCAGGCAGGGGCAACAGGCAGG - Intergenic
1069760911 10:70810368-70810390 TGCAGGCAGGGGCAACAGGCAGG + Intergenic
1069905659 10:71730763-71730785 CTCAGGCTGGGGCCACTGGTGGG - Intronic
1069995982 10:72342442-72342464 AGCAGGCTGCAGGCAGAGGCTGG + Intronic
1070162670 10:73875016-73875038 CGCAGGCTGGGGGCGCCTCCCGG - Intergenic
1070658212 10:78285736-78285758 AGCGGGCAGGGGGCACAGCCTGG + Intergenic
1070757664 10:79003498-79003520 CTCAGAGTGGGGGCACAGGATGG - Intergenic
1070757905 10:79004967-79004989 CCCAGGCTGGAAGCCCAGGCTGG - Intergenic
1070787268 10:79169149-79169171 CTCAGGTTGGTGGGACAGGCTGG + Intronic
1071464060 10:85923487-85923509 TGCAGGCTGGGGGCAATCGCTGG + Intronic
1071465339 10:85934756-85934778 CGCTGGCTGGGGCCACTGCCAGG + Intronic
1071560975 10:86646690-86646712 TGCAGGGTGGGGGCCCAAGCTGG - Intergenic
1072909143 10:99484554-99484576 GGTAGTCTGGGGGCACAGGAAGG - Intergenic
1073480162 10:103781392-103781414 CGCAGGATGGGGTCACCAGCTGG + Intronic
1074377818 10:112952828-112952850 TGAGGGCAGGGGGCACAGGCCGG - Intronic
1075031182 10:119025685-119025707 CACAGGCTGAGGGCTCTGGCAGG - Intergenic
1075116171 10:119628849-119628871 GGCAGGCTGGCTGCAGAGGCTGG - Intergenic
1075464093 10:122638478-122638500 CCCAGGCTGGATGCCCAGGCAGG + Intronic
1075871139 10:125773531-125773553 GGGAAGCTGGAGGCACAGGCAGG + Intronic
1076130212 10:128008795-128008817 GGCAGGATGAGGACACAGGCTGG - Intronic
1076149348 10:128150048-128150070 CGCGGGCCGGGGACACAGGCTGG - Intergenic
1076300415 10:129421487-129421509 GGCAGGCTGAGGGAACATGCTGG - Intergenic
1076442328 10:130488551-130488573 CGCTGTCTGAGGGCAGAGGCAGG + Intergenic
1076719833 10:132388197-132388219 CGCGGGCGGGGGGCTCATGCGGG + Intergenic
1076719849 10:132388236-132388258 CGCGGGCGGGGGGCTCATGCGGG + Intergenic
1076719892 10:132388332-132388354 CGCGGGCGGGGGGCTCATGCGGG + Intergenic
1076719987 10:132388540-132388562 CGCGGGCGGGGGGCTCATGCGGG + Intergenic
1076972397 11:143642-143664 CTAAGGCTGGGGGCAAAGGTAGG + Intergenic
1076993903 11:289280-289302 CGGGGGCTGGGGGGACGGGCCGG - Intronic
1077024210 11:432155-432177 GGCAGGCTGGGGGCTCTGCCAGG - Intronic
1077178426 11:1201059-1201081 CGCAGGCTGAGGGCTGAGGTAGG - Intronic
1077288986 11:1780170-1780192 CCCAGGCCAGGGGTACAGGCGGG + Intergenic
1077479642 11:2807630-2807652 AGCCGGCGGTGGGCACAGGCGGG + Intronic
1077495405 11:2884596-2884618 CGAGGGCTGGGGGGACCGGCCGG + Intronic
1080393204 11:31866843-31866865 CTCAGGCTGGAGGGACAGGAAGG - Intronic
1081329747 11:41788567-41788589 CGCAAGCAGGGCGCACAGCCCGG + Intergenic
1081673176 11:44953071-44953093 GGGAGGCTGGGAGCTCAGGCTGG + Intergenic
1081793392 11:45804440-45804462 CGCGGCCCGGGGACACAGGCAGG + Exonic
1082813280 11:57491672-57491694 TGGGGGTTGGGGGCACAGGCGGG - Intronic
1082835529 11:57647975-57647997 CACAGGCTGGGAAGACAGGCAGG - Exonic
1083172279 11:60930120-60930142 AGCAGGCTGAAGGCACAGACTGG + Intronic
1083616421 11:64028703-64028725 CTGAGGCTGGGGGCACTGGGAGG - Intronic
1083894029 11:65611370-65611392 GGCTGGTGGGGGGCACAGGCAGG - Intronic
1083895089 11:65616002-65616024 GGCAGGCGCGGGGCACGGGCCGG - Exonic
1083921061 11:65781498-65781520 AGCGGGCTGGGGGCCCGGGCAGG - Intergenic
1084054880 11:66625693-66625715 CCCCAGCTGGGGGCAGAGGCGGG - Intronic
1084114100 11:67031816-67031838 AGCAGGCTGTGGGCACAGCCAGG - Intronic
1085268136 11:75249916-75249938 TGCAGGCTGGGGGAACAGGGAGG - Intergenic
1085496352 11:76973311-76973333 CACAGACTTGGGGCACAGGGGGG - Intronic
1085716474 11:78877998-78878020 AGCCGGCACGGGGCACAGGCTGG - Intronic
1085768944 11:79308079-79308101 CTCAGGCTGGGTGGAGAGGCCGG + Intronic
1085818805 11:79770529-79770551 CACAGGCTGGGGGCAAAGGAGGG + Intergenic
1087064625 11:94016111-94016133 CCCAGGCTGGGTGCAGTGGCAGG + Intergenic
1088191623 11:107234221-107234243 TGCAGGCTGGGGGAGAAGGCAGG + Intergenic
1089258068 11:117204515-117204537 CTGAGGCTGGGGGCACAGGGAGG - Exonic
1089323553 11:117642415-117642437 CACAGTCTGGAGGCACAGTCTGG + Intronic
1089620920 11:119721722-119721744 CGGAGCCCTGGGGCACAGGCAGG - Intronic
1089699034 11:120233282-120233304 AGCAGGCTGGAAGCTCAGGCGGG + Intergenic
1090248607 11:125235777-125235799 CAGAGGCAGGGGACACAGGCAGG - Intronic
1090594583 11:128307499-128307521 CGGAGGCTGGGAGCACAGAAAGG + Intergenic
1090709503 11:129373082-129373104 CGCATTCTGTGGGCACACGCCGG + Intergenic
1090733128 11:129588989-129589011 TGCAGGGTGGGGGCCGAGGCTGG - Intergenic
1090805105 11:130197824-130197846 GGCATGCTGCGGGCACAGGCAGG - Exonic
1091221340 11:133931524-133931546 ACCAGGCTGGGAGTACAGGCAGG - Exonic
1091222782 11:133939080-133939102 AGGAGGCTGGTGCCACAGGCAGG - Intronic
1091224265 11:133948379-133948401 AGCATGCTGGGGCCTCAGGCAGG - Intronic
1091300061 11:134502023-134502045 CACAGGGTGGGGCCAGAGGCAGG + Intergenic
1091372697 11:135073996-135074018 GGAGGGCTGGGGGCCCAGGCTGG - Intergenic
1092233779 12:6792883-6792905 TGCAGGCTGGGGGCATAAGCTGG + Intronic
1094354667 12:29565128-29565150 GGCAGGCTGGGGACCCAGGGAGG + Intronic
1096172795 12:49486667-49486689 CCCAGGCTGGAGGCTGAGGCAGG + Intronic
1096260126 12:50085270-50085292 GGCCGGCCGGGGGAACAGGCGGG + Exonic
1096494081 12:52029288-52029310 GGCAGGGTCTGGGCACAGGCAGG - Intronic
1096572960 12:52534220-52534242 AGCAGGCCGGGAGCCCAGGCAGG - Intergenic
1097177119 12:57149662-57149684 CACAGGCTGGAATCACAGGCAGG + Intronic
1097534537 12:60850020-60850042 CGCAGGCTGAGGCCAAAGGCAGG - Intergenic
1100357419 12:93844495-93844517 AGCAGTCTGTGGACACAGGCCGG - Intronic
