ID: 922782441

View in Genome Browser
Species Human (GRCh38)
Location 1:228263896-228263918
Sequence CACCAAGGGCTGCCCCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 524
Summary {0: 1, 1: 1, 2: 9, 3: 85, 4: 428}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922782441_922782451 24 Left 922782441 1:228263896-228263918 CCTGCCTGGGGCAGCCCTTGGTG 0: 1
1: 1
2: 9
3: 85
4: 428
Right 922782451 1:228263943-228263965 GTGTTCCTTGTGCTGGGAGGTGG 0: 1
1: 1
2: 2
3: 40
4: 309
922782441_922782453 28 Left 922782441 1:228263896-228263918 CCTGCCTGGGGCAGCCCTTGGTG 0: 1
1: 1
2: 9
3: 85
4: 428
Right 922782453 1:228263947-228263969 TCCTTGTGCTGGGAGGTGGTGGG 0: 1
1: 1
2: 3
3: 43
4: 356
922782441_922782450 21 Left 922782441 1:228263896-228263918 CCTGCCTGGGGCAGCCCTTGGTG 0: 1
1: 1
2: 9
3: 85
4: 428
Right 922782450 1:228263940-228263962 ACTGTGTTCCTTGTGCTGGGAGG 0: 1
1: 1
2: 3
3: 13
4: 226
922782441_922782452 27 Left 922782441 1:228263896-228263918 CCTGCCTGGGGCAGCCCTTGGTG 0: 1
1: 1
2: 9
3: 85
4: 428
Right 922782452 1:228263946-228263968 TTCCTTGTGCTGGGAGGTGGTGG 0: 2
1: 0
2: 18
3: 175
4: 1093
922782441_922782446 -6 Left 922782441 1:228263896-228263918 CCTGCCTGGGGCAGCCCTTGGTG 0: 1
1: 1
2: 9
3: 85
4: 428
Right 922782446 1:228263913-228263935 TTGGTGCCGTGCGAAATGGAAGG 0: 1
1: 0
2: 0
3: 1
4: 42
922782441_922782455 29 Left 922782441 1:228263896-228263918 CCTGCCTGGGGCAGCCCTTGGTG 0: 1
1: 1
2: 9
3: 85
4: 428
Right 922782455 1:228263948-228263970 CCTTGTGCTGGGAGGTGGTGGGG 0: 1
1: 1
2: 5
3: 54
4: 500
922782441_922782443 -10 Left 922782441 1:228263896-228263918 CCTGCCTGGGGCAGCCCTTGGTG 0: 1
1: 1
2: 9
3: 85
4: 428
Right 922782443 1:228263909-228263931 GCCCTTGGTGCCGTGCGAAATGG 0: 1
1: 0
2: 0
3: 1
4: 75
922782441_922782448 17 Left 922782441 1:228263896-228263918 CCTGCCTGGGGCAGCCCTTGGTG 0: 1
1: 1
2: 9
3: 85
4: 428
Right 922782448 1:228263936-228263958 AGAAACTGTGTTCCTTGTGCTGG 0: 1
1: 1
2: 2
3: 17
4: 191
922782441_922782449 18 Left 922782441 1:228263896-228263918 CCTGCCTGGGGCAGCCCTTGGTG 0: 1
1: 1
2: 9
3: 85
4: 428
Right 922782449 1:228263937-228263959 GAAACTGTGTTCCTTGTGCTGGG 0: 1
1: 1
2: 1
3: 12
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922782441 Original CRISPR CACCAAGGGCTGCCCCAGGC AGG (reversed) Intronic
900393793 1:2444869-2444891 CACCATGGGCTCCCCAAGTCAGG - Intronic
900554069 1:3271010-3271032 CACCAAGGTCTGCCTCTGGGAGG - Intronic
900558090 1:3290004-3290026 CAGCAGGGGCAGCCCCAGGCAGG - Intronic
901005705 1:6170650-6170672 CAGCAAGGGCCGCCCCAGGTGGG + Intronic
901012518 1:6209688-6209710 AACCAGGGCCTGCCGCAGGCTGG + Intronic
901494276 1:9612524-9612546 AAGCCAGTGCTGCCCCAGGCTGG + Intronic
902039576 1:13483070-13483092 GACCTAGGGCTGCACCAGCCTGG + Intronic
902580143 1:17402912-17402934 TACCAAGGGCTGCCTTAGGGTGG + Intergenic
902697322 1:18149171-18149193 CAGCAGGGGCTGTGCCAGGCTGG - Intronic
902786823 1:18738337-18738359 GACTAACGCCTGCCCCAGGCCGG - Intronic
902874746 1:19334042-19334064 TCCCCAGGGCTGTCCCAGGCTGG - Intergenic
902939059 1:19786589-19786611 TGCCAAGGGCTGCCCCAGGCAGG + Intronic
903066289 1:20701571-20701593 AACCCTGGGCTGTCCCAGGCTGG - Intronic
903166413 1:21523641-21523663 CATGCTGGGCTGCCCCAGGCAGG - Intronic
903466211 1:23554315-23554337 CCCTAAAGCCTGCCCCAGGCTGG + Intergenic
903510034 1:23868057-23868079 AACCACTCGCTGCCCCAGGCGGG + Exonic
904145803 1:28390499-28390521 CACCATGCCCTGCCCCAGCCTGG - Intronic
904160280 1:28518101-28518123 GGCCAAGGGCTCCCCCAGCCCGG + Intronic
904160290 1:28518122-28518144 GGCCAAGGGCTCCCCCAGCCCGG + Intronic
905208399 1:36356324-36356346 CACCAAGGACTTCCTCAAGCTGG - Intronic
905241086 1:36582074-36582096 GGGGAAGGGCTGCCCCAGGCTGG - Intergenic
905752467 1:40477611-40477633 CATCAAGGGCCCGCCCAGGCGGG - Exonic
906796009 1:48696906-48696928 CAGCAAGGGCTTCCTCAGGGAGG - Intronic
906953716 1:50355072-50355094 AACCAGGGACTACCCCAGGCTGG - Intergenic
906954069 1:50358133-50358155 AACCAAGGGCTGTCCTAGGCTGG - Intergenic
907909648 1:58815072-58815094 CCCCAAAGGCAGCCCCAGGACGG + Intergenic
907943107 1:59107814-59107836 CACCTAGGGCTGGTCCAGGTGGG - Intergenic
909327025 1:74364027-74364049 CACCCAGGTCTAGCCCAGGCTGG + Intronic
912375987 1:109210340-109210362 CACAAAGGGCTGCCACAGTGAGG + Intergenic
913252437 1:116923009-116923031 CACCAAGAGCTGACGCAGGCTGG - Intronic
913257531 1:116967255-116967277 CGCCAAAGGCTGCCCCTGACAGG - Exonic
915018760 1:152760578-152760600 CTCCCCGTGCTGCCCCAGGCAGG + Exonic
919748497 1:201023033-201023055 CACCCAGCTCTGGCCCAGGCCGG - Intronic
919806381 1:201383226-201383248 CACCAACAGCTGACCCATGCTGG + Intronic
922744686 1:228037420-228037442 CTCCAACGTCTTCCCCAGGCAGG + Intronic
922775105 1:228210961-228210983 CAACAAGGGCAGCTTCAGGCCGG + Intronic
922780609 1:228249778-228249800 TGCCATGGGCTGTCCCAGGCAGG - Intronic
922782441 1:228263896-228263918 CACCAAGGGCTGCCCCAGGCAGG - Intronic
922792604 1:228318389-228318411 AACCAAGGGCTGCACCACCCAGG - Intronic
