ID: 922779989

View in Genome Browser
Species Human (GRCh38)
Location 1:228244430-228244452
Sequence CTGAGCTCCAGCTCAAAAGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922779980_922779989 21 Left 922779980 1:228244386-228244408 CCCAGGCCCAGACGGAGGTGACG 0: 2
1: 5
2: 4
3: 12
4: 98
Right 922779989 1:228244430-228244452 CTGAGCTCCAGCTCAAAAGTGGG 0: 1
1: 0
2: 0
3: 10
4: 120
922779983_922779989 15 Left 922779983 1:228244392-228244414 CCCAGACGGAGGTGACGTGGTAC 0: 2
1: 7
2: 2
3: 3
4: 77
Right 922779989 1:228244430-228244452 CTGAGCTCCAGCTCAAAAGTGGG 0: 1
1: 0
2: 0
3: 10
4: 120
922779981_922779989 20 Left 922779981 1:228244387-228244409 CCAGGCCCAGACGGAGGTGACGT 0: 2
1: 5
2: 3
3: 7
4: 64
Right 922779989 1:228244430-228244452 CTGAGCTCCAGCTCAAAAGTGGG 0: 1
1: 0
2: 0
3: 10
4: 120
922779984_922779989 14 Left 922779984 1:228244393-228244415 CCAGACGGAGGTGACGTGGTACA 0: 2
1: 8
2: 3
3: 2
4: 50
Right 922779989 1:228244430-228244452 CTGAGCTCCAGCTCAAAAGTGGG 0: 1
1: 0
2: 0
3: 10
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922779989 Original CRISPR CTGAGCTCCAGCTCAAAAGT GGG Exonic
901145407 1:7061574-7061596 CTGAGCTCCTGCTCAAAATCTGG - Intronic
902678589 1:18027197-18027219 CTGAGCCCCAGCTCAAGAGATGG - Intergenic
904447725 1:30588458-30588480 CGGAGTTCCAGCTCAAATGGGGG - Intergenic
905343806 1:37297852-37297874 CTGAACATCAGCTCAAAAGTTGG - Intergenic
906022063 1:42638477-42638499 CTGAGATCCAGCTTAGAACTAGG + Intronic
907360869 1:53913571-53913593 CTGAGCCCCATCTCAAAGGAAGG - Intergenic
908405274 1:63808257-63808279 CTGTGCTCCAGCCCAACAGAAGG - Intronic
909840332 1:80313083-80313105 CTGAGCTTCAGACCAAAAGAAGG - Intergenic
909924168 1:81419062-81419084 CAGAACTAAAGCTCAAAAGTAGG + Intronic
911623555 1:100094636-100094658 CTGAGCTCAAGGTCAGAGGTGGG - Intronic
912993994 1:114515102-114515124 CTGAGCTGCAGCTGAAATCTGGG + Intergenic
919093690 1:193003929-193003951 CTGAGCAGTAGCCCAAAAGTGGG + Intergenic
922548699 1:226477895-226477917 CTGAGCTCCAGATCAGAAAGTGG + Intergenic
922779989 1:228244430-228244452 CTGAGCTCCAGCTCAAAAGTGGG + Exonic
1067834995 10:49632898-49632920 CTCAGCTCCAGCTCAGACATGGG + Intronic
1069968311 10:72141236-72141258 CTGACTTCTATCTCAAAAGTGGG - Intronic
1076221906 10:128740467-128740489 CTCAGCTCCCACTCAACAGTTGG - Intergenic
1081261512 11:40967110-40967132 CTGAGTTTGAGCTTAAAAGTTGG + Intronic
1084051966 11:66605845-66605867 GTGAGGTCCTGCTCAAAGGTGGG - Exonic
1089978106 11:122750234-122750256 CTGAGCCCTATCTCAACAGTGGG - Intronic
1090081886 11:123618953-123618975 CTGTGCCCCAGATCAGAAGTGGG - Intronic
