ID: 922776712

View in Genome Browser
Species Human (GRCh38)
Location 1:228217661-228217683
Sequence TCTCATGTGCAGGGAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 388
Summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 353}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922776708_922776712 25 Left 922776708 1:228217613-228217635 CCTTGTTACAGATGACAGAGGCA 0: 1
1: 1
2: 1
3: 36
4: 335
Right 922776712 1:228217661-228217683 TCTCATGTGCAGGGAGAAGAAGG 0: 1
1: 0
2: 4
3: 30
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922776712 Original CRISPR TCTCATGTGCAGGGAGAAGA AGG Intronic
902207842 1:14882669-14882691 CTCCACGTGCAGGGAGAAGAAGG - Intronic
902521752 1:17021980-17022002 TCTGATGTGCAGGCATGAGAAGG + Intronic
902647284 1:17808872-17808894 CTTCAGGTGCATGGAGAAGATGG + Intronic
902814894 1:18910631-18910653 ACCCATGTGCAGAGAGCAGAGGG - Intronic
903020627 1:20391360-20391382 TCTAAGGTGCAGGGAGCAGATGG - Intergenic
903135521 1:21307079-21307101 TCTTGAGTGCAGGGAGACGAGGG - Intronic
903608876 1:24595462-24595484 GGTCATGTTCAGTGAGAAGAAGG - Exonic
905915069 1:41678904-41678926 CCAGATGTCCAGGGAGAAGAAGG + Intronic
907373401 1:54017417-54017439 TCTCTTGGGCAGGGAGAGAATGG - Exonic
907470128 1:54668405-54668427 CATCATGTTAAGGGAGAAGAAGG - Intronic
908057192 1:60300762-60300784 TCTCATGTTCATGGATCAGAAGG - Intergenic
908138456 1:61157316-61157338 TCTCTTTTGCAGGGAGTGGAGGG - Intronic
910048211 1:82943402-82943424 TGTCCTGTACAAGGAGAAGAAGG + Intergenic
910720686 1:90282943-90282965 TCTCATGACCGTGGAGAAGAAGG + Intergenic
911711260 1:101076303-101076325 TCTCAGTTGCAGGGATAAAAGGG + Intergenic
911805008 1:102194779-102194801 TCTCATGACCAGGGAGAATTAGG - Intergenic
912183997 1:107252599-107252621 ACTCATGTGCAAGAAGAATAGGG - Intronic
912465748 1:109872489-109872511 ACTGATGTGCAGAGAGAACAAGG + Intergenic
914326161 1:146618884-146618906 TCTCCTGTTCTGGGAAAAGAAGG + Intergenic
915029188 1:152861545-152861567 TCTCATGCTCAGGAAGGAGATGG + Intergenic
915164752 1:153942274-153942296 CCCCATGGGCAGGCAGAAGACGG + Exonic
915489416 1:156242963-156242985 CCCCATGTGTAGGGAGAGGAGGG + Intronic
916078166 1:161215188-161215210 TCTCTTGTGCAGGAAGGGGAAGG + Intergenic
916886157 1:169070462-169070484 TTTCATGTGCCAGGGGAAGAAGG - Intergenic
917154923 1:171986149-171986171 TTACATGTGCAGGGAGAAAGAGG - Intronic
922776712 1:228217661-228217683 TCTCATGTGCAGGGAGAAGAAGG + Intronic
923065086 1:230510143-230510165 TCTGATCTCCAGGGAGAAGAAGG - Intergenic
923845588 1:237728017-237728039 TATGATGTGCAAGGAGTAGAGGG - Intronic
924307298 1:242703378-242703400 TCTCTTTTCCAGGGAAAAGAAGG - Intergenic
924708931 1:246518757-246518779 GCTCAGGTGCAGGGAGAGGCAGG - Intergenic
1063712084 10:8489417-8489439 TCTCATATGCAGTGTGAGGATGG + Intergenic
1063903861 10:10763294-10763316 TCTCATGTGCAGTGAGTGGGAGG - Intergenic
1066338460 10:34504894-34504916 TATCAAGTGCAGCGAGAAGAGGG + Intronic
1067175163 10:43940731-43940753 TTTCATGTGCAAGTAGAAGCTGG - Intergenic
1067218946 10:44327745-44327767 CCTCATGTGAAGGGTGGAGAGGG + Intergenic
1067225359 10:44372813-44372835 TCCCATGTGGATGGAGAAGGGGG + Intronic
1067770404 10:49118686-49118708 CCAGTTGTGCAGGGAGAAGACGG - Intergenic
1068188565 10:53619636-53619658 TCTCATGACCAGGGAGAATTAGG + Intergenic
1068337707 10:55659065-55659087 TCTTATTTGAAGGGAGAGGAGGG - Intergenic
1068505903 10:57898712-57898734 TCTCATGGCCATGGAGAACAGGG - Intergenic
1071506012 10:86232031-86232053 ACCCAAGTGCAGTGAGAAGAGGG - Intronic