1100848046 12:98679899-98679921 GGCAGGCTTGGGACCCAGGCTGG + Intronic
1102455706 12:113069659-113069681 GTCTGGCTGGGGGCACCGGCTGG - Intronic
1102688868 12:114744868-114744890 GGCAGGCTGGGCGCAGAGCCGGG - Intergenic
1103479216 12:121240473-121240495 CGCTGGCTGGCTGGACAGGCGGG - Exonic
1103506068 12:121442954-121442976 CTCAGGCCTGGGGCACAGGAGGG + Intronic
1103623746 12:122204012-122204034 TCCAGGCTGGGGACAGAGGCTGG + Intronic
1103751419 12:123166054-123166076 CGCAGGCTCGGGGCTCGGGCTGG + Intronic
1103812498 12:123626940-123626962 GGCAAGCTGGGGGCACATTCTGG + Intronic
1103890942 12:124238724-124238746 CCCGGGCTGTGGGCAGAGGCTGG - Intronic
1103897121 12:124280050-124280072 CTCAGGCTGGGGACCCACGCCGG - Intronic
1103984856 12:124760443-124760465 GGCAGCCTGGGCTCACAGGCTGG + Intergenic
1104441622 12:128797882-128797904 TGCAGCCAGGGGGCACAGCCTGG + Intronic
1104844335 12:131839178-131839200 GGCAGGGTGGAGGCAGAGGCTGG - Intronic
1104893733 12:132152020-132152042 CCATGGCTGGGGGCACAGGGCGG + Intronic
1104958362 12:132476765-132476787 CGCAGGGTGCGGGGACAGCCTGG - Intergenic
1104982824 12:132581834-132581856 CGGGGGAGGGGGGCACAGGCTGG - Intronic
1104982894 12:132582045-132582067 CGGGAGCTGGGGGCAGAGGCCGG - Exonic
1105071200 12:133235527-133235549 CCCAGGCTGGAGCCCCAGGCAGG - Exonic
1105287983 13:19022907-19022929 AGGAGGCTGGAGGCAAAGGCAGG + Intergenic
1105497670 13:20945062-20945084 TTGAGGCTGGAGGCACAGGCAGG - Intergenic
1105829430 13:24150690-24150712 AGCAGGCTGGGGATTCAGGCAGG + Intronic
1106915224 13:34506741-34506763 TGCAGGCAGGGGACAAAGGCTGG - Intergenic
1107175658 13:37395298-37395320 CCCAGTCTGGGGGCTCTGGCTGG - Intergenic
1107467797 13:40665789-40665811 CGGCGGCGGGGGGCACCGGCGGG + Exonic
1107837417 13:44423057-44423079 CCCAGGCTGGAAGCCCAGGCAGG - Intergenic
1108212934 13:48156699-48156721 AGCAGGGTGGAGTCACAGGCAGG + Intergenic
1108672629 13:52707522-52707544 CCCAGGCTCTGTGCACAGGCAGG - Intronic
1112817030 13:103284549-103284571 TGCAGGCTGAGTGGACAGGCAGG - Intergenic
1113407757 13:110057234-110057256 CCCAGGCTGGGCTCACAGGCTGG - Intergenic
1113465102 13:110507265-110507287 TGGAGGCGGGGCGCACAGGCAGG - Intronic
1113772716 13:112920799-112920821 CACAGGCTGAGGGCACAGATTGG + Intronic
1114224198 14:20723447-20723469 GGGAGGCTGCGGGCGCAGGCGGG + Intergenic
1115226070 14:31103510-31103532 CTCAGGCTGGAGTCCCAGGCTGG - Intronic
1115268646 14:31527349-31527371 CGGAGGCTGGCGGCGCCGGCCGG + Intronic
1117723164 14:58646561-58646583 CGCGGGCGGGGGCCACAGGGCGG + Exonic
1119703924 14:76772525-76772547 CCCAGGCTGGGGACAGAGGGAGG + Intronic
1121010504 14:90517501-90517523 GGCGGGCTGGGGGCAGGGGCAGG - Intergenic
1121279296 14:92687767-92687789 CGCAGGCTCGCGGCAGAGACGGG + Intronic
1121436810 14:93925965-93925987 CCCAGACTGGGGGCATTGGCAGG - Intronic
1121895463 14:97642796-97642818 CACAGGCTGGGTGCAAAGGAAGG + Intergenic
1122232906 14:100315979-100316001 GCCAGGCTGGGGCCACAGGTGGG + Intergenic
1122386465 14:101351500-101351522 CGGGGGCTGGGGGCACAGAATGG + Intergenic
1122632325 14:103112624-103112646 GGGAGGCTGGGGGCAGAGGCGGG + Intergenic
1122784724 14:104158410-104158432 CGCAGGCTGGGGCCACGGAGAGG + Intronic
1122931373 14:104934129-104934151 TGCGGGCTGGGGAGACAGGCGGG + Exonic
1123154217 14:106208882-106208904 AGCAGGGTTGGGGCACAGGATGG + Intergenic
1123998278 15:25733897-25733919 CGCCTGCTGGCGGCACAGGCTGG + Intronic
1124175374 15:27418944-27418966 GGCAGGCTGGCAGCTCAGGCTGG + Intronic
1124581402 15:30958323-30958345 CAGAGGCTGAGGGCCCAGGCGGG + Intronic
1124690967 15:31822536-31822558 GCCAGGCTGGGGGTGCAGGCTGG - Intronic
1125485604 15:40108812-40108834 CGGCGGCGGCGGGCACAGGCCGG + Exonic
1127289243 15:57555381-57555403 AGCAGGCTCTGGACACAGGCTGG - Intergenic
1127668096 15:61169013-61169035 AGCAGGATGGAGGCACAGGAAGG - Intronic
1127734396 15:61828157-61828179 CCCGGGCTGGAGGCACAGGGCGG - Intergenic
1127961751 15:63895446-63895468 CGAGGGATGGGGGCCCAGGCAGG - Intergenic
1128157672 15:65402058-65402080 CGAAGGCTGGGGACAGAGGTGGG - Intronic
1128261561 15:66236503-66236525 TTCAGTCTGGGGGCACAGGCTGG + Intronic
1128322912 15:66705154-66705176 CCCAGGCTGGGAGCACAGAGAGG + Intronic
1128418144 15:67465926-67465948 TTTAGGCTGAGGGCACAGGCAGG - Intronic
1128547523 15:68578484-68578506 CGCTGGCCCGGGGCACAGGGTGG - Intergenic
1128565721 15:68699488-68699510 CACGGGCTTGGGGCACAGGAAGG + Intronic
1128733355 15:70035271-70035293 AGCAGCTTGGGGGCAGAGGCTGG + Intergenic
1129288005 15:74541225-74541247 CGCAGCCGGGGGCCACAGCCGGG - Exonic
1129771237 15:78204696-78204718 CGGAGGCTGCGGGGACAGGCAGG + Intronic
1131152690 15:90056931-90056953 CCCAGGCTAGGGGCAGGGGCTGG + Intronic
1132013157 15:98293365-98293387 GGCCTGCTGGGGGCAGAGGCTGG + Intergenic
1132365398 15:101252708-101252730 CCCAGGCTGGGGGTACTAGCCGG - Intergenic
1132382929 15:101379131-101379153 CACAGGCTGGGTGCACAGGAGGG + Intronic
1132524463 16:407435-407457 AGCTGGCTGGGGCCACCGGCCGG + Exonic
1132528303 16:428915-428937 CGAAGGTTGGGGGCAAGGGCTGG + Intronic
1132556527 16:575137-575159 GGCCTGCTGGGGGCACAGGCAGG - Intronic
1132600964 16:772806-772828 CACAGCCTGGGGGCAGAGCCCGG + Exonic
1132640782 16:977404-977426 CGCAGGCTGTGAGCAGAGGCTGG - Intronic
1132751918 16:1461547-1461569 GGCTGGCAGGGGGCAGAGGCCGG + Intronic
1132802651 16:1761966-1761988 CACGGGCAGGGGGCCCAGGCGGG + Intronic
1132827492 16:1912421-1912443 GGCAGGCCGGCGGAACAGGCCGG - Intronic
1132865276 16:2090101-2090123 CGCTGGGTGGGGGCACATCCGGG + Exonic