1090407426 11:126485371-126485393 ATGAGCTCCAGCTGAGAAGTGGG - Intronic
1090670571 11:128942396-128942418 CTGAGCCCCAGCTCAGCGGTCGG + Intronic
1091007047 11:131962761-131962783 CTGAGCCCCAGCTGACAAGAAGG - Intronic
1091274206 11:134339047-134339069 ATAAGCTCCAGTTCAAAAGAAGG + Intronic
1092117720 12:6021295-6021317 CTGAAGTCCTGCTCATAAGTAGG - Intronic
1097272694 12:57787478-57787500 CTGAGCTCCAACTAAGTAGTGGG - Intronic
1097288270 12:57894029-57894051 CTGGGCTGAAGCTCAGAAGTGGG - Intergenic
1097506043 12:60471894-60471916 ATTAGCTCCTGCTCAGAAGTAGG + Intergenic
1098081615 12:66791886-66791908 CTTAGCTCCCACTCAAAAATGGG + Intronic
1099286893 12:80724038-80724060 CTGAGCTGCAGTTTAAAAGATGG - Intergenic
1102051310 12:109864105-109864127 CAGAGCTCCCGCTCAACAGTAGG + Intronic
1104068529 12:125325762-125325784 GAGAGCTCCACCTGAAAAGTTGG - Intronic
1109327667 13:60888605-60888627 CTGAGCTTCAGCTAAAAATGAGG + Intergenic
1110072340 13:71192338-71192360 CTCATCCCCAGCTCAAAATTTGG - Intergenic
1112454492 13:99546310-99546332 CTGAGCCCCAGCTTAAAGCTGGG + Intronic
1122931410 14:104934275-104934297 CTGCCCTCCAGCTCAAATGCTGG - Exonic
1128908095 15:71486352-71486374 CCGAGGCCCAGCTAAAAAGTGGG + Intronic
1130063856 15:80588960-80588982 CTGAGCTCCTGCTCTGACGTGGG - Intronic
1134444666 16:14321734-14321756 CTGTGCCCCCGCTCAGAAGTGGG - Intergenic
1134853622 16:17501842-17501864 CTGAGCACCAGCAAAGAAGTTGG + Intergenic
1136089478 16:27908053-27908075 CTGAGCTCAAAGTCAGAAGTGGG - Intronic
1136923033 16:34346867-34346889 CTGAGCTCCAACTGAGAAGCTGG + Intergenic
1136981540 16:35064939-35064961 CTGAGCTCCAACTGAGAAGCTGG - Intergenic
1148125317 17:45233607-45233629 CTGAGCTCCAGCCAGAAAGGAGG - Intronic
1148514155 17:48200342-48200364 CTGAGCTCCATCACAAGATTGGG + Intronic
1148516343 17:48221769-48221791 CTGTTCTCCAGTTCAACAGTGGG + Intronic
1150002507 17:61450886-61450908 CTGAAATCCACCTCAACAGTGGG - Intergenic
1150218571 17:63483504-63483526 CTTAGCTCCAGCATCAAAGTGGG - Intergenic
1151418449 17:73982047-73982069 CAGAGCTCCGTCTCACAAGTGGG - Intergenic
1152997800 18:424620-424642 CAGAGCTCAAGCCCAAAGGTTGG + Intronic
1153696463 18:7647813-7647835 CTGGGCCCCAGCTCCAAAGTTGG + Intronic
1154980072 18:21496569-21496591 CTGAGGTCCAGGGCAACAGTGGG - Exonic
1161839451 19:6670180-6670202 CTGAACCCCAGCTCTAAAGGCGG - Intronic
1164695090 19:30237500-30237522 CTGATCTTCATCTCAAAGGTAGG + Intronic
1167121788 19:47521551-47521573 CTCAGCTCCAGCCCAAATGCAGG - Exonic
928396314 2:30945554-30945576 CAGAGCTCCAGCTCTAAGATAGG - Intronic
930121633 2:47765551-47765573 CTGAGCTTCAGCACAGAAATGGG - Intronic