1071948692 10:90677992-90678014 TCTCATGTGCATAGAGAAAATGG + Intergenic
1074302719 10:112247624-112247646 TCTCTTGACCAGGGAGAAGCAGG + Intergenic
1074780700 10:116800088-116800110 TCTCATTTTCTGGGAGAAGCGGG - Intergenic
1075021219 10:118953863-118953885 TCTCACTTGCTGGGAGGAGATGG - Intergenic
1075360674 10:121830138-121830160 TCTCATGTGCAAGTATAACATGG + Intronic
1076838414 10:133032727-133032749 TCCCATGAGGAGGGAGAAGGGGG - Intergenic
1079081251 11:17415101-17415123 TCTTATGTGAAGGGAGTAAATGG + Intronic
1079115437 11:17637937-17637959 TCTCATTTGCTGGGAGAACAAGG - Intronic
1080537000 11:33231416-33231438 TCTCATCTGTAGTGAAAAGAGGG - Intergenic
1081105111 11:39057810-39057832 CTTTATGTGCAGGTAGAAGAGGG - Intergenic
1082015197 11:47480457-47480479 TCTCATTTGGAGGGAAATGAAGG - Intronic
1082704749 11:56479644-56479666 TCTCAAATGCATGCAGAAGAGGG + Intergenic
1083331537 11:61900619-61900641 GCTCATGAGCAGGGAGTAGCAGG + Intronic
1083896093 11:65620541-65620563 TCAGATCTGCAGGGAGAGGATGG + Intronic
1084644754 11:70449334-70449356 TGTCAGGGGCTGGGAGAAGAAGG + Intergenic
1084899465 11:72298869-72298891 TATAATGTGCAGAGAAAAGAGGG - Intronic
1085444586 11:76591919-76591941 GATCATGTTCAGGGAGCAGAGGG - Intergenic
1086920942 11:92585948-92585970 TCTCATGTGAAGGGAGAAGGTGG + Intronic
1088607053 11:111541881-111541903 TCTCATTTGCAGGAAGGCGAAGG - Intronic
1088749975 11:112835193-112835215 TCTGATATGAAGGAAGAAGAGGG - Intergenic
1088933263 11:114373637-114373659 TCTCATGTGCCTGGAGCTGAGGG - Intergenic
1091121605 11:133062600-133062622 TCTCATCTGTAGGGAAAGGAGGG - Intronic
1091124989 11:133086497-133086519 TTTCATCTACAGGAAGAAGATGG - Intronic
1091255051 11:134176383-134176405 CCTCCTGTGCAGAGAGAAGCCGG + Exonic
1092744282 12:11659100-11659122 TTTCAAGAGCAGGGAGTAGATGG + Intronic
1093705774 12:22273529-22273551 TCTCATGACCAGGAAGAAGTAGG - Intronic
1093953240 12:25188260-25188282 TCCCATAGGCAGGGAGAAAAGGG + Intronic
1094132482 12:27089331-27089353 TTTCAGGGGCAGGGAGAGGATGG + Intergenic
1094780399 12:33785635-33785657 TTTCATGAGCAGGGAGAAGAAGG - Intergenic
1096785944 12:54017489-54017511 TCTCTTGGTTAGGGAGAAGAGGG + Intronic
1097178463 12:57157005-57157027 TCTGACATGCAGGGAGATGAAGG + Intronic
1097859801 12:64507409-64507431 TCGCATGGGCAGGGAGGAGTGGG + Intergenic
1098790621 12:74817305-74817327 TCCCATGTCCAGGGAGAATGAGG - Intergenic
1099940525 12:89182748-89182770 CCTCATTTGCAGGGAGGAAATGG - Intergenic
1101422669 12:104562395-104562417 ACTCAGGTGCAGGGGGAAGATGG - Intronic
1101739551 12:107490286-107490308 TATCATGGGCAAGGAGCAGATGG + Intronic
1101741103 12:107500662-107500684 TCTCATGTGCAGCCATGAGATGG - Intronic
1102022367 12:109692740-109692762 TCTCAAGTGCAGGCAGATGAAGG - Intergenic
1102885571 12:116519176-116519198 TTTTGTTTGCAGGGAGAAGAAGG - Intergenic
1103221088 12:119246176-119246198 TCTCATGAGAAGGGAGTAGCAGG - Intergenic
1103913722 12:124365421-124365443 GCTCATCTGCAGGAAGGAGATGG - Intronic
1104035560 12:125094902-125094924 TCTGGTGTGCAGGGATCAGAGGG - Intronic
1105846870 13:24300993-24301015 TCTAATGTGCATGGAGATTAGGG - Intronic
1108215225 13:48177183-48177205 CCTCATGTCCAGAGGGAAGACGG + Intergenic
1109029954 13:57179059-57179081 TCTTGTGTGCAGGAAGAATAAGG + Intergenic
1109068692 13:57735384-57735406 TCTCAGCTGCAGGGAGATGCTGG - Intergenic
1109780826 13:67107680-67107702 TCTCATGTCCAGGAAGAATGAGG - Intronic
1112260821 13:97876429-97876451 TCTCATGTCCATGGAGAACGAGG - Intergenic
1113753318 13:112791408-112791430 CCTCATCTGCAGGGAGAACCAGG - Intronic