1132934250 16:2472968-2472990 CGCAGGCTGAGGACAGAGGTGGG - Exonic
1132936480 16:2483835-2483857 GGCAGGCTGGGAGCAGGGGCCGG + Intronic
1133001941 16:2856239-2856261 CACAGGCTGGGGGAACTGGAGGG + Exonic
1133020487 16:2964766-2964788 CGCTGGCTGGGGACCCAGGCGGG + Intronic
1133020913 16:2966625-2966647 CGCCAGCTGGGAGCACAGACTGG - Exonic
1133038578 16:3047574-3047596 GACAGGCTGGGTGCAGAGGCAGG - Intronic
1133103860 16:3494621-3494643 CACAGCCTGAGGGCACAGCCTGG - Exonic
1133231428 16:4368862-4368884 TGGCTGCTGGGGGCACAGGCTGG + Intronic
1133430909 16:5736163-5736185 GGCAGGCTTGTGGCAAAGGCAGG - Intergenic
1134129974 16:11642665-11642687 CCCAGGCAGGGGGCACAGAAGGG - Intergenic
1135071186 16:19353200-19353222 CCCAGGCTGGTTGCCCAGGCTGG - Intergenic
1135135470 16:19883658-19883680 CGTGGGCTGGGGCCCCAGGCGGG + Intronic
1136019020 16:27428289-27428311 CACAGGCTGGGGGGCCAGGAAGG - Intronic
1136054752 16:27680132-27680154 ACCAGCCTGTGGGCACAGGCTGG + Intronic
1136129625 16:28211686-28211708 GGGAGGCTGCGGGCCCAGGCAGG + Exonic
1136281967 16:29218617-29218639 AGCCGGCGGGAGGCACAGGCTGG - Intergenic
1136296946 16:29309183-29309205 CACAGGCAGAGGGCACAGGCAGG - Intergenic
1137056258 16:35747969-35747991 GCCATGGTGGGGGCACAGGCGGG - Intergenic
1137576330 16:49602627-49602649 CGCAGGCCCAGGGCACAGGCTGG + Intronic
1138407644 16:56810600-56810622 CCCAGGCTGGGTGTACAGGCTGG - Intronic
1138561021 16:57801229-57801251 CAAAGACTGGGGGGACAGGCTGG + Intronic
1139514486 16:67445247-67445269 AGCAGGCGGGGGGCAGAGGCTGG + Intronic
1139588188 16:67917733-67917755 AGCTGCCTGTGGGCACAGGCAGG + Intronic
1139967749 16:70755081-70755103 GGCAGCGTGGGGGCAGAGGCTGG + Intronic
1141424458 16:83936045-83936067 TGCAGGCTGGGTGCCCTGGCAGG - Intronic
1141585042 16:85028032-85028054 CGCGGGCCGAGGGCTCAGGCCGG + Intronic
1141890736 16:86924906-86924928 GAAAGGCTGGGGCCACAGGCTGG + Intergenic
1141900471 16:86987315-86987337 TGCAGGCTGAGGGCATACGCAGG + Intergenic
1141900480 16:86987387-86987409 CGCAGGCTGAGGGCATATGCAGG + Intergenic
1141900483 16:86987404-86987426 TGCAGGCTGAGGGCATACGCAGG + Intergenic
1142008655 16:87702397-87702419 CCCAGGCTGGGGGTGCAGGACGG - Intronic
1142058497 16:88015287-88015309 CACGGGCAGAGGGCACAGGCAGG - Intronic
1142086343 16:88184533-88184555 AGCCGGCGGGAGGCACAGGCTGG - Intergenic
1142136324 16:88453492-88453514 CGCGGGCTGGGGGCGCGGGCCGG + Exonic
1142155227 16:88529949-88529971 CCCAGGTTGGGGGCAGGGGCTGG + Intronic
1142184357 16:88687373-88687395 GGCAGGCCGGCGGCACAGCCAGG - Intergenic
1142186315 16:88696386-88696408 CTCACGCTGGGGGTACAGCCTGG - Intergenic
1142334895 16:89481815-89481837 GGAAGGCTGGGGACAAAGGCTGG - Intronic
1142447855 16:90153880-90153902 CTAAGGCTGGGGGCAAAGGTAGG - Intergenic
1142459635 17:81444-81466 CTAAGGCTGGGGGCAAAGGTAGG + Intergenic
1142477831 17:200167-200189 CCCAGGCTGGGCCCACAGCCAGG - Intergenic
1142769144 17:2084182-2084204 TTCAGGCTGAGGGCACAGCCAGG - Intronic
1142852628 17:2711575-2711597 CGCAGGCCGGGGGCAAGGGGCGG - Intronic
1142856091 17:2731251-2731273 TGGAGACTGGGGGGACAGGCAGG - Intergenic
1143646262 17:8232169-8232191 GGCAGGGTCTGGGCACAGGCAGG + Exonic
1143786503 17:9259743-9259765 CACAGGACGGGGTCACAGGCAGG + Intronic
1144205104 17:12974274-12974296 CCCAGGCTGGAGGCCCAGGCCGG - Exonic
1144957676 17:19027324-19027346 GGCAGGGTAGGGGCACAGGATGG + Intronic
1145269704 17:21398239-21398261 TGCATGCTGGAGGCACACGCAGG + Intronic
1145903891 17:28506094-28506116 CACAGGCTGTGCGCACTGGCAGG + Intronic
1145912827 17:28552404-28552426 CGCAGGCCCAGGGCCCAGGCCGG - Exonic
1146034586 17:29394993-29395015 AGCATGCTGGGGGCTGAGGCTGG + Intronic
1146262991 17:31433769-31433791 GGCAGGCTGGGGCAACAGGAAGG - Intronic
1147217401 17:38908720-38908742 CCCGGGCTGGGGGCACAGGGAGG - Intronic
1147448182 17:40487706-40487728 TGCAGGCTTTGGGCATAGGCTGG + Intronic
1147675399 17:42201955-42201977 CCCAGGCTGAGGGCATAGGCTGG - Intronic
1147970854 17:44218748-44218770 CGGAGGCGGGGGGAACCGGCCGG - Intronic
1148207430 17:45787901-45787923 CACAGACTGGGGGCAAAGACAGG + Intronic
1148323535 17:46771214-46771236 CGCAGGCGCGGGGCGCGGGCGGG - Intronic
1149456909 17:56795271-56795293 GGCAGGATGGGAGGACAGGCAGG + Intronic
1149685364 17:58531812-58531834 CGCCGGCCCCGGGCACAGGCTGG - Intronic
1149781945 17:59404758-59404780 GGCAGGCTGGGGCCACAGATAGG - Intergenic
1151236003 17:72720178-72720200 CGAAGGCTGGGGACAAGGGCTGG + Intronic
1151354844 17:73552085-73552107 CCCAGACAGGGGGGACAGGCTGG - Intronic
1151370281 17:73643313-73643335 CGGAGGCTGGAGGCAGGGGCGGG + Intronic
1151657738 17:75503561-75503583 CTCTGGCTGGGGGCGGAGGCTGG - Intronic
1151660216 17:75515006-75515028 CGCAGGCCTGGGGCCCTGGCCGG + Intronic
1151670793 17:75570757-75570779 AACATGCTGGGGGCCCAGGCAGG + Intronic
1152197283 17:78925151-78925173 GGCGGGCTGGGGGCGCGGGCGGG + Exonic
1152225354 17:79090278-79090300 GCCAGGCTGGGGGCACGGGCGGG + Intronic
1152272261 17:79331531-79331553 TGCAGGCTGGAGCCACGGGCAGG - Intronic
1152425713 17:80217553-80217575 AGCAGGCAGGGTGCCCAGGCAGG + Intronic
1152565457 17:81098248-81098270 CCCAGGATGGGAGCACAGTCCGG + Intronic
1152649119 17:81483815-81483837 CGCAGGCTGAGGGCACCGGCGGG + Intergenic
1152698550 17:81807933-81807955 CCTAGGGTGGGGGCACAGGGTGG - Intronic
1152747503 17:82048241-82048263 CGCAGGCTGGGTGCACGGCCGGG - Exonic
1152800011 17:82326567-82326589 CCCAGGCTGGACGCCCAGGCTGG - Intronic
1154323907 18:13376140-13376162 CACAGCCTGGGAGGACAGGCAGG - Intronic