922798761 1:228354308-228354330 CACCCAGGGCTGCCTCTTGCTGG + Intronic
923139296 1:231147637-231147659 AACCAGGGGCTGTCCCCGGCTGG + Intergenic
923881765 1:238111310-238111332 CAGAAAGAGCTGCTCCAGGCAGG + Intergenic
924254199 1:242166096-242166118 AACCAGGGGCTATCCCAGGCTGG + Intronic
924551818 1:245085230-245085252 CAACTAGGGCTGGCCCAGCCTGG + Intronic
924586322 1:245364136-245364158 CGCCCAGTGTTGCCCCAGGCTGG - Intronic
1063901560 10:10738035-10738057 CACCCAGGTCTGCCACAGGTGGG + Intergenic
1065521667 10:26579685-26579707 CACCAAAGCCAGCCCCAGGCAGG + Intergenic
1065522262 10:26584403-26584425 CACCAAAGCCAGCCCCAGTCAGG + Intergenic
1065527490 10:26637949-26637971 CACCAAAGCCAGCCCAAGGCAGG + Intergenic
1065527835 10:26640708-26640730 CACCAAAGCCAGCCCCAGTCAGG + Intergenic
1065528169 10:26643299-26643321 CACCAAGGCCAGCCCCACTCAGG + Intergenic
1065528529 10:26646151-26646173 CACCAAAGTCAGCCCCAGTCAGG + Intergenic
1065528741 10:26647961-26647983 CACCAAAGCCAGCCCCAGTCAGG + Intergenic
1065558483 10:26939586-26939608 CACCAAAGCCAGCCCCAGTCAGG - Intergenic
1065558709 10:26941416-26941438 CACCAAAGCCAGCCCCAGTCAGG - Intergenic
1065559064 10:26944233-26944255 CACCAAAGCCAGCCCCAGGCAGG - Intergenic
1065559350 10:26946439-26946461 CACCAAAGCCAGCCCCAGGCAGG - Intergenic
1065611533 10:27475996-27476018 CACCTGGGCCTGCCTCAGGCTGG - Intergenic
1065797157 10:29318473-29318495 CACAAAGGGCTGCCTCTGTCTGG + Intergenic
1065945998 10:30605860-30605882 CACAAAGGGCTGCCTCTGTCTGG - Intergenic
1067392974 10:45882734-45882756 AACTCATGGCTGCCCCAGGCAGG + Intergenic
1067861297 10:49851862-49851884 AACTCATGGCTGCCCCAGGCAGG + Intronic
1068069939 10:52183228-52183250 GCCCGTGGGCTGCCCCAGGCAGG - Intronic
1068421814 10:56804166-56804188 AACTAGGGGCTGCCCCAGGCTGG + Intergenic
1068570400 10:58621615-58621637 CACCATGCCCTGCCCCAGGCTGG - Intronic
1069042850 10:63712665-63712687 ATACACGGGCTGCCCCAGGCAGG + Intergenic
1069582431 10:69574896-69574918 GACCACGGGATGTCCCAGGCGGG - Intergenic
1069589677 10:69634110-69634132 CACCCAGTGCCTCCCCAGGCAGG - Intergenic
1069908950 10:71748354-71748376 CGCCACGGACTCCCCCAGGCAGG + Exonic
1069987431 10:72293902-72293924 TAGGAAGGACTGCCCCAGGCCGG - Intergenic
1070806982 10:79276468-79276490 CAGCCAGGGGTGCCCAAGGCAGG - Intronic
1070874030 10:79784474-79784496 CACTAAGGACTGGCACAGGCTGG - Intergenic
1071562381 10:86654610-86654632 CCCCAAGAGCAGCTCCAGGCTGG + Exonic
1072750076 10:97972123-97972145 AACCAGGGGCTGCCCCAGGCTGG - Intronic
1073069305 10:100783115-100783137 CACCCAGGGCTGCGCCTGGCTGG + Intronic
1074560293 10:114529626-114529648 CACCAAGGGCTGCCCAACTAGGG - Intronic
1076350255 10:129810682-129810704 CAGCAGGGGCTGAGCCAGGCGGG + Intergenic
1076410083 10:130242777-130242799 CACCACAGGCTTCCCCAGGAGGG - Intergenic
1076484478 10:130807313-130807335 CACCAAAGCATGCCCCAAGCAGG + Intergenic
1076738200 10:132468091-132468113 CCCCAAGGCCGGCTCCAGGCAGG + Intergenic
1076762549 10:132612561-132612583 CTCCTAGGGCTGCTCCAAGCTGG + Intronic
1076849395 10:133085784-133085806 CTCCAAGGGCAGCTCCAGGGAGG + Intronic
1076877901 10:133225570-133225592 CACCAAGGGCTGTTCTAAGCTGG - Exonic
1077101977 11:826387-826409 CCCCAAGGGGAGCCCCAGTCAGG + Intronic
1077382088 11:2248858-2248880 CACCAAGAGATGCCCCTGGTGGG - Intergenic
1077389587 11:2293923-2293945 CACCAACGGCTCCACCAGACTGG - Intergenic
1078147324 11:8730677-8730699 CAGTGAGGGCTGCCCCAGCCTGG - Exonic
1080779878 11:35419841-35419863 CGCCAGGGGCTGCTCCAGGGAGG - Intronic
1083965729 11:66042650-66042672 CACCGAGGCCTGCCTCAAGCTGG - Exonic
1084301878 11:68257560-68257582 GTCCAAGGGCTCCCCCTGGCGGG - Intergenic
1084317743 11:68355104-68355126 CACCAAGGGCCACCCCATCCAGG - Intronic
1085554985 11:77411740-77411762 CAGCTAGGGGAGCCCCAGGCAGG + Intronic
1087880981 11:103416135-103416157 CACCAGGGCCTGTCCCAGGCTGG + Intronic
1089494051 11:118899620-118899642 CACCACTGGCTTCCCCTGGCTGG + Intronic
1089663506 11:120001461-120001483 CACCAAGGGCTGTGTCAGGCAGG - Intergenic
1090822540 11:130356739-130356761 CACCACGCCCGGCCCCAGGCTGG - Intergenic
1092030132 12:5276958-5276980 GATGAAGGGCTGCCCCAGGAAGG + Intergenic
1092055586 12:5505777-5505799 CACCAGGGGCTGGCACAGACTGG - Intronic
1092226688 12:6752740-6752762 CACTCAGGCCTCCCCCAGGCGGG + Intronic
1094841472 12:34344314-34344336 CACCTTGGGCTGCCCCCCGCGGG + Intergenic
1095349178 12:41188862-41188884 CACCCAGGGCTGGCCGGGGCGGG + Exonic
1096073413 12:48788402-48788424 CCCCAAGGCCTGCCGCAGGGTGG - Intronic
1099391028 12:82078555-82078577 CGCCATGGGCTGCCTCAGGTGGG + Intergenic
1101812444 12:108119722-108119744 AACTAGGGGCTGCCCCAGGCTGG + Intergenic
1101832465 12:108269898-108269920 CAATAAGGGCTGCCCCAGGAAGG - Intergenic
1102238624 12:111310152-111310174 CAGCAGGGGCTGCCCGGGGCTGG - Exonic
1103058037 12:117836847-117836869 CAGCTGGGGGTGCCCCAGGCCGG + Intronic
1103272968 12:119688692-119688714 GACCAGGGGCTCCCCCAGGCAGG - Intronic