1113822366 13:113223767-113223789 TCAGATGTGCAGGTAGAAAAAGG + Intronic
1114400116 14:22402368-22402390 TTTTAGGTGCAGGGAGAAGTGGG - Intergenic
1114526236 14:23368345-23368367 TGCCATATTCAGGGAGAAGAAGG + Intergenic
1114632243 14:24166572-24166594 TCTGATTTTCTGGGAGAAGAAGG + Exonic
1115914096 14:38290567-38290589 TCTCATTTGAAGGGAGATCAGGG + Intergenic
1116159707 14:41253289-41253311 TCTCATGTCCAGGAAGAATAAGG + Intergenic
1118382730 14:65230505-65230527 TCTCATTTGCTTGGAGAACAAGG + Intergenic
1119005465 14:70923501-70923523 GATCATGTGCAGGTAGAAAACGG - Intronic
1119421136 14:74508724-74508746 TCACATCTGCAGGGAAAAGATGG + Exonic
1120386862 14:83857534-83857556 TTTCATGTGCGGGGAGGAGGTGG - Intergenic
1120756365 14:88248134-88248156 TCTCAAGTGCAGAGAGAGCAAGG - Intronic
1121321759 14:92995651-92995673 ACTTATGTGCAGGGAGAGGATGG - Intronic
1121651757 14:95564043-95564065 TCTCATGGGCAGGGAGTGGTAGG + Intergenic
1121655629 14:95593581-95593603 AGTCATGTGCAGTGAGACGACGG - Intergenic
1123826406 15:24086572-24086594 TCTCATGTCCAAGGAGAATGAGG + Intergenic
1124080191 15:26486981-26487003 GCTGAGGTGCAGCGAGAAGATGG + Intergenic
1124560798 15:30771571-30771593 TCGCAGGTCCAGAGAGAAGAGGG + Intronic
1125241607 15:37582733-37582755 TCCCATGTCCAGGAAGAATAAGG - Intergenic
1125430193 15:39585985-39586007 TTTCATCTGTAGGGATAAGAGGG + Intronic
1125485846 15:40110233-40110255 TTACCTGTGCAGGGAGCAGAGGG + Intergenic
1126189955 15:45868861-45868883 CCTCATATTCAGGGAGAAGCAGG + Intergenic
1127414812 15:58748560-58748582 TTTCATGTGCAGGGGGGAGGGGG + Intronic
1129221061 15:74131818-74131840 GCTCCTGTGAGGGGAGAAGAAGG - Intronic
1129664543 15:77572239-77572261 TCTCTGGTGCAGGGAGAAGATGG + Intergenic
1129888431 15:79055042-79055064 TCTCCTCAGCAGGGAGGAGAAGG + Intronic
1130008875 15:80131262-80131284 TTTCATGTGCAGGAAGAAAGTGG + Exonic
1130709338 15:86264413-86264435 CCTTCTGTGCAGGGTGAAGACGG + Exonic
1131532158 15:93203031-93203053 CCTCTTGGGCAGAGAGAAGAAGG - Intergenic
1131591929 15:93759266-93759288 CCTCATTTGCAGGGACAATAAGG + Intergenic
1131815006 15:96213034-96213056 TCTCAGCTGCAGTGAGAAAAGGG - Intergenic
1132011364 15:98279477-98279499 TCTGATCTGCAGAGAGAAGGTGG + Intergenic
1132062746 15:98705907-98705929 TCTGATGGTCAGGGTGAAGAGGG - Intronic
1133767137 16:8845979-8846001 TCACATGTGTAGGTAGCAGATGG + Intronic
1134183305 16:12064434-12064456 TCCCATCAGCAGTGAGAAGATGG - Intronic
1135183127 16:20292181-20292203 GGTCAAGTGCAGGGAGAGGAGGG - Intergenic
1135351168 16:21730330-21730352 TCTATTGAGGAGGGAGAAGAAGG + Intronic
1135449648 16:22546457-22546479 TCTATTGAGGAGGGAGAAGAAGG + Intergenic
1135886895 16:26318382-26318404 TCTGATGTTCAGGAAGAAGAAGG + Intergenic
1136174551 16:28507923-28507945 TCCCATCTTCAGGGAGAGGATGG + Intronic
1137476716 16:48815727-48815749 TGTCCTTTGCAGGGACAAGATGG + Intergenic
1138284136 16:55794916-55794938 TCTCACCTGCAGGCAGGAGACGG + Intergenic
1138284866 16:55802071-55802093 TCTCACCTGCAGGCAGGAGACGG - Intergenic
1139939215 16:70592372-70592394 TCTCATGGGCAGAGAGAGGAGGG - Intronic
1140007406 16:71092062-71092084 TCTCCTGTTCTGGGAAAAGAAGG - Intronic
1140585790 16:76290276-76290298 TCACAGATGCAGGGAGAAGATGG - Intronic
1140712376 16:77690509-77690531 TCTCATGTGGCGGGAGCAGGAGG + Intergenic
1141884424 16:86881995-86882017 TCTGCTGTGCAGAGAGAAGCTGG - Intergenic
1142414632 16:89934710-89934732 TGACCTGTACAGGGAGAAGAGGG - Exonic
1142735325 17:1894768-1894790 TGTCAGGGCCAGGGAGAAGAGGG - Intronic