1154473123 18:14723984-14724006 CTGAGGCTGGGGGCAAAGGCAGG - Intergenic
1155166788 18:23238108-23238130 CTCAGGCTGGGAGCACAGGAGGG - Intronic
1155836613 18:30593669-30593691 CCCAGGCTGGTGCAACAGGCTGG + Intergenic
1156822842 18:41393492-41393514 CCCAGGCTGGACGCCCAGGCTGG + Intergenic
1157555575 18:48610845-48610867 CACAGGGTGGGGGCTCAGGAGGG + Intronic
1157591979 18:48841649-48841671 CGCTGGCTCGGGGGCCAGGCTGG + Intronic
1157602336 18:48901920-48901942 CCCTTGCTAGGGGCACAGGCAGG + Intergenic
1158369518 18:56784111-56784133 AAAAGGCTGGGGGCAGAGGCAGG - Intronic
1158559963 18:58505421-58505443 CGCAGTGTGTGGGCACAGACCGG - Intronic
1160345268 18:78127299-78127321 CGGAGGTGGGGGGCACTGGCTGG + Intergenic
1160649351 19:213952-213974 CTAAGGCTGGGGGCAAAGGTAGG + Intergenic
1160749667 19:727892-727914 AGCTTGCTGGGGGCAGAGGCTGG + Intronic
1160861607 19:1239587-1239609 GCCATGCTGGGTGCACAGGCCGG + Intergenic
1160871874 19:1281454-1281476 CCCAAGCTGTGGGCACAAGCCGG - Intergenic
1160906347 19:1453370-1453392 GGGAGGCTGGGGGGAAAGGCAGG + Intronic
1160990466 19:1858260-1858282 CGCAGTCTGGGTGCCCAGGCGGG - Intronic
1161030509 19:2055992-2056014 CCCAGGCTGGGGGCGCGGGATGG + Intergenic
1161270110 19:3385099-3385121 GGCAGGCTGGGGGCAAGGGAGGG - Intronic
1161285972 19:3468469-3468491 AGGAAGCTGGGGGCACAGGCTGG - Intronic
1161366106 19:3880721-3880743 CGGAGGCAGGGCGCGCAGGCGGG + Exonic
1161719625 19:5895684-5895706 GGTAGGCCAGGGGCACAGGCGGG + Intronic
1162536629 19:11266315-11266337 CGGAGGCAGCGGGCAAAGGCAGG - Intergenic
1162764486 19:12910388-12910410 CTCAGGCTGGAGTGACAGGCTGG + Intronic
1162914173 19:13865454-13865476 GGCGGGCCGGGGGCACGGGCGGG + Intronic
1162916542 19:13877331-13877353 CTCTGGCTGGGGGCTCAGCCTGG - Exonic
1162932371 19:13963424-13963446 TGCAGGCTGGGCGGGCAGGCTGG - Intronic
1162959612 19:14118077-14118099 CGCAGTCTGCGGGCCCGGGCCGG + Intronic
1162971327 19:14182980-14183002 CCCAGGCCGGGGGCAAGGGCGGG - Intronic
1163033365 19:14558584-14558606 CTCTGGCCTGGGGCACAGGCTGG - Intronic
1163730890 19:18948673-18948695 CGTGGGATGGGGGGACAGGCGGG - Intergenic
1163829733 19:19541870-19541892 CACAGGGTGGGGGCACATGGTGG + Intronic
1164120529 19:22261710-22261732 CTTGGGCTGGGGGCCCAGGCAGG - Intergenic
1164430670 19:28185775-28185797 CCCAGGCTGGGAGCAGAGGGAGG + Intergenic
1164763817 19:30747784-30747806 CAGAGCCAGGGGGCACAGGCAGG - Intergenic
1164982906 19:32627805-32627827 CGCAGGCTGGGGGCCCAGCAAGG - Intronic
1164983962 19:32634630-32634652 CTCAGGCTGGGCGCAGTGGCTGG + Intronic
1165068084 19:33240592-33240614 GGCAGGCTGGGGTCTCAGCCAGG - Intergenic
1165395024 19:35559211-35559233 CGCAGGCTGGGGACCCACCCTGG + Intronic
1165480449 19:36060440-36060462 TTCAGGCAGGGGGCACAGGAAGG + Intronic
1165855675 19:38878283-38878305 AGCAGGCAGGGGGAAGAGGCGGG + Intergenic
1165918144 19:39273821-39273843 CTCAGGCTGGAGTCAGAGGCAGG - Intergenic
1166094443 19:40530416-40530438 GGCAGGCAGGGGGCGCACGCGGG + Intronic
1166190716 19:41174835-41174857 TGCAGGCTGGGGGCACCCCCTGG + Intergenic
1166591986 19:44007782-44007804 GGCAGCCTGGGGGCGCAGGCTGG - Intronic
1166944892 19:46390570-46390592 CTGGGGCTGGGGGCACAGCCTGG + Exonic
1167149799 19:47702073-47702095 CGCTGGCTGCGGGCTCTGGCGGG - Exonic
1168108072 19:54176344-54176366 CGGAGGCTGGGTGCAATGGCTGG + Intronic
1168401691 19:56089006-56089028 GGCCGGCTGGGGGCGCAGACTGG + Exonic
1168403631 19:56099793-56099815 CGCAGGCTGGGGGCCGTGTCAGG + Intronic
1202697044 1_KI270712v1_random:132857-132879 CGCCGGCTGGCTGCACCGGCTGG + Intergenic
924999407 2:393061-393083 GGCAGGCTGAGGGTGCAGGCAGG + Intergenic
925008203 2:461901-461923 GGCAGGCTGGAGGCAGAGCCTGG - Intergenic
925008970 2:467902-467924 CTCACGCCGGGGGCCCAGGCAGG + Intergenic
925097225 2:1216675-1216697 AGCATGCTGGAGGCACAGACAGG + Intronic
925376227 2:3388115-3388137 CGGAGGCTGGGGGCGCGCGCTGG - Exonic
925430312 2:3786320-3786342 CGGAGGCTCCGTGCACAGGCGGG - Intronic
925430319 2:3786355-3786377 CGGAGGCTCCGTGCACAGGCGGG - Intronic
925430328 2:3786390-3786412 CGGAGGCTCCGTGCACAGGCGGG - Intronic
925430337 2:3786425-3786447 CGGAGGCTCCGTGCACAGGCGGG - Intronic
925430346 2:3786460-3786482 CGGAGGCTCCGTGCACAGGCGGG - Intronic
925430355 2:3786495-3786517 CGGAGGCTCCGTGCACAGGCGGG - Intronic
925430364 2:3786530-3786552 CGGAGGCTCCGTGCACAGGCGGG - Intronic
925430373 2:3786565-3786587 CGGAGGCTCCGTGCACAGGCGGG - Intronic
925430382 2:3786600-3786622 CGGAGGCTCCGTGCACAGGCGGG - Intronic
925430391 2:3786635-3786657 CGGAGGCTCCGTGCACAGGCGGG - Intronic
925430400 2:3786670-3786692 CGGAGGCTCCGTGCACAGGCGGG - Intronic
927502450 2:23591709-23591731 GGCAGGCTGGAGGGACAGGATGG - Intronic
927571847 2:24166993-24167015 GGCAGGTTGGGGTTACAGGCCGG + Intronic
929540816 2:42819323-42819345 CCCACCCTGGGGGTACAGGCCGG + Intergenic
929828558 2:45329354-45329376 TGCAGGCTGTGAGCCCAGGCTGG - Intergenic
929886496 2:45883481-45883503 GTCGTGCTGGGGGCACAGGCAGG + Intronic
929904129 2:46031324-46031346 CTCAGGCAGAGGGAACAGGCAGG - Intronic
930021564 2:47004868-47004890 CGCAGGCTGGGGGCAAAAGGTGG - Intronic
932221816 2:70005345-70005367 CACAGGCTGGGTGCACATGGTGG - Intergenic
932440460 2:71731453-71731475 GGCAGGCTGGGGGTAAAGGGAGG - Intergenic
934278206 2:91589871-91589893 CGCCGGCTGGCTGCACCGGCTGG + Intergenic
934560475 2:95310602-95310624 CCCAGGCTGGGGTCCCAGGCTGG - Intronic
936061360 2:109297587-109297609 CCCAGGTTGGGGGCACTGACTGG - Intronic
936088581 2:109486746-109486768 GGCAGGCTGAGGGCACTGGGTGG + Intronic