1103764354 12:123270765-123270787 CCCCAAGGGCTGGCCCTGGAAGG - Intronic
1104409691 12:128547774-128547796 CACCAGCGGCTTCCCCAGGCAGG + Intronic
1104977458 12:132558599-132558621 CACCAAGGTCGGCCTCAGCCAGG - Intronic
1106503812 13:30354644-30354666 CAGCATGGGCTGGCCAAGGCGGG - Intergenic
1108901357 13:55412250-55412272 AACTAAGGGCTGCCACAGGCTGG + Intergenic
1109002106 13:56818370-56818392 CACCAGGGCCTGTCCCAGGGTGG + Intergenic
1109217638 13:59608034-59608056 CACCAAAAACTGCCCTAGGCAGG + Intergenic
1111930603 13:94509330-94509352 CACCAATGACTGCCACAGCCAGG - Intergenic
1113597078 13:111540731-111540753 CCCCAAGGGCAGCCCCGGCCTGG - Intergenic
1113610928 13:111644827-111644849 CCCCTGGCGCTGCCCCAGGCAGG - Intronic
1113714860 13:112496348-112496370 CACCAGGGGGTGCAGCAGGCGGG + Intronic
1114219580 14:20684466-20684488 CTCCAAGGGCGGATCCAGGCGGG + Exonic
1114590981 14:23864459-23864481 TGCAAAGGGCTGCCCCAGGAAGG + Intergenic
1115670949 14:35611205-35611227 CACCATGCCCGGCCCCAGGCTGG - Intronic
1119862425 14:77946075-77946097 CTCCAAGGACTACACCAGGCAGG - Intergenic
1119878054 14:78077116-78077138 CACCTTGGGGTGGCCCAGGCTGG - Intergenic
1120609631 14:86624098-86624120 CTCTAATGGCTGCCCCAGTCTGG + Intergenic
1121023587 14:90598196-90598218 TACCAAGGGCTGACGTAGGCAGG + Intronic
1122289716 14:100673882-100673904 CACCAAGGGATGGCCAAGGTTGG - Intergenic
1122541471 14:102499952-102499974 CAGCAGAGGCAGCCCCAGGCCGG + Exonic
1122773002 14:104105507-104105529 CACCCTGGGATGCACCAGGCAGG + Intronic
1122855734 14:104559323-104559345 CACCAAGGGCAGCCCTGGGCAGG - Intronic
1122925151 14:104896022-104896044 CAACACGGGCTGCCCCAGCAGGG - Exonic
1123041517 14:105492141-105492163 CTCCCAGGGCTACCCGAGGCTGG + Exonic
1123097677 14:105774143-105774165 CTCCAGGGGCTGCCCCCTGCTGG + Intergenic
1123105690 14:105840137-105840159 CACCACGTGCTGGCCCAGGCTGG - Intergenic
1123919398 15:25059966-25059988 GACCAAGGTCTGCCTGAGGCTGG - Intergenic
1126552342 15:49946778-49946800 AAGCAGGGGCTGCCCCAGACTGG + Intronic
1126701043 15:51367784-51367806 CACCCAGGGCTGCTCTGGGCTGG - Intronic
1127531710 15:59850048-59850070 GGCCAAGAGCTGCCCCAGGAAGG - Intergenic
1128349450 15:66879479-66879501 CACCAAATGATGCTCCAGGCAGG + Intergenic
1128368052 15:67018682-67018704 CACCTAGGCCTGACCGAGGCAGG - Intergenic
1128643548 15:69358478-69358500 CACCAGAGGCTGCCCCTGGACGG - Intronic
1129355418 15:74987615-74987637 CACCAGGGCCAGGCCCAGGCTGG + Intronic
1129456194 15:75677233-75677255 CACCAACAGCTGGCCCCGGCTGG + Exonic
1129656264 15:77527413-77527435 CCCTGAGGGCTGCCCCAGGCGGG + Intergenic
1130062722 15:80581163-80581185 CCCCAACCGATGCCCCAGGCTGG - Intronic
1131171933 15:90184971-90184993 CCCCAGGGGCTGCGCCGGGCCGG + Intronic
1132476753 16:143131-143153 TGCCAAGGGCAGGCCCAGGCTGG - Intergenic
1132645667 16:998235-998257 CACCAGGAGCTGCCCCAGCCAGG - Intergenic
1132745372 16:1434088-1434110 CACCTAGGCCTGCCCCCGCCAGG - Intergenic
1132806702 16:1778335-1778357 CTCTCAGGGCTGCCCCAGCCTGG - Intronic
1132860096 16:2066318-2066340 CACCAACAGCTGCCACAGCCTGG - Intronic
1132932636 16:2466835-2466857 CACCAAGCGCTGCTCTGGGCAGG + Intergenic
1132975972 16:2711425-2711447 CACCCAGGGCTCTCCGAGGCTGG + Intergenic
1133176531 16:4019350-4019372 CACCCAGGGATGTCCCAGGCTGG + Intronic
1133565154 16:6986485-6986507 CACCACGTCCAGCCCCAGGCTGG + Intronic
1134054687 16:11162293-11162315 CACCAAGAGCAGGGCCAGGCAGG - Intronic
1134207921 16:12252782-12252804 CACCAAAGGCTCCCCATGGCTGG - Intronic
1134311847 16:13082383-13082405 CACCAAGAGGTGCCCGAGGATGG - Intronic
1135564388 16:23500361-23500383 CACCAATGCCAGCCCCAGGTAGG + Intronic
1136621991 16:31435776-31435798 CACCCAGGGCTGCAGCACGCTGG + Exonic
1137445633 16:48530231-48530253 CACCTAGGGCAGGCCCTGGCTGG + Intergenic
1138097837 16:54226404-54226426 CTCAAATGGCTTCCCCAGGCGGG + Intergenic
1138512254 16:57515479-57515501 CACCCAGGGCTGGGCAAGGCCGG + Intronic
1139958153 16:70703080-70703102 CACCAGGGGCTGTCCCTGCCCGG + Intronic
1141768746 16:86075762-86075784 GACCCAGTGCTGCCCCTGGCTGG + Intergenic
1141962360 16:87417671-87417693 CACCACGGGCAGCACCCGGCCGG - Exonic
1142559651 17:802622-802644 CACCAAGCCCAGCCCCAGGGAGG - Intronic
1142927677 17:3255367-3255389 CACCAGGGCCTGCCGCAGGGTGG + Intergenic
1143450220 17:7031838-7031860 CACCAAGGACTACCCCAGTGGGG + Intergenic
1144090604 17:11852559-11852581 AACCAGGGGCTGCTCCAGGCTGG - Intronic
1144779491 17:17800694-17800716 CAACTAGGGCTGCCCCGGGAAGG + Intronic
1145058829 17:19719777-19719799 CACCGGGGACTGGCCCAGGCTGG + Intergenic
1146377277 17:32303180-32303202 GCCCCAGGGCAGCCCCAGGCAGG - Intronic
1150579891 17:66463052-66463074 CACCCAGCACTGCTCCAGGCCGG - Intronic
1151698100 17:75728289-75728311 CACCAAGGGCTGGCTCAGAAGGG - Intronic
1152091243 17:78249078-78249100 CACCGAGGGCTTCCCCAGGCTGG + Intergenic
1152270236 17:79320240-79320262 CACCAAGAGCGGCTCCATGCAGG - Intronic
1152615915 17:81337704-81337726 TACCAAGGGTGGCCCCACGCAGG + Intergenic