933775418 2:85768610-85768632 CTGAGCTCAACCTCCCAAGTGGG - Intronic
935466212 2:103401299-103401321 GAGAGCTCCAGGTCAAAAGGAGG - Intergenic
938575340 2:132598116-132598138 CTGGCCTCCAGCTCAAAGGCAGG + Intronic
939817989 2:146920223-146920245 CTGAGCTCCAGGTCAATTATGGG - Intergenic
940189148 2:151020383-151020405 CTGATCTCCAGATAACAAGTGGG - Intronic
944635975 2:201676450-201676472 CTGAGCCCCATTTCAAAAGTGGG - Intronic
948676669 2:239600938-239600960 CTGTGCTCCAGCAGCAAAGTGGG - Intergenic
1175259769 20:57667171-57667193 CTGAGCTCTAACTGAAAGGTGGG - Intronic
1180569161 22:16699708-16699730 CTGAAGTCCTGCTCATAAGTAGG - Intergenic
1181438636 22:22924463-22924485 CTGAGCTCAGGCTCTGAAGTTGG - Intergenic
1182720772 22:32397345-32397367 GTGAGATCCAGCTCAACACTGGG + Intronic
1183171904 22:36194548-36194570 ATGAACTCCAGGTCAAAGGTGGG - Intronic
1183178897 22:36245322-36245344 GTGAACTCCAGGTCAAAGGTGGG + Intergenic
950151109 3:10688296-10688318 CTGAGCTCCAGCCCAGCAGAGGG + Intronic
953476156 3:43207584-43207606 CTGAGATCCAGGACTAAAGTAGG - Intergenic
953605266 3:44409669-44409691 CTGAGCTCCAGCTCAGGGCTAGG + Intergenic
955018003 3:55090515-55090537 CTGAGTTCCTGCTGCAAAGTCGG - Intergenic
957408654 3:79807378-79807400 CTGAGCTAGGACTCAAAAGTGGG + Intergenic
960586172 3:119323048-119323070 CTCCGCTCCAGCTCGAAAGACGG + Intronic
966535677 3:181031079-181031101 CTCAGCTCAAACTAAAAAGTTGG + Intergenic
967250423 3:187532096-187532118 TTGAGCTACAGCTAAAAAATGGG + Intergenic
974064633 4:57066107-57066129 ATTAGCTCCACCTAAAAAGTGGG - Intronic
975735027 4:77372685-77372707 CAGAGCTACAACTCACAAGTGGG - Intronic
976425368 4:84897000-84897022 CTGGGCTCCAGCTAGAAAGAGGG + Exonic
982149001 4:152431331-152431353 CTGAGCAACAGCACAACAGTGGG + Intronic
985144926 4:186886607-186886629 GTGGGCTCCATCTCAAAAGGTGG + Intergenic
987229654 5:15880345-15880367 CTGAGCTCCACCTCAGGAGGAGG + Intronic
991155148 5:63425420-63425442 CTTAGCTCCTGCTTATAAGTGGG + Intergenic
992891285 5:81206692-81206714 CTCATCTCCAGCTCAGCAGTTGG + Intronic
993440997 5:87956719-87956741 CTGACCTCCATCCCAAATGTAGG + Intergenic
995753960 5:115482198-115482220 TTGTGCTCCAGCCCCAAAGTGGG + Intergenic
1001326732 5:170733751-170733773 CTGAGCTCCAGCAAGAAAGCAGG + Intronic
1001595329 5:172895201-172895223 CTGAGCATCAGCTCATGAGTAGG - Intronic
1002109804 5:176900815-176900837 CTTAGCTCCATCTCTACAGTTGG - Intergenic
1004018840 6:11758053-11758075 TTGAGCTGCAGTTCAAAGGTTGG - Intronic
1006838956 6:37015883-37015905 CTGGGCTCCACCTCAAGGGTAGG + Intronic
1009187392 6:60589599-60589621 CTGAGCTCCAACTCCAATATTGG + Intergenic