1145824977 17:27870034-27870056 TCTCATGACCAGGAAGAAGTAGG - Intronic
1146160040 17:30554849-30554871 GCTCAGGTGCAGGGAGAGGCAGG + Intergenic
1146297956 17:31665058-31665080 TCTCATGAGGTGGGAGAAGGGGG - Intergenic
1147551746 17:41448023-41448045 TCTCATCTGCAATGAGAGGAGGG + Intergenic
1147639619 17:41987787-41987809 TCTGATGGGTAGGGGGAAGAGGG - Intronic
1149077361 17:52611840-52611862 TCTCTTGTGAAAGGATAAGAAGG - Intergenic
1151140448 17:71986464-71986486 TGTCAAGTGCAGAGAGAAGATGG + Intergenic
1151411751 17:73935086-73935108 TCACATTTGCATGGAGAAGATGG + Intergenic
1151964701 17:77425338-77425360 TCTCAGCTGCAGGCAGGAGAGGG - Intronic
1152241807 17:79164880-79164902 ATTCTGGTGCAGGGAGAAGAGGG - Intronic
1153257573 18:3187574-3187596 ACTCAGGAGCATGGAGAAGATGG + Exonic
1153955577 18:10093006-10093028 ACAGATGTGCACGGAGAAGAAGG + Intergenic
1155151916 18:23129821-23129843 TCTCCTGTGTAGGGAGAAGAGGG + Intergenic
1156145357 18:34169411-34169433 TTTAATGTGCAGGAAAAAGAAGG + Intronic
1156662709 18:39365930-39365952 TCACATGGCCAGGGAGGAGAAGG - Intergenic
1158414881 18:57241410-57241432 TCTCATCTTCAGGGAGCACATGG + Intergenic
1160153485 18:76412998-76413020 TCTCATGTCTAAGGAGAAGTGGG - Intronic
1160629830 18:80239122-80239144 ACTGATGTGAAGGGAGAATAAGG + Intronic
1161393596 19:4033487-4033509 GTTCATCTGCAGGTAGAAGACGG - Exonic
1162259234 19:9518902-9518924 TCTCTTCTTCAGGGAGAAGCTGG - Intergenic
1163252896 19:16137041-16137063 TCTCATGGCCATGGAGAACAAGG - Intronic
1163690396 19:18735488-18735510 TCTCAACTGCAGGGAGCAGATGG + Intronic
1165741181 19:38206210-38206232 GATCTTCTGCAGGGAGAAGAAGG + Exonic
1166732437 19:45066814-45066836 TGTCCTGAGCAGGGAGAGGATGG + Intronic
1166748445 19:45153140-45153162 TTTCATGTGCGAGGTGAAGAAGG - Exonic
1168423827 19:56223016-56223038 TGTCAGGTGCAGGGAGACGTTGG - Intronic
925021615 2:574054-574076 GCTGGTGTGCTGGGAGAAGATGG + Intergenic
925632745 2:5912296-5912318 TCTCATGGGCATGGTGAAGCAGG - Intergenic
925735722 2:6961969-6961991 TTTCATGGCCAGGGAGAACAAGG + Intronic
927385791 2:22532538-22532560 TCTAGTGTGCATGGAAAAGAGGG - Intergenic
927611159 2:24542294-24542316 TCTGATGTTCAAGGATAAGAGGG + Intronic
927937585 2:27084320-27084342 CTTCATGAACAGGGAGAAGATGG - Intronic
928142865 2:28745658-28745680 GCTCTTGTGCAGGAAGGAGAGGG + Intergenic
929057169 2:37888407-37888429 TCCCATGTGATGGGGGAAGATGG + Intergenic
929571296 2:43024676-43024698 TCTCCAGAGCAGGGAGCAGAGGG + Intergenic
929654383 2:43716005-43716027 TCACATGTGCTCAGAGAAGAAGG + Intronic
929849020 2:45565008-45565030 TCCCATGTTCAGGGATCAGAGGG + Intronic
930593685 2:53359063-53359085 TCTCATATGAAGGCAGAAGTTGG + Intergenic
931073184 2:58678183-58678205 CCTCATGTGCAGGTAAAAGCTGG - Intergenic
931077969 2:58737464-58737486 TCACATTTGCAGGAGGAAGATGG - Intergenic
932484564 2:72075826-72075848 TTTCATGTAGAGGGAGATGATGG - Intergenic
932708959 2:74048011-74048033 TGTCATCGGCAGGGGGAAGAGGG - Exonic
933368896 2:81390065-81390087 TCTCATGGCCATGGAGAACAAGG - Intergenic
933863312 2:86492114-86492136 TCCAATGTGCAGGGAGATTAAGG - Exonic
937501652 2:122485776-122485798 TGTCATCTCCAGGGAAAAGAAGG + Intergenic
937770966 2:125720780-125720802 GCTTATGTTCAGAGAGAAGATGG + Intergenic
937920043 2:127122418-127122440 GCTGATGTGCAGGGAGAGGGAGG - Intergenic
938097843 2:128475105-128475127 TCCCCTCTGCTGGGAGAAGATGG - Intergenic
940078247 2:149768638-149768660 TCTCATGTGGTGGGAGGAAAGGG - Intergenic
942867995 2:180699256-180699278 TCCCATGTCCAGGGAGAATGAGG + Intergenic