1152641182 17:81449912-81449934 CACCATGGAGTGCCCCAGCCTGG + Intronic
1152758231 17:82096022-82096044 GGCCGAGGGCTGGCCCAGGCAGG - Intronic
1152861004 17:82697282-82697304 CCCTAAGGGCAGCTCCAGGCAGG - Intronic
1153560127 18:6363278-6363300 CATCAGGGGCTGCCCCTGGACGG - Intronic
1153615473 18:6929653-6929675 CACCTAGAGATGCCCCAGGAGGG - Intergenic
1153798977 18:8651851-8651873 CACCAGGGCCTGCCACAGGGTGG + Intergenic
1155116928 18:22778064-22778086 CAGCATGGGCTGCTACAGGCTGG + Intergenic
1156499337 18:37547262-37547284 CACCCAAGGCTGCTCCAGCCTGG - Intronic
1157071060 18:44409274-44409296 CACCAAGAACTTCCCCATGCTGG - Intergenic
1160910299 19:1470915-1470937 CGCCAAGGGGTGCGACAGGCAGG - Exonic
1161105329 19:2441039-2441061 AACCAGGAGCTGCCCCAGGCTGG + Intronic
1161442176 19:4298157-4298179 CACCAACGGCAGCCTCAGCCTGG - Exonic
1161480985 19:4510567-4510589 CCCAAGGGGCCGCCCCAGGCAGG - Exonic
1161664382 19:5565948-5565970 TTCCCAGAGCTGCCCCAGGCCGG + Intergenic
1162134693 19:8548182-8548204 CACCCTGGGCTGCCCCAGGGAGG + Intronic
1162565685 19:11445008-11445030 TAACAAGGGCTGGCCCAGGCTGG - Intronic
1162786214 19:13036586-13036608 CCCCAAGGGCTGCACTCGGCTGG - Intronic
1162981439 19:14242799-14242821 CACCATGCCCTGCCCCAGTCTGG - Intergenic
1163359346 19:16836080-16836102 CGCCAAAGGCTGCCCGAGGCTGG - Intronic
1165025630 19:32959171-32959193 CACCAAAGGCACCCCCAGCCTGG + Intronic
1165055558 19:33174279-33174301 CCCCGAGGCCTGCCCCAGGTAGG + Intronic
1165689325 19:37851119-37851141 AACTAGGGGCTGCCTCAGGCTGG + Intergenic
1165785478 19:38459249-38459271 CATCAACGGCTGCCCCGTGCAGG + Exonic
1166916064 19:46196777-46196799 GACCCAGTGCTGCCGCAGGCTGG + Intergenic
1167007305 19:46784444-46784466 TAGCAAGGGCTCCCCCTGGCTGG + Intronic
1168638872 19:58017438-58017460 GAGCAGGGGCTGCCTCAGGCAGG + Intergenic
925451882 2:3976057-3976079 AACCAGGGACTGCCTCAGGCTGG + Intergenic
925918596 2:8624373-8624395 CACCAAGGGCTGCTCTAGCAGGG + Intergenic
926251131 2:11155954-11155976 CACCAAGGGCTGCCTCCGCTGGG - Intronic
927513358 2:23658194-23658216 CACCAAGGCCAGCTCCAGGGTGG + Intronic
928055993 2:28055247-28055269 CACCAAGGCCTACCCTAGGGTGG + Intronic
928166595 2:28976903-28976925 CTCCAAGGCCAGCCCCAGCCTGG - Intronic
928213761 2:29343811-29343833 CACAAAGGGCTGCTTCAGACTGG + Intronic
929602424 2:43212745-43212767 CACAAGGGGATGTCCCAGGCAGG + Intergenic
929603347 2:43218673-43218695 CACCAAGGCCTGTCCTTGGCAGG + Intergenic
930099589 2:47592659-47592681 CACTATTGGCTGTCCCAGGCAGG + Intergenic
934553125 2:95274354-95274376 CACCAAGGGCGGTCCCAGCCTGG + Intergenic
934574117 2:95389766-95389788 GACCACGGCCTGCCCCAGGGAGG + Intergenic
934759019 2:96843279-96843301 CGCCAGAGGCTGCACCAGGCTGG + Intronic
936238454 2:110766877-110766899 CACCAAGGTGTGCACCAGGTCGG + Intronic
937884339 2:126889796-126889818 CAAGAACGGCTGCCCCAGCCTGG + Intergenic
937924136 2:127154575-127154597 CACCCAGGCCTGCCCTATGCCGG - Intergenic
939960468 2:148561212-148561234 TCCCTAAGGCTGCCCCAGGCCGG + Intergenic
942073905 2:172339414-172339436 CACCAAGTGCTGCAGGAGGCAGG + Intergenic
942352889 2:175071964-175071986 CACCAAGGGATGCCAAAGGCAGG + Intergenic
945234943 2:207625214-207625236 CACCCAGGGCTCGCCCAGGCCGG + Exonic
946031257 2:216706968-216706990 CAACCATGGCTTCCCCAGGCAGG - Intergenic
947111229 2:226721546-226721568 CACCAAGGCCAGCCTCAGTCTGG - Intergenic
947530172 2:230904036-230904058 CATCAAGGGATGCCCCAGCTAGG + Intergenic
948663362 2:239520133-239520155 CCTCCACGGCTGCCCCAGGCTGG - Intergenic
948712478 2:239833655-239833677 CACCCATGGCTGTCCCTGGCCGG + Intergenic
948829454 2:240591065-240591087 TACCATGGGCTGCCCCAGGAGGG + Intronic
948978313 2:241478331-241478353 GCCCTAAGGCTGCCCCAGGCAGG - Intronic
1169052669 20:2594072-2594094 CTCCAAGGGCTTCCTAAGGCTGG + Intronic
1169230882 20:3888473-3888495 TACCAAAGGCTGCCCAAGCCCGG - Intergenic
1170466990 20:16631161-16631183 GACCAAGGTCTGCCCCATGGTGG + Intergenic
1170999393 20:21397271-21397293 CCCCAGGGGCGCCCCCAGGCCGG + Exonic
1171309445 20:24134795-24134817 CCCCAGTGGCTGCTCCAGGCTGG - Intergenic
1171725841 20:28620401-28620423 CACCAAAGCCAGCCCCCGGCAGG + Intergenic
1171784417 20:29449157-29449179 CAGCAAGGCCTGGCCCAGCCTGG - Intergenic
1171790045 20:29514897-29514919 CACCAAAGCCAGCCCCAGGCAGG + Intergenic
1172057737 20:32166027-32166049 CCTCCAGGGCTGCCCAAGGCAGG + Exonic
1175068143 20:56308051-56308073 CAGCTAGGGTTGCCACAGGCTGG - Intergenic
1175101295 20:56580479-56580501 CAGGGAGGGATGCCCCAGGCTGG - Intergenic
1175223167 20:57429105-57429127 CACCGAGGGTAGCACCAGGCTGG - Intergenic
1175667282 20:60871158-60871180 CACCCAGGGATTCTCCAGGCAGG + Intergenic
1175733740 20:61371355-61371377 CACCAAGGGCTGCCCCAGGAAGG - Intronic
1176086482 20:63297610-63297632 CACCCAGGGAGGCCCCAGCCTGG - Intronic
1177476636 21:21632231-21632253 CACAGAGGACTGCGCCAGGCAGG + Intergenic
1178493274 21:33067752-33067774 CACCAGGGCCTGCCCCAATCTGG + Intergenic