936379100 2:111968561-111968583 CCCAGGCTGGATGCCCAGGCTGG + Intronic
936613256 2:114022714-114022736 AGCAGGCTGGAGGCTCAAGCAGG - Intergenic
938410013 2:131055743-131055765 CGCAGGGAGAGGACACAGGCAGG + Intronic
938955529 2:136294342-136294364 CGCAGGCATGGGGCAGAGTCGGG + Intergenic
940559934 2:155282056-155282078 GGCAGGCTGGGCGCAGTGGCTGG - Intergenic
941463168 2:165794359-165794381 CGCAGGGTGGGGGCGCCGTCCGG + Exonic
942625040 2:177891258-177891280 CCCAGGCTGGAGGCCCAGGGTGG - Intronic
943669688 2:190648466-190648488 CGCAGGCTCGGGGCAGAGGCGGG - Intronic
944435294 2:199682315-199682337 TGCAGGCTGGGTGGGCAGGCCGG - Intergenic
944557683 2:200904318-200904340 CGCAGGCAGGGGGCAGGGCCAGG + Intergenic
947526026 2:230877247-230877269 TGCAGGCACCGGGCACAGGCAGG + Intronic
947614701 2:231548318-231548340 GGCAGGCTGGAGTCTCAGGCAGG - Intergenic
947716881 2:232345403-232345425 CCAAGGATGGTGGCACAGGCAGG - Intergenic
947830481 2:233137497-233137519 CCCAGGCTGGGTGCAGTGGCAGG + Intronic
948080238 2:235199605-235199627 CCCAGGCTGGGGGCGGAGGCAGG + Intergenic
948329919 2:237156621-237156643 TGCAGTGTGGGGGCACACGCCGG + Intergenic
948656417 2:239479434-239479456 CACGGGGTGGGGGCACAGGCAGG + Intergenic
948855179 2:240727048-240727070 GAGCGGCTGGGGGCACAGGCTGG + Intronic
948886768 2:240888693-240888715 CGCAGGGTGGGAGCACAGGGTGG - Intronic
948886810 2:240888815-240888837 AGCAGGCTGGGGGCAGCGGGTGG - Intronic
949028387 2:241776846-241776868 CCCAGGGTGCAGGCACAGGCAGG - Exonic
1169226076 20:3857828-3857850 AGCAGGCTGGGGGTCCAGGAGGG - Intronic
1170713944 20:18816465-18816487 CACAGGCTGGGGGCACTGACAGG - Intronic
1170734245 20:19000108-19000130 AGCAGGCTGGGAGGAGAGGCAGG + Intergenic
1170768206 20:19309974-19309996 TGCAGGATGGGGACTCAGGCTGG - Intronic
1171385067 20:24764377-24764399 CGCAAGATGGGAGCACAGGTGGG - Intergenic
1172242626 20:33423458-33423480 GGGAGGGTGGGGGCACTGGCCGG - Intronic
1172883550 20:38217056-38217078 CCCTGGCTGGGGGCACAGCAGGG - Intronic
1173263512 20:41457678-41457700 AGCAGGGCGGGGGCACAGGATGG - Intronic
1173318917 20:41970045-41970067 AGCTGGCTGGGGTCACAGGAAGG - Intergenic
1175217969 20:57401381-57401403 GGCAGGCTGGAGGGACAGGCAGG - Intronic
1175234757 20:57502168-57502190 GGCAGGCCGGGGGCACACCCAGG + Intronic
1175333928 20:58182826-58182848 TGCAGGCAGTGGGCACAGGCAGG - Intergenic
1175428812 20:58889009-58889031 CGCACCCTGGGGGTGCAGGCCGG - Intronic
1175787957 20:61723891-61723913 CCCATGCAGGGGGCACAGGATGG + Intronic
1175787975 20:61723941-61723963 CCCATGCAGGGGGCACAGGATGG + Intronic
1175787993 20:61723991-61724013 CCCATGCAGGGGGCACAGGATGG + Intronic
1175788012 20:61724041-61724063 CCCATGCAGGGGGCACAGGGTGG + Intronic
1175788030 20:61724092-61724114 CCCATGCAGGGGGCACAGGATGG + Intronic
1175788049 20:61724142-61724164 CCCATGCAGGGGGCACAGGATGG + Intronic
1175790288 20:61736407-61736429 CCCAGGCTGGGTGGACAGGTGGG - Intronic
1175960548 20:62634426-62634448 CGGAGGCTGGGGGCCTTGGCTGG - Intergenic
1175990636 20:62786773-62786795 TGCAGCCTTGGGACACAGGCAGG - Intergenic
1176094432 20:63333413-63333435 CTCACGCTGGGGTCACAGGGTGG + Intronic
1176119787 20:63449078-63449100 GGCAGGCCTGGGGCACTGGCAGG + Intronic
1176200984 20:63860460-63860482 AGAAGGCTGGGGTCCCAGGCGGG + Intergenic
1176256666 20:64156614-64156636 TGAGGGCTGGGGGCACCGGCAGG - Intronic
1176290580 21:5042400-5042422 AGCAGGCAGGGAGGACAGGCTGG + Intergenic
1176801359 21:13433865-13433887 CTGAGGCTGGGGGCAAAGGCAGG + Intergenic
1178390057 21:32190942-32190964 CACAGGATGTGGGCACAGGTGGG - Intergenic
1178976362 21:37224483-37224505 CGCAGGCTGAGTGCACTGGCAGG - Exonic
1179808397 21:43854606-43854628 CTCAGGCTGGGTGCACAGAAGGG + Intergenic
1179866675 21:44221241-44221263 AGCAGGCAGGGAGGACAGGCTGG - Intergenic
1179940595 21:44637040-44637062 CCCAGGCTGAGGGCCCACGCTGG + Intronic
1179975318 21:44862196-44862218 CGCAGGCAGATGGCACAGGAAGG + Intronic
1179987012 21:44927679-44927701 TGCAGGCTGGGGGCAGGGGCGGG + Intronic
1180003076 21:45003889-45003911 GGCAGGCTCTGGGCACAGCCAGG - Intergenic
1180037606 21:45257749-45257771 TGCAGGCTGGGGTCGGAGGCAGG - Intergenic
1180068428 21:45424284-45424306 GGCAGGCCCAGGGCACAGGCAGG + Intronic
1180092447 21:45539999-45540021 CGCAGGCAGGGGCCACTGCCAGG + Intronic
1180230207 21:46422420-46422442 GGCAGGAGGGAGGCACAGGCGGG - Intronic
1180635955 22:17263173-17263195 CGCTGACTGCGGGCTCAGGCAGG + Intergenic
1180699633 22:17774318-17774340 GGCAGGCAGGGGTCACGGGCTGG + Intronic
1180858099 22:19060784-19060806 CCCAGGCGGGGCTCACAGGCTGG + Intronic
1180859109 22:19066972-19066994 TTCGGGCTGTGGGCACAGGCCGG + Intronic
1180994761 22:19959910-19959932 CGCGGGCAGGTGGGACAGGCGGG + Intronic
1181048561 22:20228027-20228049 CAAAAGCTGGGGGCACAGGCAGG + Intergenic
1181056316 22:20262038-20262060 GGCCGGCTGTGGCCACAGGCCGG + Intronic
1181068937 22:20320585-20320607 CGCAGTCTGGGCTCACGGGCTGG - Intergenic
1181166917 22:20988885-20988907 CGGAGGTGGGGTGCACAGGCCGG - Intronic
1181485168 22:23226006-23226028 CGCCGGATGTGGGCACAGGAGGG - Intronic
1181696179 22:24593918-24593940 CCCAGGCTGGGGTCAGAGGTGGG - Intronic
1182278679 22:29205970-29205992 GGCAGGCGGGGAGGACAGGCTGG + Exonic
1182429824 22:30292913-30292935 GGAAGACTGGGGGCCCAGGCTGG - Intronic
1182508718 22:30803479-30803501 CCCAGGCTGGTGCCACAGGGGGG + Intronic
1182765002 22:32752428-32752450 GGGAGGCTGGGGCCAGAGGCAGG - Intronic
1183050531 22:35257585-35257607 CTCAGGGTGGGGGCCCAGCCCGG - Intronic