944561270 2:200940902-200940924 TTTCTTTTGCAGGGGGAAGAGGG - Intronic
944869309 2:203893791-203893813 TCTCATGAGCATCCAGAAGATGG + Intergenic
945106778 2:206323726-206323748 TGTCATGTGCTGGGAGAATAAGG - Intergenic
946211631 2:218151912-218151934 TCTGATGTCCAGGGAGGAGGTGG - Intergenic
946876830 2:224137962-224137984 CCTCATGACCAGGGAGAAGGGGG - Intergenic
947268030 2:228303995-228304017 CCTCATGAGCATGGAGAAGTAGG + Intergenic
947653868 2:231809882-231809904 TCTCATATGCAAAGCGAAGATGG - Intergenic
948432783 2:237930666-237930688 TCTCATGTCCAGGAAGAATGAGG - Intergenic
1168880678 20:1203810-1203832 TCTCAGGTTCAGGGATAAGTAGG + Intronic
1169292821 20:4367268-4367290 TCACATGTTCAGAGAGCAGAGGG - Intergenic
1170315203 20:15033404-15033426 TCACATGGGCAGGCAGAGGAAGG + Intronic
1170362304 20:15559601-15559623 TCTCATGGGAAGAGAGATGACGG + Intronic
1171157625 20:22890854-22890876 TTTAATGTGCAGGGAGAGGTGGG - Intergenic
1171417578 20:24993498-24993520 TCCCAGGTGCTGGGAGACGATGG + Intergenic
1171791205 20:29526914-29526936 TCTGATGAGCGGAGAGAAGAAGG + Intergenic
1172466344 20:35157901-35157923 TTTCAAGTACAGGGTGAAGAAGG - Intergenic
1175133138 20:56804389-56804411 TGGCGTGTGGAGGGAGAAGAAGG - Intergenic
1175682049 20:60996050-60996072 TGTCATTGGCGGGGAGAAGAGGG - Intergenic
1175945815 20:62558225-62558247 TCTCAAGGGCAGGGATCAGAGGG + Intronic
1176080059 20:63267948-63267970 TCTCAAGTGGAGGGTGCAGAGGG + Intronic
1176260607 20:64177650-64177672 TCTCCAGGGCAGGGACAAGAGGG + Intronic
1177160246 21:17539486-17539508 ACTAATGTGGAAGGAGAAGAGGG - Intronic
1177349302 21:19914108-19914130 TCTGATGTGCAGGCAGAAAAAGG + Intergenic
1178093279 21:29187113-29187135 TTCCATGTGCAGGGAGAGCATGG + Intergenic
1178118277 21:29440076-29440098 TGTCATGGGGTGGGAGAAGAGGG - Intronic
1179037666 21:37773441-37773463 TCTTATGAGTAGGGAGCAGAGGG + Intronic
1180061553 21:45387969-45387991 TCTCATGTGCCGGGAGAACGAGG + Intergenic
1181177941 22:21048266-21048288 TCCCATGTGCTAGGTGAAGAGGG - Intronic
1182194497 22:28502217-28502239 TCTCAGGTGCAGGGATAATGGGG - Intronic
1183654686 22:39177708-39177730 TCTCAAGGGCAGGCAGAAGGAGG - Intergenic
1183872219 22:40748611-40748633 TCTCATGTGCAAGAAGAATGAGG - Intergenic
1184326119 22:43787624-43787646 TCCCATGTTCATGGATAAGATGG + Intronic
1184372794 22:44093231-44093253 TCACTGGTGCAGGGAGATGAGGG + Intronic
1184790432 22:46696450-46696472 TCTCAAGTGCAGGGGGCAGGGGG + Intronic
1184876059 22:47276409-47276431 ACTCATGTGGAGGGAGGACATGG - Intergenic
1184889032 22:47368342-47368364 TCTCTTGTTCAAGCAGAAGAGGG + Intergenic
1185018260 22:48358237-48358259 CATCATGTGCAGGGAGCAGGTGG - Intergenic
949110771 3:257930-257952 TCTCATCTTGAAGGAGAAGATGG + Intronic
950578332 3:13846588-13846610 TTTCATTTGCTGGGAGAATATGG - Intronic
950869835 3:16219231-16219253 GGTCATGTGTTGGGAGAAGAAGG - Intronic
953174052 3:40533070-40533092 GCTCATGAGGAGTGAGAAGAAGG - Exonic
953337071 3:42102525-42102547 TCTCATGACCAGGGAGAAGTAGG + Intronic
954757213 3:52847586-52847608 TCTCATGTAAATGAAGAAGAGGG - Intronic
955770888 3:62383889-62383911 TCTCAAGAGCAGGGAAGAGAAGG - Intergenic
956118600 3:65943195-65943217 TTTCTTTTGCTGGGAGAAGATGG + Intronic
956253986 3:67264264-67264286 TCTCATGGCCATGGAGAACAAGG - Intergenic
959188444 3:103077936-103077958 TCTTATATGCTGGGAGAAGTAGG - Intergenic
959568759 3:107859574-107859596 TCTGATGTTCAAGGAGAGGAAGG - Intergenic
961656939 3:128448038-128448060 GCTCTGGTGCAGGTAGAAGAAGG - Intergenic