1178636448 21:34308084-34308106 CACCAAGGTGTGCCCAAGGCTGG - Intergenic
1179028259 21:37698323-37698345 CAGCAAGGGCAGCCCCCGCCTGG - Intronic
1179919986 21:44502833-44502855 CCCCAAGGGCTCACCGAGGCCGG - Intronic
1179920194 21:44503503-44503525 CCCCAAGGGCTCACCAAGGCCGG - Intronic
1179920231 21:44503624-44503646 CCCCAAGGGCTCACCAAGGCCGG - Intronic
1179920298 21:44503837-44503859 CCCCAAGGGCTCACCAAGGCCGG - Intronic
1180059484 21:45377204-45377226 CACCAAGGGCTGCTCCCAGAGGG - Intergenic
1180390744 22:12280007-12280029 CACCAAAGCCAGCCCCCGGCAGG + Intergenic
1180408998 22:12584750-12584772 CACCAAAGCCAGCCCCCGGCAGG - Intergenic
1180706131 22:17811018-17811040 CACTGAGGGCTGCTGCAGGCTGG - Intronic
1181054195 22:20252391-20252413 CACCTTGGGCTGTCCCAGGGAGG - Intronic
1181235191 22:21444297-21444319 CGCCAAGTGCTGCCCCAGCCTGG - Intronic
1181492874 22:23271681-23271703 CACCAAGGGATGACCCAAGTGGG - Intronic
1181633966 22:24165882-24165904 CCCCAAGGGCTGCACCACCCAGG + Intronic
1181682302 22:24503899-24503921 AACCAGGGGCTGCCCCAGGCTGG + Intronic
1181787599 22:25238260-25238282 AACCAGGGGCTGCCCTAGGAGGG - Intergenic
1181819340 22:25463298-25463320 AACCAGGGGCTGCCCTAGGAGGG - Intergenic
1182109905 22:27715630-27715652 CCTCAATGGCTGCCCCAGGAAGG - Intergenic
1182861240 22:33561278-33561300 AACCAGGGGCTGCCCCAGGCTGG + Intronic
1183056779 22:35311629-35311651 CCAGAAGGTCTGCCCCAGGCAGG + Intronic
1183392191 22:37552076-37552098 CCCCCAGGGCTGGGCCAGGCTGG + Intergenic
1183457944 22:37932898-37932920 CAGGGAGGGATGCCCCAGGCGGG - Intronic
1184136153 22:42551010-42551032 AACCAGGGGCTGCCCTAGGCCGG - Intergenic
1184422496 22:44390162-44390184 CCCCAAGGTCTGGCCCTGGCAGG - Intergenic
1184477648 22:44730092-44730114 CCCCCAGGGCTGCCCCTGGCGGG + Intronic
1184842082 22:47058024-47058046 CACCTAGGGCAGCCCAAGGGGGG - Intronic
1185204781 22:49531632-49531654 CAGCCAGGGCTGCCCCTGCCTGG - Intronic
1185317239 22:50184484-50184506 CAGTGAGGGCTGCCCCACGCAGG - Intergenic
949391100 3:3563431-3563453 CACTAAAGGCTGGCCCAGCCTGG - Intergenic
950373883 3:12554270-12554292 CACCAAGTCCTGCCCCACCCGGG - Intronic
950880324 3:16317827-16317849 AACCAATGACTGCCCCAGGTGGG + Intronic
952272096 3:31843245-31843267 GATCAAGGGCTGCCCCAAGGTGG - Intronic
952288219 3:31988704-31988726 CACCAATGGATAGCCCAGGCAGG + Exonic
953350230 3:42209846-42209868 CACCAAGGGCTTCCGGACGCTGG + Exonic
953606328 3:44415486-44415508 CACCCAGCACGGCCCCAGGCAGG + Intergenic
954162371 3:48732072-48732094 CAAAAAGAGCTGCACCAGGCTGG + Intronic
954434843 3:50490498-50490520 CACCAAGGGCTGCTCTGGGGAGG - Intronic
954879681 3:53824865-53824887 CAACAAGGCCTGCCCAAGACAGG + Intronic
960109678 3:113833486-113833508 CACCAACACCTGCCCAAGGCAGG + Intronic
961215102 3:125153569-125153591 CACTAAGTTCTGCCCCTGGCTGG + Intronic
961462235 3:127058326-127058348 CACAAATGGCTCACCCAGGCAGG - Intergenic
962304427 3:134273000-134273022 CACCAAGGCCGGCCCCACCCAGG + Intergenic
962381040 3:134898322-134898344 CACCAAGTGCTGCTCATGGCAGG + Intronic
965803942 3:172523334-172523356 CACGCAGGTCTGTCCCAGGCTGG + Exonic
966887719 3:184386123-184386145 CACCAAGGGTAGCCCCAGAGGGG + Exonic
966918126 3:184595951-184595973 CACCAAGGTCTGCACCATGGAGG + Intronic
968602578 4:1517296-1517318 CACCCAGGGCTAGCCCAGGTGGG - Intergenic
968650186 4:1757335-1757357 CCCCCAGGGCTGCTCCAGGCAGG + Intergenic
968662677 4:1805263-1805285 CCTCAAGGGCTGGGCCAGGCTGG + Intronic
968904073 4:3443672-3443694 CACACAGGCGTGCCCCAGGCAGG + Intronic
968905716 4:3449713-3449735 CTCCCAGGCCAGCCCCAGGCCGG + Intergenic
969406529 4:6996709-6996731 CCCCCAGGGCTGTCCCGGGCGGG + Intronic
969432089 4:7161302-7161324 CACCAAGCCCTGCCCTGGGCTGG - Intergenic
969702455 4:8775001-8775023 AACCACGGGCTGCCTCTGGCCGG + Intergenic
969706225 4:8793805-8793827 CCCCAAGGGCTCAGCCAGGCCGG + Intergenic
974377316 4:61095273-61095295 AACGAGGGGCTGCCCCAGGCAGG - Intergenic
974451282 4:62064203-62064225 CAGTAAGAGCTGCCTCAGGCAGG + Intronic
975498167 4:75057397-75057419 CACAAGGGGCTGCTCCAGACAGG - Intergenic
976102262 4:81578305-81578327 CACCTAGGGCTCCTCCAGCCTGG + Intronic
978723900 4:111947608-111947630 TTCAAAGGGCTGCTCCAGGCCGG + Intergenic
983077640 4:163344389-163344411 GACAAAGCGCTGCCCCCGGCTGG + Exonic
984553279 4:181185303-181185325 CACTAAGGGATGCCCCAGTAGGG + Intergenic
984891610 4:184498868-184498890 CTCCTAGGGCTGCCCCAGCCTGG + Intergenic
985110742 4:186544313-186544335 CACAAATGGCTGCTGCAGGCCGG - Intronic
985434715 4:189917394-189917416 CACCAAAGCCAGCCCCCGGCAGG - Intergenic
985791563 5:1931045-1931067 CACCGCCGGCTGCCCTAGGCAGG - Intergenic
985875554 5:2591420-2591442 GTCCAGGGGCTGCCCCAGGTAGG + Intergenic
985964089 5:3326467-3326489 CACCGAGGGTCGCCCCTGGCTGG + Intergenic
986705817 5:10453990-10454012 CACTGTGAGCTGCCCCAGGCAGG + Intronic
987073492 5:14359557-14359579 AGCCAAGGGCTCCCACAGGCAGG - Intronic
987638964 5:20586488-20586510 CACCAAGGCCTGTCGGAGGCTGG + Intergenic
987848792 5:23322748-23322770 CACCAGGGCCTGCAACAGGCTGG + Intergenic