1183385767 22:37513617-37513639 TGCAGGCTGGGGGTACTGGGAGG - Intronic
1183461560 22:37953977-37953999 CCCCGGCTGGAGGCACAGGAGGG + Intronic
1183464626 22:37973444-37973466 CACAGGCTGGGGGCAGGGGCTGG + Exonic
1183657391 22:39195624-39195646 AGCTGGCTGGGACCACAGGCTGG - Intergenic
1183706960 22:39480129-39480151 CTCTGGCTTGGGGCAGAGGCAGG + Intronic
1183713371 22:39519854-39519876 CGCAGGCTGGGAGCGGCGGCGGG + Intronic
1183943001 22:41306894-41306916 CCCAGGCTGGAGGCTCAGCCTGG + Intronic
1183953767 22:41367411-41367433 CGCAGGCTAGGGAGGCAGGCGGG - Intronic
1184058123 22:42066151-42066173 CCCAGGGTGTGGGCCCAGGCTGG + Intronic
1184291881 22:43501756-43501778 CACAGGCTGGGGGCAGACACTGG - Intronic
1184369382 22:44072945-44072967 AGAAGGCTGGGGGCTCAGGAGGG - Intronic
1184370141 22:44076829-44076851 CACAGGCTGGGGGCTGGGGCTGG + Intronic
1184371039 22:44082161-44082183 CGCAAGGTGGGGGCACTGGGCGG + Intronic
1184372310 22:44090290-44090312 AGGAGGAGGGGGGCACAGGCTGG - Intronic
1184651154 22:45920043-45920065 CTCAGGCTGCGGGGACAGGAGGG - Intergenic
1184775634 22:46621468-46621490 CGCAGGCTGGAGGCGTAGCCCGG + Intronic
1184775658 22:46621540-46621562 CGCAGGCTGGAGGCGTAGCCCGG + Intronic
1184775682 22:46621612-46621634 CGCAGGCTGGAGGCGTAGCCCGG + Intronic
1184795663 22:46731172-46731194 TGCAGGGTGGGGGCCCGGGCTGG - Intronic
1185281608 22:49972203-49972225 GCCAGGCTGGGGGCACCGTCGGG + Intergenic
950432246 3:12957583-12957605 GCCAGGCTGGAGGCACAGGCTGG + Intronic
950576521 3:13835314-13835336 AGCAGGGTGGGGGCTCAGTCAGG + Intronic
953251180 3:41246883-41246905 CGAGGGCTGGGGCCACAGGGCGG + Exonic
953680400 3:45034750-45034772 CACAGGCTGTGGTCAGAGGCCGG - Intronic
954257656 3:49417754-49417776 AGGAGGGTGGGGGCACTGGCAGG - Intronic
954402801 3:50327913-50327935 CCCTGGCGGGGGGAACAGGCGGG - Intronic
954468996 3:50675387-50675409 CGCAGCCTGCGGGCAGTGGCGGG - Intronic
954619218 3:51986191-51986213 CGCAGGCTGGCCCCACAGGCAGG - Intronic
954693952 3:52410412-52410434 GGCAGGCTAGGGGAAAAGGCGGG + Intergenic
954705891 3:52480337-52480359 CCCAGCCAGGGGGCCCAGGCAGG - Intronic
955070482 3:55568674-55568696 AACAGGATGGGGGCAAAGGCAGG - Intronic
955387534 3:58491765-58491787 CCCAGGCTGCGGGCGGAGGCGGG + Intergenic
956827733 3:73014485-73014507 CTCAGGCTGGTTGCCCAGGCTGG + Intronic
958980177 3:100710220-100710242 CGCCGGCTGGAGGCCCAGCCTGG + Intronic
960942731 3:122945242-122945264 CACCTGCTGGGGGCAAAGGCAGG - Intronic
961214523 3:125148964-125148986 AGCAGCGGGGGGGCACAGGCAGG + Intronic
961300184 3:125916907-125916929 CGCGGGCTGGCGGCATAAGCTGG + Intergenic
961369096 3:126418852-126418874 CAGGGGCTGGGGGCAGAGGCTGG - Intronic
961383133 3:126508708-126508730 CTCAGCCTGGGGTCAAAGGCAGG + Intronic
961494237 3:127279160-127279182 CTGAGGCTGGGCACACAGGCAGG + Intergenic
962917122 3:139914333-139914355 CTCAGGCTTGGGGCACAGCAAGG + Intergenic
963285903 3:143434550-143434572 GCCAGTCTGAGGGCACAGGCTGG + Intronic
965757333 3:172040017-172040039 CTGAGGCAGGGGGCACAGGCGGG - Intronic
966228656 3:177626269-177626291 AGCAGGCTGGAGACACAGGGAGG + Intergenic
968368496 3:198206179-198206201 CTAAGGCTGGGGGCAAAGGTAGG - Intergenic
968461988 4:730780-730802 CGCAGGCTCTGAGGACAGGCTGG + Intronic
968686178 4:1960442-1960464 CACAGTCTGGGAGCAGAGGCAGG - Intronic
968810503 4:2797639-2797661 ACCAGGCTGGGGGCTCAGGAAGG - Intronic
968911951 4:3480912-3480934 CCCAGGCTGGGGGCACTGCGGGG + Intronic
968958371 4:3730464-3730486 TGGGGGCTGGGGGCACAGGGTGG + Intergenic
969333089 4:6491299-6491321 TGCATGATGGTGGCACAGGCTGG + Intronic
969584957 4:8086135-8086157 CACAGGCTGGGGGAAGGGGCAGG + Intronic
970254449 4:14153250-14153272 CACAGGCAGGGAACACAGGCAGG + Intergenic
972408168 4:38766108-38766130 CCGAGGCTGGGAGCACAGGCGGG + Intergenic
975118411 4:70704658-70704680 CACAGGCTGGGGGCCGGGGCGGG + Intronic
975300714 4:72787597-72787619 CTAAGGGTGGGGGAACAGGCAGG - Intergenic
975748863 4:77502086-77502108 CCAAGGCTGGAGGCTCAGGCTGG + Intergenic
976383882 4:84433260-84433282 TGGAGGCTTGGGGCACAGGGTGG + Intergenic
976930396 4:90559907-90559929 CCCAGGCTGGGGGAACTGCCTGG - Intronic
977682634 4:99812790-99812812 TGCAGGGTGGGCTCACAGGCTGG + Intergenic
979256920 4:118615902-118615924 CTAAGGCTGGGGGCAAAGGTAGG - Intergenic
979543728 4:121916304-121916326 TGCACTCTGGGGGCAAAGGCAGG - Intronic
981013429 4:139949997-139950019 TGCAGGCTGGAAGCATAGGCAGG - Intronic
983937056 4:173509475-173509497 AGGAGGCCGGGGGCAGAGGCCGG - Intergenic
983944996 4:173576052-173576074 GGGAGGCTGGAGGCCCAGGCTGG - Intergenic
985480363 5:106730-106752 CCCAGGGTGGCTGCACAGGCAGG + Intergenic
985757992 5:1730554-1730576 AGCAGGCGGGGGTCAGAGGCAGG + Intergenic
986169364 5:5303378-5303400 AGCAGGCTGAGGGCACAGGCTGG - Exonic
986416055 5:7529369-7529391 GGCAGGCTGGGAGCAGAGGGAGG + Intronic
986424827 5:7620948-7620970 TGCAGGCTGAGGGCAAAGCCAGG - Intronic
988529693 5:32016808-32016830 TGCATGCTGGGGGCCCAGGCAGG - Intronic
988940273 5:36138953-36138975 CGCAGTGTGGGGGGACTGGCGGG + Intronic
991661484 5:68955282-68955304 AGAAGGTTGGGGGCACAGGCCGG + Intergenic
993187202 5:84635754-84635776 CGATGGCGGGGGGCACAGGGAGG - Intergenic
994179006 5:96743488-96743510 CTCAGGCTGGGGGTGCTGGCAGG + Intronic
994615528 5:102099812-102099834 CGCAGGCAGGGGTCACATGTGGG + Intergenic
996747111 5:126854791-126854813 CCCGGGCTGGGGGCGCAGGCCGG + Intergenic
997803593 5:136891039-136891061 ACCAGGCTGGAGGCACGGGCAGG + Intergenic
998154267 5:139775574-139775596 CACAGGCTGGGGGGTCAGGCGGG - Intergenic