962017248 3:131454327-131454349 GCTCAGGTGATGGGAGAAGAGGG + Intergenic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
963616916 3:147551751-147551773 TCACATATGCGGAGAGAAGAGGG + Intergenic
963791164 3:149583800-149583822 TCAAATGAGCAGGGAGAAGGTGG + Intronic
965770462 3:172176535-172176557 TTTCATGTACAGGAAGAGGAAGG + Intronic
966267818 3:178067700-178067722 TTTCATATGCAGGCAGAAAATGG + Intergenic
967337124 3:188357018-188357040 TTGCATGTGTATGGAGAAGAAGG - Intronic
967388019 3:188929347-188929369 TCTCCTGGTCAGGCAGAAGAGGG - Intergenic
968496932 4:923671-923693 TCTCAAGGGCAGGGAGTGGAGGG + Intronic
969299257 4:6287876-6287898 TCTCCTCTTTAGGGAGAAGAGGG - Intronic
969842595 4:9893388-9893410 TCTCATTTGCAGGGGGAGGGCGG + Intronic
969943539 4:10759504-10759526 GCTAAGATGCAGGGAGAAGATGG + Intergenic
971669768 4:29542295-29542317 TCTCATGTCCAGGAAGAATGAGG + Intergenic
971876788 4:32318541-32318563 TCTCATGTCCAGGAAGAATGAGG + Intergenic
972782469 4:42297902-42297924 TGTACTGTGGAGGGAGAAGATGG + Intergenic
974695705 4:65367820-65367842 TCTATTGTGCAGGGTGATGAAGG - Intronic
974846190 4:67353317-67353339 TCCTATGAGTAGGGAGAAGATGG + Intergenic
976565108 4:86544057-86544079 GCTCATGTGGAGGGAGAGAATGG + Intronic
976647403 4:87400282-87400304 TCCCATGTCCAGGAAGAAGGGGG - Intergenic
976727409 4:88228170-88228192 TCTCCTGTTCAGGAAGCAGATGG + Intronic
977335593 4:95694354-95694376 TCTAAAGAGGAGGGAGAAGAAGG - Intergenic
977424254 4:96846396-96846418 TCTAATGTTCAGGGATAAGAGGG - Intergenic
980197426 4:129608845-129608867 TCTCATTTGAAGGGAGATCAGGG - Intergenic
981341953 4:143631752-143631774 TTTAATATGGAGGGAGAAGAAGG + Intronic
981557423 4:146009945-146009967 TGTCTAGGGCAGGGAGAAGAAGG - Intergenic
982702426 4:158671731-158671753 TCTGAAGAGGAGGGAGAAGAGGG + Exonic
983648447 4:170015648-170015670 TCACATCTGCAGTGAGATGAGGG - Intronic
985170054 4:187139135-187139157 TCTCATGCCCAGGAAGAAGAGGG + Intergenic
986060806 5:4188442-4188464 GCCCATCTGCAGGGAGCAGAGGG + Intergenic
986333432 5:6734834-6734856 TCCCTTGCACAGGGAGAAGAGGG - Intronic
987065221 5:14283358-14283380 TCATATGTGAAGGGAGAACATGG + Intronic
988658830 5:33242082-33242104 TAGCAAGTGCAGGGAGAGGAAGG - Intergenic
989417462 5:41196428-41196450 TATGATGTCCAGGGAGAAGGAGG + Intronic
989828313 5:45886217-45886239 TTTCATGAGCTGAGAGAAGAAGG - Intergenic
990054779 5:51559356-51559378 TATCATGTGCAGGGGGGAGTAGG + Intergenic
990508173 5:56465653-56465675 TCCCCTGGGCAGGGAGATGATGG - Intronic
990916806 5:60915357-60915379 TCTCTTTTGCAGGTAGGAGAGGG + Intronic
994450657 5:99937832-99937854 TCTCCTGTTCAGAAAGAAGATGG + Intergenic
994945947 5:106392119-106392141 TCTGGAGTGCAGGGAGAAAATGG + Intergenic
995457549 5:112368267-112368289 TCTCAAGTGCAAGGGGATGAGGG - Intronic
995633700 5:114161986-114162008 TTTCATGAGCTGAGAGAAGAAGG - Intergenic
996213974 5:120845318-120845340 TCTCATTTGCAGGATGAAGAGGG + Intergenic
996819322 5:127608672-127608694 TCTCCTGTGCAAGGATATGAAGG - Intergenic
997200327 5:132006133-132006155 GCTTAGGTGCAGGGAGAGGAAGG + Intronic
997242193 5:132315606-132315628 TCCCACATGCAGGGTGAAGAAGG + Intronic
998539418 5:142965853-142965875 TCTCGTGTACTGGGAGTAGAGGG + Intronic
999038903 5:148384940-148384962 TCTCAAGTTCAGAGAGAGGAAGG - Intronic
999062232 5:148648278-148648300 TCTACTGTGCAGGTAGAAGATGG + Intronic
999168942 5:149576413-149576435 TCTCATTTGTAGAAAGAAGATGG + Intronic
999979850 5:156947288-156947310 TATCAAGTGTAGGGAGAATATGG + Intronic
1001075892 5:168627754-168627776 TCTCCTGGGCAGCCAGAAGACGG - Intergenic