992640011 5:78761126-78761148 CAGTAGGGGCAGCCCCAGGCTGG - Intronic
996803401 5:127428112-127428134 CACCATGGCCTGCCTCAGTCTGG - Intronic
998252414 5:140561943-140561965 CAACCAGGGCTGGACCAGGCAGG + Intronic
1001159433 5:169300647-169300669 CGCCAAGGCCAGCGCCAGGCGGG + Exonic
1001306630 5:170579423-170579445 CACCAAGAACAGCCACAGGCAGG + Intronic
1001592965 5:172878921-172878943 CACCGAGGGCTCCGACAGGCTGG + Intronic
1001783122 5:174387364-174387386 CACAAAGAGTTTCCCCAGGCTGG - Intergenic
1002051290 5:176573099-176573121 CAGGAAGGGGTGCTCCAGGCAGG + Intronic
1002053913 5:176587580-176587602 CACCGAGGGCTGGGCCTGGCTGG + Intronic
1002063315 5:176639466-176639488 CTCCAGGAGCTTCCCCAGGCTGG + Intronic
1002456297 5:179346797-179346819 CACCTAAGGGTGCCCGAGGCTGG + Intergenic
1004991173 6:21140434-21140456 CATAAAGGGATGCCCAAGGCAGG - Intronic
1005407160 6:25501578-25501600 CACAAAGGGCTGAAGCAGGCAGG - Intronic
1006372549 6:33654372-33654394 CACCAAGGGCTGCCCCACCTAGG - Intronic
1006471737 6:34233194-34233216 CAACCAGGACTGACCCAGGCCGG - Intergenic
1006641830 6:35493377-35493399 CCCCCAGGGCTGTGCCAGGCAGG - Intronic
1006860564 6:37169677-37169699 CATCAAAGGCCGCCCGAGGCCGG - Intergenic
1007082103 6:39114949-39114971 CTCTAAAGGCAGCCCCAGGCTGG - Exonic
1007263488 6:40580226-40580248 GCCCATGGGCTGCCCCAGGGTGG + Intronic
1007280984 6:40712303-40712325 GGCCCAGGGCTGCCCCATGCTGG + Intergenic
1007544759 6:42685111-42685133 CACCAAGGGTTTGGCCAGGCTGG - Intronic
1009612460 6:65963851-65963873 AACTAGGGGCTACCCCAGGCTGG - Intergenic
1011543273 6:88456651-88456673 CAGCAAGGGCTTCCTCAAGCAGG - Intergenic
1014550959 6:122789402-122789424 CGCCACGGGCAGCCCGAGGCCGG - Exonic
1014815199 6:125927869-125927891 CATAAAGGGCTGACCCAGCCCGG - Intronic
1017427178 6:154334524-154334546 CCCCATGGGATGACCCAGGCTGG + Intronic
1017677659 6:156830306-156830328 CACCATGGGACGCCCCAGCCTGG - Intronic
1018654336 6:166019430-166019452 CACTTGGGGCTGCCCGAGGCTGG - Intergenic
1018887079 6:167948796-167948818 CACCATGAGCTCCCACAGGCAGG - Intronic
1018947291 6:168356685-168356707 CAGCAGGGGCAGCCCCAGGCAGG + Intergenic
1018947307 6:168356740-168356762 CAGCAGGGGTGGCCCCAGGCAGG + Intergenic
1018947323 6:168356795-168356817 CAGCAGGGGTGGCCCCAGGCAGG + Intergenic
1018947354 6:168356905-168356927 CAGCAGGGGCGACCCCAGGCAGG + Intergenic
1018947388 6:168357015-168357037 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947404 6:168357070-168357092 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947420 6:168357125-168357147 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947438 6:168357180-168357202 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947455 6:168357235-168357257 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947486 6:168357345-168357367 CAGCAGGGGCGACCCCAGGCAGG + Intergenic
1018947520 6:168357455-168357477 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947553 6:168357565-168357587 CAGCAGGGGTGGCCCCAGGCAGG + Intergenic
1018947570 6:168357620-168357642 CGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947588 6:168357674-168357696 CGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947619 6:168357784-168357806 CAGCAGGGGCGACCCCAGGCAGG + Intergenic
1018947652 6:168357894-168357916 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947669 6:168357949-168357971 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947689 6:168358004-168358026 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947707 6:168358059-168358081 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947727 6:168358114-168358136 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947743 6:168358169-168358191 CAGCAGGGGTGGCCCCAGGCAGG + Intergenic
1018947760 6:168358224-168358246 CGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947778 6:168358278-168358300 CGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947809 6:168358388-168358410 CAGCAGGGGCGACCCCAGGCAGG + Intergenic
1018947843 6:168358498-168358520 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947858 6:168358553-168358575 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947878 6:168358608-168358630 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947896 6:168358663-168358685 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947916 6:168358718-168358740 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947932 6:168358773-168358795 CAGCAGGGGTGGCCCCAGGCAGG + Intergenic
1018947948 6:168358828-168358850 CAGCAGGGGTGGCCCCAGGCAGG + Intergenic
1018947965 6:168358883-168358905 CGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947983 6:168358937-168358959 CGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1019057769 6:169235519-169235541 CATCAAGGGCTTCCCCAGGGAGG - Intronic
1019171691 6:170136547-170136569 GCCCAAGGCCTGCCGCAGGCGGG - Intergenic