998292196 5:140926514-140926536 CGCTGGCTGCGGGCGCAGGGCGG - Intronic
999139150 5:149345904-149345926 CACAGGCTGGGAGAAGAGGCCGG - Intronic
999521609 5:152356744-152356766 CCCAGGCTGGAGGGAAAGGCTGG + Intergenic
1001342704 5:170862184-170862206 CCCCGGCTAGGGGCAGAGGCAGG - Intronic
1001476494 5:172054529-172054551 GGCAGCCTGGGGGCAGGGGCAGG + Intronic
1001480963 5:172089036-172089058 GGCAGGCTCTGGGCTCAGGCTGG - Intronic
1002324755 5:178397083-178397105 TGGAGGCTGGGTGCACAGCCAGG - Intronic
1002422355 5:179155260-179155282 GGCAGGCAGGGGGCAGAGGCAGG - Intronic
1002499164 5:179636080-179636102 AGCTGGCTGGGACCACAGGCAGG - Intergenic
1002502512 5:179656441-179656463 AGCTGGCTGGGACCACAGGCAGG + Intergenic
1002727717 5:181311406-181311428 CTAAGGCTGGGGGCAAAGGTAGG - Intergenic
1002948625 6:1786519-1786541 CCCAGGCTGGGGCCACACACTGG + Intronic
1003201065 6:3960916-3960938 GACAGGCTGGTGGCACGGGCTGG + Intergenic
1003541893 6:7025444-7025466 GGCAGGGTGGGTGCAGAGGCTGG - Intergenic
1003673429 6:8181029-8181051 AGCTGGCGAGGGGCACAGGCGGG + Intergenic
1004225056 6:13777537-13777559 CGCAGGCAGGAGGCTCAGGCAGG - Intergenic
1005562926 6:27059808-27059830 CGGGGGGGGGGGGCACAGGCAGG + Intergenic
1005928628 6:30464691-30464713 CGCAGGGTTGGGGCCCAGGAGGG + Intergenic
1006418399 6:33918793-33918815 CCTAGGCTGGGAGCACAGTCAGG - Intergenic
1007073312 6:39051517-39051539 CCCAGGCTGGGGGCTGGGGCAGG + Intronic
1007548353 6:42710399-42710421 CCCAGGCTGGTGACCCAGGCAGG - Intronic
1007784095 6:44270538-44270560 GGCAGGCTGGGGGGCCGGGCCGG - Exonic
1008370155 6:50722673-50722695 CGCAGGGTGGGGGTACAAGTGGG + Intronic
1012386481 6:98689146-98689168 CCCAGGCGGGGGGCAAAGGAAGG - Intergenic
1012834845 6:104252097-104252119 CTCAGGCTGGAGTTACAGGCTGG - Intergenic
1013366373 6:109440995-109441017 CGCAGGCGGCGCGCACAGGTGGG - Exonic
1013595932 6:111661155-111661177 CGCAGCTTGGTGGCTCAGGCCGG + Exonic
1015802863 6:137078274-137078296 CGGAGGCTGGGGAAATAGGCAGG - Intergenic
1017545963 6:155450811-155450833 CTGTGGCAGGGGGCACAGGCAGG + Intronic
1017834960 6:158168500-158168522 CGGGTGCTGGGGGCACAGGGCGG + Intronic
1019326156 7:439298-439320 AGCAGGCTGGGAGCCCGGGCAGG - Intergenic
1019510313 7:1414381-1414403 AGCCAGCTGGGGGCACAGCCAGG - Intergenic
1019511362 7:1419253-1419275 GCCAGGCTGGGCGTACAGGCAGG - Intergenic
1019539414 7:1545119-1545141 TGGAGGCTGGGGGCACTGGCTGG - Exonic
1019595825 7:1857871-1857893 TCCAGGCTGGGGGCCCAGGGAGG + Intronic
1019618778 7:1979408-1979430 CGGTGGCTGTGGGCACAGGGTGG - Intronic
1019881996 7:3869554-3869576 AGCGGGCTGGGGGCACAGGGTGG - Intronic
1020039034 7:4987381-4987403 GGCAGGCTGGGGTCCCAGTCTGG - Intronic
1020080518 7:5283612-5283634 TGCATGCAGGGGCCACAGGCTGG - Intronic
1020156260 7:5727085-5727107 GGCAGGCTGGGGTCCCAGTCTGG + Intronic
1021984084 7:26082162-26082184 AGGAGGCTGGGGGAAGAGGCAGG + Intergenic
1022127323 7:27371099-27371121 CCCAGGCTGGGTGCAGTGGCAGG - Intergenic
1022199408 7:28102085-28102107 ATCAGGGTGGTGGCACAGGCTGG - Intronic
1022537411 7:31106717-31106739 CACAGGCTGGGACCGCAGGCAGG + Exonic
1022840909 7:34163128-34163150 CTCAGGCTGGTGGCAGAGGTTGG + Intergenic
1023984134 7:45085464-45085486 AGCAGGCTGAGGGAACAGGAGGG + Exonic
1024651535 7:51407479-51407501 CTAAGGCTGGGGGCCAAGGCAGG + Intergenic
1025069719 7:55887716-55887738 CGGAGGCGGGGGGCGGAGGCGGG + Intronic
1025069726 7:55887729-55887751 CGGAGGCGGGGGGCGGAGGCGGG + Intronic
1025069733 7:55887742-55887764 CGGAGGCGGGGGGCGGAGGCGGG + Intronic
1025069740 7:55887755-55887777 CGGAGGCGGGGGGCGGAGGCGGG + Intronic
1025069747 7:55887768-55887790 CGGAGGCGGGGGGCGGAGGCGGG + Intronic
1025069754 7:55887781-55887803 CGGAGGCGGGGGGCGGAGGCGGG + Intronic
1025110438 7:56211832-56211854 CACAGGCTAGGGCCACAGGGAGG + Intergenic
1025133740 7:56393285-56393307 CTAAGGCTGGGGGCCAAGGCAGG + Intergenic
1025198401 7:56948568-56948590 TGCATGCAGGGGCCACAGGCTGG + Intergenic
1025200422 7:56958144-56958166 CTCAGGGTGGGGGCACAGAAAGG - Intergenic
1025671521 7:63618788-63618810 CTCAGGGTGGGGGCACAGAAAGG + Intergenic
1025673549 7:63628365-63628387 TGCATGCAGGGGCCACAGGCTGG - Intergenic
1025839086 7:65127140-65127162 GGCAGGCTGAGGGCACAGAACGG + Intergenic
1025883981 7:65568825-65568847 GGCAGGCTGAGGGCACAGAACGG - Intergenic
1025889464 7:65633781-65633803 GGCAGGCTGAGGGCACAGAACGG + Intergenic
1025962825 7:66238537-66238559 AGCAGGCTGGACACACAGGCAGG + Intronic
1026044465 7:66897053-66897075 CTGAGGCTGGGGGCAAAGGCAGG - Intergenic
1026307478 7:69154577-69154599 CACAGGCTGGGGCCACAGCGGGG - Intergenic
1026774189 7:73220928-73220950 GCCTGGCTGGGGACACAGGCGGG - Intergenic
1027015046 7:74774314-74774336 GCCTGGCTGGGGACACAGGCGGG - Intronic
1027072985 7:75171639-75171661 GCCTGGCTGGGGACACAGGCGGG + Intergenic
1029175411 7:98661259-98661281 GGGAGGCTGGGCACACAGGCTGG - Intergenic
1029666497 7:101998472-101998494 CGATGGCTGGGGGCACCGCCCGG - Intronic
1031852989 7:126888196-126888218 GGCAGGCTGAGGGCACAGAATGG - Intronic
1032016059 7:128381070-128381092 GGGAGGCTGGGGGCAGGGGCTGG + Intergenic
1032239949 7:130152994-130153016 CGCAGGCAGGCAGCACGGGCAGG + Intergenic
1034343129 7:150370404-150370426 GGCAGAATGGGGGCACAGTCTGG + Intronic
1034426517 7:151016916-151016938 AGCAGGCTGGGGGCGGGGGCTGG + Intronic
1034500691 7:151448658-151448680 CGCAGCCAGGGGGCCCGGGCTGG - Intergenic
1034555463 7:151847696-151847718 CCCAGGCTGGGAGCAAGGGCTGG - Intronic