1002087876 5:176787001-176787023 TCTCATGTTCAGGCTGTAGATGG + Intergenic
1003593449 6:7454906-7454928 TCTCATGCTGAGAGAGAAGAGGG - Intergenic
1007293319 6:40803041-40803063 TCTCATTAGGAGGCAGAAGAAGG - Intergenic
1007300083 6:40861364-40861386 CCTGAGGTGCAGGGATAAGAAGG - Intergenic
1008056904 6:46954939-46954961 TCTCTGCTGCAGGAAGAAGACGG + Intronic
1009224827 6:61012175-61012197 TTTAATATGCAGGGAGAAAAGGG - Intergenic
1010534638 6:77011935-77011957 TCTCATGTTCAGGAAGAATGAGG - Intergenic
1010887550 6:81263173-81263195 TCCCATGTCCAGGGAGAAAGAGG + Intergenic
1011482520 6:87809339-87809361 TCTCAAGGGAAGGGAGAGGAGGG + Intergenic
1012473250 6:99594114-99594136 TTTCAAGTGCAGGGAGAAGTAGG - Intergenic
1013093309 6:106920971-106920993 TCTAATGTGCAGTGAGCTGATGG - Intergenic
1013356527 6:109350248-109350270 TTCCCTGTGCAGGGAGAGGAGGG + Intergenic
1015225811 6:130855691-130855713 TCTTATGTTCAAGGAAAAGAAGG + Intronic
1015399139 6:132768680-132768702 GCTGATGTGGAGGGAGGAGAGGG - Intergenic
1015681438 6:135813171-135813193 TCTCATGACCAGGAAGAAGTAGG + Intergenic
1016290160 6:142519447-142519469 TCTAATGTGGATGGAGATGATGG - Intergenic
1016454368 6:144215778-144215800 TCTCATGTGCACAGAAAGGAAGG + Intergenic
1016559296 6:145377457-145377479 TCTCATGACCAGGAAGAATAAGG + Intergenic
1017233411 6:152096047-152096069 CCTCATCTGCAGGGAAGAGATGG + Intronic
1018213302 6:161503151-161503173 TCCCATGTAGAGGGAGGAGATGG + Intronic
1018266405 6:162029127-162029149 TCTGAAGTGCAGGGAGAACTGGG - Intronic
1019281384 7:202176-202198 TCCCATGTGCATAGAGAGGACGG + Intronic
1019440892 7:1046170-1046192 TCACTGGGGCAGGGAGAAGAAGG + Intronic
1019508009 7:1403176-1403198 TCTCAAATGCAAGGAGAACATGG + Intergenic
1019625501 7:2013853-2013875 TCACCTGTGCAGTGGGAAGAAGG - Intronic
1019656209 7:2197533-2197555 GCCCGTGTGCAGGGAGAAGGTGG - Intronic
1023881524 7:44324090-44324112 CCACACGTGCAGGGAGAAGTGGG + Intronic
1023939302 7:44759725-44759747 TATCCTGTGCAGGGAGCAGCAGG + Intronic
1024589501 7:50868758-50868780 TGTGATGTATAGGGAGAAGAGGG + Intergenic
1024805635 7:53136017-53136039 TCACAGATCCAGGGAGAAGAGGG + Intergenic
1025085806 7:56022441-56022463 TGGCATGTGCTGGGAGGAGAGGG + Intronic
1028401903 7:90433599-90433621 TCTCATGTCCAGGAAGAATGAGG + Intronic
1030672515 7:112352826-112352848 TCTCCTGTCCAAGGAGCAGAAGG - Intergenic
1031890308 7:127286739-127286761 TCTCATGTTCAGTGAGGAGATGG + Intergenic
1032479193 7:132232994-132233016 GATCATCTGCAGGGAGAAGTAGG - Intronic
1032548895 7:132766184-132766206 GCTAATGAGCAGGGAGAAGCGGG + Intergenic
1033459071 7:141529093-141529115 TCTCCTGTGCAGGTATCAGAGGG - Intergenic
1036050257 8:5188157-5188179 TTTCATGGGCTGAGAGAAGAAGG + Intergenic
1038136938 8:24796519-24796541 TCTCAGGAGCCTGGAGAAGAAGG - Intergenic
1038263222 8:26016126-26016148 TCTTTAGTGCAGGGAGAAGGAGG + Intronic
1038638178 8:29303924-29303946 TCTAATATCCAGGGAGAAAAAGG - Intergenic
1041093173 8:54323289-54323311 TTTCATGTTCATGGATAAGAAGG + Intergenic
1041965425 8:63669892-63669914 TCTCATGTCCAGGAAGAATGAGG + Intergenic
1041967524 8:63697041-63697063 TCTCATGAGCAGTGACAAGATGG - Intergenic
1043047086 8:75339758-75339780 TTTCATGTGCCTGGAGTAGAAGG - Intergenic
1043363874 8:79508839-79508861 TCTCAAGTGTAAGGAGAAAAAGG - Intergenic
1043680954 8:83023774-83023796 TCTCATGACCAGGAAGAAGTAGG + Intergenic
1043690888 8:83150114-83150136 TCTCATGACCAGGGAGAATTAGG - Intergenic
1044282169 8:90368717-90368739 TCTCATCTGAAGGGACAAGGTGG + Intergenic