1019325586 7:436745-436767 CACCATGGCCTGCTCCAGTCGGG + Intergenic
1019406883 7:888653-888675 CAGAAGGGGCTGGCCCAGGCTGG + Intronic
1019522986 7:1468912-1468934 AGCCATGGGCTGCCCCAGGGTGG - Intergenic
1022088141 7:27088412-27088434 CACCAGCGCCTGCCCCCGGCCGG - Intergenic
1022301317 7:29105292-29105314 CACCCATGGCTGCCACAGTCTGG - Intronic
1022903610 7:34834598-34834620 CACCAAAGGCTGTCACAGGCGGG + Intronic
1023822922 7:43990092-43990114 CACCCACGTCTGTCCCAGGCTGG + Intergenic
1024622314 7:51172465-51172487 CCTCCAGGGCTGCCCCAGGAAGG - Intronic
1026133819 7:67642061-67642083 CACACAGGACTGCCCGAGGCTGG + Intergenic
1027188030 7:75983368-75983390 CATCAAGGGCTCTCCCAGCCTGG - Intronic
1027999069 7:85467975-85467997 AACCAGGGGCTTCCCCAGGCTGG + Intergenic
1029303120 7:99600001-99600023 CACTAAGGGCTGCTTCAGGGAGG + Intronic
1029751186 7:102543522-102543544 CACCCACGTCTGTCCCAGGCTGG + Intronic
1029769138 7:102642627-102642649 CACCCACGTCTGTCCCAGGCTGG + Exonic
1030287012 7:107837326-107837348 CACCAAGCTCTGCCCCACCCTGG - Intergenic
1030362008 7:108605165-108605187 AACCAGGGGCTGCCCCAGGCTGG + Intergenic
1032086126 7:128884798-128884820 CACAGGGGTCTGCCCCAGGCTGG + Exonic
1032097925 7:128948752-128948774 CACCAAGGCCTGCTCCAGGAGGG - Exonic
1032766457 7:134998810-134998832 CTCCAACCACTGCCCCAGGCTGG + Intronic
1034383604 7:150720202-150720224 CACCACGGGCAGCCGCAGGTGGG + Exonic
1035033251 7:155878341-155878363 CACCAAGGGCTCCCCACAGCAGG - Intergenic
1036566796 8:9944894-9944916 CACCAAGGTCTGGCCCTCGCTGG - Intergenic
1036753936 8:11460212-11460234 CACCGAGGGCTGCCTAAAGCCGG - Intronic
1036928706 8:12931718-12931740 CACTTTGGGCTGGCCCAGGCCGG - Intergenic
1037752592 8:21692572-21692594 CCACAAGGGCTCTCCCAGGCAGG + Exonic
1037803031 8:22045295-22045317 GCCCAATGGCTGCCCCTGGCAGG - Intronic
1037880857 8:22572757-22572779 CCCCCAGGGCTGCTCGAGGCAGG - Intronic
1038304381 8:26385298-26385320 CAAAAAGGGCTGAGCCAGGCAGG + Intronic
1038805239 8:30784604-30784626 CACTTTGGGTTGCCCCAGGCTGG - Intronic
1039838845 8:41279337-41279359 CACCGAGTGCTTGCCCAGGCCGG + Intronic
1040286832 8:46104774-46104796 CACCCAGGGCTGTCCCGGGCGGG - Intergenic
1040287907 8:46109827-46109849 CCCCCAGGTCTGTCCCAGGCAGG - Intergenic
1040290075 8:46119735-46119757 CCCCCAGGGCTGTCCCAGGCAGG - Intergenic
1040290813 8:46123196-46123218 CCCCCAGGGCTGTCCCAGGCAGG - Intergenic
1040291681 8:46128738-46128760 CACCCAGGATTGTCCCAGGCGGG - Intergenic
1040291904 8:46129834-46129856 CACCCAGGGGTGTCCCGGGCAGG - Intergenic
1040292965 8:46134839-46134861 CCCCCAGGGCTGTCCTAGGCTGG - Intergenic
1040294247 8:46141092-46141114 AACCCAGGGCTGTCTCAGGCGGG - Intergenic
1040294489 8:46142175-46142197 CCCCCAGGGCTGCCCCAGATGGG - Intergenic
1040294538 8:46142392-46142414 CATCCAGGCCTGCCCCATGCGGG - Intergenic
1040302219 8:46194021-46194043 CCCCCAGTGCTGCCCCAGGCCGG + Intergenic
1040303731 8:46201451-46201473 CCCCAAGGTCTGTCCCAGGTGGG + Intergenic
1040305021 8:46207564-46207586 CTCGTAGGGCTGTCCCAGGCAGG + Intergenic
1040307210 8:46218299-46218321 CCCCCAAGGCTGTCCCAGGCCGG - Intergenic
1040307341 8:46218981-46219003 CCCCCAGGGCTGTCCCAGACTGG - Intergenic
1040308055 8:46222441-46222463 CCCCTAGGGCTGTCCCAGACAGG + Intergenic
1040308410 8:46224076-46224098 CACCCAGGGCTGTCCCGGCCTGG + Intergenic
1040312043 8:46241811-46241833 CCCCGAGGGCTGTCCCGGGCGGG + Intergenic
1040312084 8:46242017-46242039 CATCCAGGGCTGTCCCGGGCGGG + Intergenic
1040312387 8:46243518-46243540 CACCCAGGGCTGTCCCGGGCGGG + Intergenic
1040312760 8:46245238-46245260 CCCCCAGGGCTGTCCCGGGCGGG + Intergenic
1040314553 8:46254172-46254194 CCCCCAGGGCTGTCCCAGGCGGG + Intergenic
1040315127 8:46256973-46256995 CCCCCAGGGCTGTCCCGGGCGGG + Intergenic
1040315314 8:46257848-46257870 CCCCCAGGGCTGTCCCAAGCGGG + Intergenic
1040316061 8:46261475-46261497 CCCCCAGGGCTGTCCCTGGCGGG + Intergenic
1040324619 8:46335455-46335477 CCCCCAGTGCTGCCTCAGGCAGG + Intergenic
1040325466 8:46339342-46339364 CACCCAGGGCTGTCCCAGCGGGG + Intergenic
1040325833 8:46341067-46341089 CACCCAGGGCTGTCCCCGGCAGG + Intergenic
1040328965 8:46376300-46376322 CACCCAGGGCTGTCCTGGGCAGG + Intergenic
1040329302 8:46377819-46377841 CCCCCAGGGCTGTCCCAGGCGGG + Intergenic
1040329398 8:46378254-46378276 CTCCCAGGGCTGTCCCAGGCGGG + Intergenic
1040330768 8:46384671-46384693 CTCCCAGGGCTGTCCCACGCGGG + Intergenic
1040330906 8:46385322-46385344 CCCCCAAGGCTGCCCCGGGCTGG + Intergenic
1040330956 8:46385539-46385561 CCCCCAGGGCTACCCCGGGCGGG + Intergenic
1040331108 8:46386251-46386273 ACCCAAGGGCTGTCCCAAGCAGG + Intergenic
1040331298 8:46387115-46387137 CCCCCAGGGCTGACCCGGGCAGG + Intergenic
1040331727 8:46389061-46389083 CCCCCAGGGCTGTCCCAGGTGGG + Intergenic
1040332108 8:46390998-46391020 CCCCCAGGGCTGTCCCAGGAGGG + Intergenic
1040334239 8:46408048-46408070 CCCCCAGGGCTGTACCAGGCGGG + Intergenic
1040334598 8:46409658-46409680 CCCCCAGGGCTGTCCCAGGAGGG + Intergenic
1040334738 8:46410297-46410319 CATTTAGGGCTGTCCCAGGCGGG + Intergenic