1009779462 6:68251077-68251099 CTTAGCTCCAACTTATAAGTGGG + Intergenic
1010315830 6:74449088-74449110 CTTAGCTCCCGCTTATAAGTGGG + Intergenic
1012121131 6:95367881-95367903 CTGATCCCCAATTCAAAAGTAGG + Intergenic
1012309328 6:97702324-97702346 GTAAGCTCCAGTTCCAAAGTTGG + Intergenic
1012318898 6:97817311-97817333 CTCATCCCCAGCTCAGAAGTGGG - Intergenic
1017936680 6:159011702-159011724 CTGAGCTCCAGCTTTCATGTAGG - Intergenic
1018460438 6:163993820-163993842 CTGAGATCCAGCTAGAAAGTAGG + Intergenic
1018582987 6:165323902-165323924 CTGAGCTCTAGGACAAAAGCAGG + Intergenic
1018746182 6:166764187-166764209 CTGAGCCCCAGCTCAGAGCTGGG + Intronic
1024883302 7:54113958-54113980 CTGGGCTCCAGCTTAAGGGTTGG - Intergenic
1027633168 7:80634478-80634500 CTGATCTTCAGCTTAAAGGTAGG + Intronic
1027936887 7:84617128-84617150 TTGTGCTGCTGCTCAAAAGTTGG + Intergenic
1030836683 7:114295845-114295867 GTGAGCTGCAGCTAAAAAGTTGG - Intronic
1033158388 7:138975707-138975729 GTGAGCTCCAGATGAAAGGTGGG + Intronic
1038192941 8:25340503-25340525 CTGTCCACCAACTCAAAAGTGGG - Intronic
1041808744 8:61884701-61884723 CTGTGCTCCCGCTCAAATCTTGG - Intergenic
1045445643 8:102260356-102260378 CTGAGCTCTGACTCTAAAGTGGG + Intronic
1045473048 8:102529345-102529367 CTCTGCTCCAGCTCAGAGGTGGG - Exonic
1046039162 8:108881007-108881029 TTGAGCTCCAGCTTAGAAGTAGG + Intergenic
1047193259 8:122698037-122698059 TTGAGCTCATGCTCAAATGTAGG + Intergenic
1049922016 9:373723-373745 CTGTGGTCCAGGGCAAAAGTTGG - Intronic
1052156190 9:25193981-25194003 CTGAGCCCAGGCTAAAAAGTGGG - Intergenic
1053073095 9:35112406-35112428 TTGAGCTCCATCACAAGAGTTGG - Intronic
1053895475 9:42737528-42737550 CTGCGATCCAGATCAAAACTCGG + Intergenic
1059862852 9:118484453-118484475 CTGAGCCCCATCTGTAAAGTGGG + Intergenic
1062418222 9:136464673-136464695 CAGACTTCCAACTCAAAAGTCGG + Intronic
1188281741 X:28278801-28278823 CTGAGATCCTGGTGAAAAGTGGG - Intergenic
1189170966 X:38909013-38909035 CTGAGCTCCAGCCCAGGAGAGGG + Intergenic
1189748600 X:44195593-44195615 CTGAGGTCCAGCTTAACACTGGG - Intronic
1192269765 X:69567780-69567802 CTGCACTCCAGCTGAATAGTAGG + Intergenic
1193333883 X:80264707-80264729 CATAGCTCCAGGTCATAAGTAGG + Intergenic
1194987765 X:100509343-100509365 CAGAGCTCTATCTCAAAAGCTGG + Intergenic
1197496965 X:127196145-127196167 CTTAGCTCCAACTTATAAGTGGG - Intergenic
1198188552 X:134280635-134280657 CTCACATCCAGCTCATAAGTGGG - Intergenic
1201857265 Y:18558505-18558527 CTATACTTCAGCTCAAAAGTCGG - Intronic
1201876056 Y:18761875-18761897 CTATACTTCAGCTCAAAAGTCGG + Intronic