1034578943 7:152025964-152025986 GGCAGGCTGGGGGCGGCGGCGGG + Intronic
1035019830 7:155794338-155794360 CCCACGCTGGGGCCACAGGCAGG - Intergenic
1035023022 7:155809846-155809868 CCCGGGCTGGGGGCTCCGGCTGG + Intronic
1035274158 7:157737492-157737514 CCCGGGCAGGGGGCGCAGGCAGG + Intronic
1035283235 7:157790401-157790423 AGCAATCTGGGGGCACAGGAAGG + Intronic
1035404559 7:158588686-158588708 CGGAGGTTGGGGGCCCAGGTGGG - Intergenic
1035819670 8:2578238-2578260 TGCAGGCAGGAGGCAGAGGCGGG - Intergenic
1036823088 8:11955411-11955433 AGCAGCCTGGGGGCTCAGGACGG + Intergenic
1037799663 8:22025431-22025453 CGCAGGCTGCGAGCTCAGTCAGG + Exonic
1037993951 8:23339591-23339613 GCCAGGCTGGGGGCACTGGTAGG + Intronic
1038811432 8:30849898-30849920 CGGGGGCTGGGGGCAGAGGTGGG + Intronic
1039436660 8:37564153-37564175 CGGAGGCTGGGGGCACACGGAGG + Intergenic
1040386513 8:46918150-46918172 AGCAGGCTGGCGGGAGAGGCGGG + Intergenic
1040531605 8:48270839-48270861 GGTAGGCTCGGGGCACAGGTCGG + Intergenic
1041006744 8:53503162-53503184 CACAGCCTGGGGGCAGAGGAAGG - Intergenic
1041020527 8:53633728-53633750 TGCATGCTGGGAGCACAGGCAGG - Intergenic
1044417879 8:91956436-91956458 CTCAGGCTGGGGTCACTGGTGGG + Intronic
1047228918 8:122979564-122979586 CAGGTGCTGGGGGCACAGGCAGG - Intergenic
1047441681 8:124884343-124884365 GGCAGGCGGGGGGCACAGTGAGG + Intergenic
1047770751 8:128028126-128028148 TGCAGGCTGGGGGACCTGGCTGG - Intergenic
1048317265 8:133371505-133371527 CACAGGTTGGGGGCATAGGCAGG + Intergenic
1049189481 8:141278972-141278994 CACAGGCTGGGGGCCAAGGTGGG - Intronic
1049204503 8:141357429-141357451 GGCAGGCTGGCGGCAGCGGCGGG + Exonic
1049645484 8:143733929-143733951 CGCGGGCCGGGGGCGCGGGCTGG - Intergenic
1049708147 8:144052132-144052154 CGGAGGCTGGGGGCACGGCCGGG - Intronic
1051314458 9:15813079-15813101 CGCAGCCTGTGGGCAGAGACTGG + Intronic
1052976803 9:34417109-34417131 CCCAGGCTGGTTGCCCAGGCTGG + Intronic
1053141262 9:35684310-35684332 CTCAGCCTGGGGGTAAAGGCAGG + Exonic
1056047378 9:82733124-82733146 AGCAGGCTGGGGTCAAAGGAAGG - Intergenic
1056825439 9:89873498-89873520 GGAAGGCTGGGGGCTCACGCTGG + Intergenic
1056926716 9:90840412-90840434 AGCAGGCTGGGGGCAGTGGCTGG + Intronic
1057151176 9:92797470-92797492 CCCAGGCTGTTGACACAGGCAGG + Intergenic
1057198248 9:93126969-93126991 AGGAGGCCGGGGGCACAGACCGG - Intronic
1057398908 9:94704917-94704939 CCCAGGCTGGGAGTACAGCCTGG + Intergenic
1057828871 9:98392133-98392155 CTCAGCCTGGGGGCAGAGCCCGG + Intronic
1058388107 9:104462264-104462286 TGGACGCTGGAGGCACAGGCAGG + Intergenic
1059429714 9:114242566-114242588 CTCGGGCTGAGGGCCCAGGCAGG - Intronic
1059733031 9:117075337-117075359 CCAAGGCTGGCGGCCCAGGCTGG + Intronic
1060191801 9:121598574-121598596 CGCAGGCTGGAGGCCCCAGCAGG - Intronic
1060196921 9:121629722-121629744 ACCAGGCTGTGGGCACAGGCTGG + Intronic
1060817120 9:126640840-126640862 CGCAGGCTGGGTGGCCAGCCAGG + Intronic
1060938387 9:127528938-127528960 AGCAGGCTTGTGGCCCAGGCAGG + Intronic
1061097716 9:128469420-128469442 CGCAGGCTGAGGGACCAGGCAGG - Intronic
1061150106 9:128823529-128823551 CCCAGTCTGGGAGCACAGGACGG + Intronic
1061187251 9:129061834-129061856 CCCAGGCTGTGGGGACAGACAGG + Intronic
1061235117 9:129337590-129337612 GGCAGATTTGGGGCACAGGCAGG - Intergenic
1061375239 9:130220107-130220129 GGAGGGCTGGGGGCAGAGGCTGG + Intronic
1061481260 9:130898757-130898779 CACAGGTTGGGGGCAGAGGTGGG - Intergenic
1061799971 9:133108532-133108554 CACAGGCAGGGACCACAGGCAGG - Intronic
1061805110 9:133133427-133133449 CCCAGGCTGGCGGCAGAGGCAGG - Intronic
1061896109 9:133648674-133648696 CGCTGGGTGGAGGCACAGGTTGG + Intronic
1062219067 9:135404593-135404615 AGCAGGCAGGAGGCCCAGGCAGG + Intergenic
1062219071 9:135404606-135404628 CCCAGGCAGGAGGCCCAGGCAGG + Intergenic
1062219076 9:135404619-135404641 CCCAGGCAGGAGGCCCAGGCAGG + Intergenic
1062349767 9:136133103-136133125 AGTAGGCTGGGGGGGCAGGCCGG - Intergenic
1062393381 9:136342813-136342835 CCAGGGCTGGGGGCACAGGAGGG + Intronic
1062462553 9:136668013-136668035 CACAGCCTGGGGGCACAGGGGGG - Intronic
1062477592 9:136736368-136736390 CGCAGGCTGGCTGCAGAGGCAGG - Intergenic
1062566945 9:137167713-137167735 CCCACGCTGGGGGCACGCGCGGG - Intronic
1062617228 9:137403356-137403378 CTGAGTTTGGGGGCACAGGCAGG + Intronic
1062625279 9:137439649-137439671 TGCTGGTTGGGGACACAGGCTGG - Intronic
1062752837 9:138268884-138268906 CTAAGGCTGGGGGCAAAGGTAGG - Intergenic
1203575354 Un_KI270745v1:3659-3681 CTAAGGCTGGGGGCAAAGGTAGG - Intergenic
1185833652 X:3324257-3324279 GGCAGGCTCGGGGCAGAAGCTGG - Exonic
1186473564 X:9839523-9839545 CTTGGGCTGGGGACACAGGCAGG - Intronic
1189354142 X:40298733-40298755 CGCAGGGCAGGAGCACAGGCTGG + Intergenic
1190049368 X:47138282-47138304 CCCAGGATGAGGGCAGAGGCTGG - Intergenic
1192358200 X:70422991-70423013 CGAGGGCTGAGGGCACAGGCTGG - Intergenic
1195655164 X:107325724-107325746 GGCAGGCATGGGGCCCAGGCTGG + Intergenic
1195699286 X:107690414-107690436 AGCAGGCTGGTAGCACAGACTGG - Intergenic
1197034190 X:121854377-121854399 CGCAGGAGAGGGGCACTGGCGGG - Intergenic
1199942192 X:152637771-152637793 CGCAGGCTACGGGCGGAGGCAGG + Intergenic
1200053549 X:153446914-153446936 CCCATGCTGGGGGCACAGAGAGG + Intronic
1200064827 X:153499350-153499372 CGCCGACTGTGGGGACAGGCTGG + Intronic
1200076437 X:153553598-153553620 CACAGGTTTGGGGCACAGGGTGG + Intronic
1200089887 X:153629815-153629837 AGCAGGCTGGGGGCACAGCATGG - Intergenic
1201242070 Y:11968778-11968800 GGCAGGCTCGGGGCAGAAGCTGG + Intergenic