1040334779 8:46410512-46410534 CTTCCAGGGCTGCCCCAGGCAGG + Intergenic
1040335592 8:46414383-46414405 CACCGAAGGCTGTCCCGGGCGGG + Intergenic
1040336439 8:46418443-46418465 CACCCAGGGCTTTCCCAGTCAGG + Intergenic
1040336530 8:46418872-46418894 CCCCCAGGGCTGTCCCGGGCTGG + Intergenic
1040336880 8:46420569-46420591 CCTCCAGGGCTGCCCCAGGCGGG + Intergenic
1040338063 8:46426234-46426256 CCCCCACGGCTGTCCCAGGCGGG + Intergenic
1040338217 8:46426906-46426928 CCCCCAGGGGTGCCCCAGGCAGG + Intergenic
1040338269 8:46427123-46427145 CCCCAAGGGCTGTTCCAGGCGGG + Intergenic
1040338606 8:46428630-46428652 CCCCCAGGGCTGTCCCGGGCAGG + Intergenic
1040338921 8:46430108-46430130 CCCCCAGGGCTGTCCCGGGCGGG + Intergenic
1040341849 8:46445048-46445070 CCCCTAGGGCTGTCCCGGGCGGG - Intergenic
1040341891 8:46445261-46445283 TCCCAAGGGCTGTCCCAGGCTGG - Intergenic
1040342388 8:46447517-46447539 CCCCTAGGGCTGTTCCAGGCAGG - Intergenic
1045111885 8:98944430-98944452 CTCCCCAGGCTGCCCCAGGCCGG - Exonic
1047097232 8:121639217-121639239 CACCAAGGGCTTCCCCCAACTGG - Intronic
1047251888 8:123186982-123187004 CACCGAGGGTTGCCCAAGCCTGG - Intronic
1048746460 8:137619763-137619785 AACTAGGGGCTGCCCCAGGCTGG - Intergenic
1048949136 8:139478621-139478643 CACCAAAAGCTGCTCCAGGCAGG - Intergenic
1049233016 8:141494007-141494029 CACACAGGCCTGTCCCAGGCGGG - Intergenic
1049377219 8:142295018-142295040 CACCAGGGGCTACCCAAGGCTGG + Intronic
1049420642 8:142515069-142515091 CACCAATGGCTTCTCCTGGCTGG - Intronic
1049465450 8:142749340-142749362 TCCCAAGGGCTGCCCAAGGGAGG - Intergenic
1049554895 8:143276945-143276967 CCCCAAGGTCTCACCCAGGCAGG - Intergenic
1049658026 8:143807377-143807399 CAAGACGGGCTGCCCCAGGCAGG + Intronic
1049675342 8:143886607-143886629 CACCAGGGCCTGTACCAGGCAGG + Intergenic
1051170442 9:14314990-14315012 CACCCAGGCCGCCCCCAGGCCGG + Intronic
1052815867 9:33102223-33102245 CACCAGGTGTTGGCCCAGGCAGG + Intergenic
1054873172 9:70067892-70067914 CACCTTGGGCAGCCCCATGCAGG + Intronic
1055272472 9:74576678-74576700 CACCAATTGCTTTCCCAGGCGGG - Intronic
1055566086 9:77569586-77569608 CAACAGGGGCTGCTCCAGGGAGG + Intronic
1055638079 9:78297207-78297229 CACCATGGACGCCCCCAGGCAGG + Exonic
1056103854 9:83327532-83327554 CAGCAAGGGCTTCCCCACCCAGG + Intronic
1056280276 9:85035099-85035121 AACTAGGGGCTGCCCCAGGCTGG + Intergenic
1056634518 9:88320574-88320596 CCCCTGGGGCTGGCCCAGGCAGG - Intergenic
1056670121 9:88620250-88620272 AACCAAGGGCTACCCCAGGCTGG - Intergenic
1058597404 9:106629842-106629864 CCCCAAGTCCAGCCCCAGGCAGG - Intergenic
1058815605 9:108680291-108680313 CACCCAAGGCAGCCCAAGGCAGG + Intergenic
1059686265 9:116639630-116639652 CATCAAAGACTGCCCCAGCCAGG - Intronic
1061208483 9:129177525-129177547 CTCCAAGGGCTGCCCGCGGTGGG + Exonic
1061284427 9:129613998-129614020 CCCCAATGGCTGCCCCAGGATGG + Intronic
1061489553 9:130937719-130937741 GCCCCAGGGCTGCCCCAGGCTGG - Intronic
1061850211 9:133410512-133410534 AACCAGGGGCTGCCCCAGGCGGG + Intronic
1062033350 9:134371955-134371977 CACCCAGTCCTGCACCAGGCTGG - Intronic
1062318697 9:135980095-135980117 CACCCAGGCCTGGCCCAGGAGGG + Intergenic
1062342296 9:136099217-136099239 CAGCAAGCCCTGCCCCAGGAAGG - Intergenic
1062376479 9:136264050-136264072 CACGCAGGGCTGGCACAGGCTGG + Intergenic
1062381773 9:136290279-136290301 CACCAGGGCCTCCCCCAGGGAGG + Intronic
1062473120 9:136714837-136714859 CACGGATGGCCGCCCCAGGCAGG - Intronic
1062496409 9:136833557-136833579 CACCCTGGGCTGCCCCAGCTGGG + Intronic
1203445023 Un_GL000219v1:46036-46058 CAGCAAGGCCTGGCCCAGCCTGG - Intergenic
1203451391 Un_GL000219v1:120531-120553 CACCAAAGCCAGCCCCCGGCAGG + Intergenic
1185596754 X:1311769-1311791 TACAAAGGGATTCCCCAGGCTGG - Intergenic
1186497719 X:10024985-10025007 CTCCAAGGCCTCCCCCATGCTGG - Intronic
1186638113 X:11427674-11427696 GCCCAGGGGCTGCCCCAGGATGG - Intronic
1187096647 X:16155853-16155875 CACCAACGGCTGCTGCTGGCAGG + Intergenic
1187449121 X:19381438-19381460 CACCAAGGCCTGAGCCTGGCAGG - Intronic
1189198789 X:39174296-39174318 CAGCTAGGGCTGCCACAGCCAGG + Intergenic
1190628097 X:52355908-52355930 AGGCAAGGGCAGCCCCAGGCTGG + Intergenic
1192168049 X:68838348-68838370 GACAAAGGGCTCCCCCAGCCAGG + Intronic
1193962879 X:87947436-87947458 CACTAAGGGGTGCCCCAGTAGGG - Intergenic
1194097915 X:89666105-89666127 CAGTGAGGGCAGCCCCAGGCAGG + Intergenic
1196937808 X:120746916-120746938 CAGCAAGAGCAGCCCCTGGCAGG + Intergenic
1199365125 X:146971715-146971737 CACTCAGGGCTGCCCCAGGATGG + Intergenic
1199382245 X:147184056-147184078 CACTCAGGGCTGCCCCAGGATGG - Intergenic
1200039232 X:153353735-153353757 CGGCAAGGGCTGGGCCAGGCCGG - Intronic
1200065756 X:153503431-153503453 CACCGAGGGCCACCCCAGGCTGG + Intronic
1200230379 X:154440991-154441013 CAAAGAAGGCTGCCCCAGGCAGG - Intronic
1200450937 Y:3327494-3327516 CAATGAGGGCAGCCCCAGGCAGG + Intergenic
1201584597 Y:15546776-15546798 CACAAAGAGCTGCCCCAGGCTGG + Intergenic