1044522818 8:93219130-93219152 TCTAGGGTGCAGGGAGAAAATGG - Intergenic
1044979865 8:97705798-97705820 TATGATGTGCAGGGAGAGAAGGG + Intronic
1045270564 8:100657651-100657673 TCTGAAGTGGAGGGACAAGATGG + Intronic
1046134227 8:110005435-110005457 TCTCATGTTCATGGATTAGAAGG - Intergenic
1047332440 8:123903886-123903908 TCTCATGTTCTCTGAGAAGAGGG + Intronic
1047599592 8:126412936-126412958 TCTCATCTGGAGAGAGCAGAGGG - Intergenic
1048268225 8:133005952-133005974 CCTCCAGTGCAGGGAGAAGATGG - Intronic
1048302357 8:133260859-133260881 GGTCAGGTGCAGGGACAAGAGGG + Intronic
1048848706 8:138623775-138623797 TTTCTCTTGCAGGGAGAAGAAGG - Exonic
1049894278 9:99175-99197 TGTCAGGGGCTGGGAGAAGAGGG + Intergenic
1050237989 9:3603142-3603164 TGTCATATGCAGGAAGAGGAAGG - Intergenic
1050660627 9:7879587-7879609 TCTGATGGGCAGGGCCAAGATGG + Intronic
1051515936 9:17930445-17930467 TTTCTTGTGGAGGGACAAGAGGG - Intergenic
1051572698 9:18578366-18578388 TCTGAGATGCAGGGTGAAGAGGG - Intronic
1051950152 9:22621412-22621434 ACTAAAATGCAGGGAGAAGACGG - Intergenic
1053109932 9:35450178-35450200 TTTCATGTGCAGGAAGAAAGTGG + Intergenic
1053204067 9:36171688-36171710 TCTCATGGCCAGGAAGGAGAAGG + Intergenic
1053328774 9:37183974-37183996 TCTACTGTGCAGGGAAAGGAGGG - Intronic
1053735506 9:41099280-41099302 TGTCAGGGGCTGGGAGAAGAGGG + Intergenic
1054692871 9:68332121-68332143 TGTCAGGGGCTGGGAGAAGAGGG - Intronic
1054698452 9:68387333-68387355 CATCATGTGCAGGGATATGATGG + Intronic
1055248159 9:74271941-74271963 TCTGATGGGCAGGAAGAAAATGG + Intergenic
1055846002 9:80564173-80564195 TGCCAAGTGGAGGGAGAAGATGG + Intergenic
1055890857 9:81122330-81122352 TCTCATGTTCAGGAAGAATTAGG + Intergenic
1056509611 9:87290829-87290851 TCCAATGTGCAGGGAGATTATGG + Intergenic
1056566837 9:87780412-87780434 TAAGATGTGCAGGTAGAAGATGG - Intergenic
1056930079 9:90867000-90867022 TCTCATTGGCAGGGACAGGAGGG + Intronic
1057552352 9:96061246-96061268 TGCCATGTGAAGGGAGAAGATGG + Intergenic
1057899072 9:98933609-98933631 ACTCATGCCCAGAGAGAAGAAGG - Intergenic
1058465471 9:105222775-105222797 TCACATGGGCAGGGAGATAAGGG + Intergenic
1058518562 9:105798489-105798511 TGTCCTGTCCAGGGAGAAAAAGG - Intergenic
1059049898 9:110912800-110912822 TCTCATCTGGAGGGTGAAGAAGG - Intronic
1060291381 9:122306266-122306288 TGTCAAGTGCAGGGGGATGAGGG - Intronic
1060779003 9:126398091-126398113 CCTCATGTGCAGGGAGCACCGGG - Intronic
1061326314 9:129866974-129866996 ACTCATGTGCAGGGAAGGGAGGG - Intronic
1062107438 9:134763681-134763703 TCTCCTCTGCAGGGTGACGACGG + Exonic
1062111125 9:134782655-134782677 TCCCATATTCAGGGTGAAGACGG + Exonic
1186108237 X:6228065-6228087 TCTGCAGTACAGGGAGAAGAAGG - Intronic
1187845853 X:23536379-23536401 TCCCATGTTCATGGATAAGAAGG + Intergenic
1190223522 X:48528573-48528595 GCTCATGGGCAGGCACAAGAAGG + Exonic
1191740971 X:64434801-64434823 TCTCCTGGCCAGGGAGGAGATGG + Intergenic
1191997968 X:67116762-67116784 TCTCATGAGAAGGGAGGAGGAGG + Intergenic
1192138998 X:68631570-68631592 TCTCATACGGAGGGAGCAGAGGG - Intergenic
1195715870 X:107818334-107818356 TCTCATATGGTGGGAGCAGAAGG - Intergenic
1196505536 X:116436736-116436758 CTTCAAGTGCAGGGAGAAGGAGG + Exonic
1197020741 X:121685045-121685067 TCTCAAGTGCAGACACAAGATGG + Intergenic
1198946720 X:142024330-142024352 TCACATGTGCAGGAGAAAGACGG - Intergenic
1199726238 X:150585187-150585209 TCTCATTTGAAGGCAGAAGCAGG - Intronic
1201337450 Y:12895881-12895903 TCTAATGGGGAGGAAGAAGAGGG - Intergenic
1201572307 Y:15427068-15427090 TTTAATGAGCTGGGAGAAGAAGG + Intergenic