ID: 922782467

View in Genome Browser
Species Human (GRCh38)
Location 1:228264034-228264056
Sequence GGGGAGAGAAGGCCTGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1036
Summary {0: 1, 1: 1, 2: 7, 3: 101, 4: 926}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922782467_922782478 8 Left 922782467 1:228264034-228264056 CCCTGCCCAGGCCTTCTCTCCCC 0: 1
1: 1
2: 7
3: 101
4: 926
Right 922782478 1:228264065-228264087 CTTCCTGACCTTGATGGTGGTGG 0: 1
1: 2
2: 7
3: 29
4: 222
922782467_922782476 5 Left 922782467 1:228264034-228264056 CCCTGCCCAGGCCTTCTCTCCCC 0: 1
1: 1
2: 7
3: 101
4: 926
Right 922782476 1:228264062-228264084 TGCCTTCCTGACCTTGATGGTGG 0: 1
1: 2
2: 4
3: 11
4: 183
922782467_922782475 2 Left 922782467 1:228264034-228264056 CCCTGCCCAGGCCTTCTCTCCCC 0: 1
1: 1
2: 7
3: 101
4: 926
Right 922782475 1:228264059-228264081 TGCTGCCTTCCTGACCTTGATGG 0: 1
1: 2
2: 2
3: 30
4: 262

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922782467 Original CRISPR GGGGAGAGAAGGCCTGGGCA GGG (reversed) Intronic
900205135 1:1428192-1428214 GGGGAGGGAAGGGCAGGGCAGGG + Intergenic
900227445 1:1539913-1539935 GGGGAGCGTAGGCCTTGGTAGGG + Intronic
900299330 1:1969211-1969233 GGGCAGGGCAGGGCTGGGCAGGG - Intronic
900299359 1:1969281-1969303 GGGCTGGGAAGGCCTGGGCTGGG - Intronic
900299374 1:1969326-1969348 GGGCAGGGCAGGGCTGGGCAAGG - Intronic
900376283 1:2356220-2356242 GTGGTGGGAAGGGCTGGGCAGGG + Intronic
900397714 1:2460073-2460095 GGGCAGAAAGGGCCTGGGCAGGG - Intronic
900516769 1:3085859-3085881 GGGGAGACAAGGCCTGGGTGGGG - Intronic
900606965 1:3528011-3528033 GGGGAGACAGGGCCTGGGTGGGG + Intronic
900615627 1:3564532-3564554 GGGGAGAGGAGGCCAGTGCTGGG - Intronic
900623203 1:3596669-3596691 GTGGAGACAGGGTCTGGGCAGGG - Intronic
900714140 1:4133251-4133273 GGGAAGAGGAGGCCTGGGGCAGG + Intergenic
900998126 1:6133838-6133860 CGGGGGAGAGGGCCAGGGCAGGG + Intronic
901439016 1:9266235-9266257 AGGGAGAGAAGGCCTGGCTGCGG - Exonic
901465120 1:9416586-9416608 GGTGAGGGAAGGCATGGGCCAGG + Intergenic
901761996 1:11477828-11477850 GGGGAGTGAGTGCCAGGGCAGGG + Intergenic
901773474 1:11543198-11543220 GTGGAGAGGAGGCCTGTGGAAGG - Intergenic
902069304 1:13720344-13720366 ATGGAGAGAAGGGCTGGGTAGGG + Intronic
902079563 1:13811892-13811914 GGGCAGAGGAGGGCAGGGCAGGG + Intronic
902178557 1:14670099-14670121 GGGGAGGGGAGGGCTGGGGAGGG - Intronic
902192556 1:14773809-14773831 GAGGAGAGCAGGCCTGGCCTGGG - Intronic
902480215 1:16707743-16707765 GGGGAGAGAGGGCCGGGGGATGG + Intergenic
902565068 1:17305946-17305968 GGGGAGAGCAGCCCAGGGCGGGG - Intergenic
902669856 1:17965638-17965660 CAGGATAGAAGGACTGGGCAGGG + Intergenic
902910910 1:19596755-19596777 GAGGAGGAAAGGCCTGGTCACGG + Intergenic
903358636 1:22763285-22763307 GGGAAGACGAGTCCTGGGCAGGG + Intronic
903672487 1:25045000-25045022 GGGGAGGGAAGGGATGGGGAGGG + Intergenic
903920134 1:26794142-26794164 GAGGAGAGAAGGCTTCTGCATGG - Exonic
904492490 1:30869732-30869754 GGGCAGGGAAGGCCTGGGGGAGG + Intronic
904575705 1:31503911-31503933 GGGCAGGGAAGGGCAGGGCAGGG - Intergenic
904661890 1:32091635-32091657 GGTGAGGGAAGGCCTGCCCATGG - Intronic
905109524 1:35585080-35585102 GGGGAGAGAAGCTCTGCACAGGG + Intronic
905452179 1:38063944-38063966 GGGGAGGGGAGTCCAGGGCAAGG + Intergenic
905561819 1:38933340-38933362 GGTGCGGGAAGGCATGGGCAGGG - Intronic
905891160 1:41519207-41519229 GTTCAGGGAAGGCCTGGGCAAGG + Intronic
905914079 1:41673102-41673124 GAGAAGACAAGGCCTGGGGAGGG - Intronic
905974282 1:42163964-42163986 GGGGAAAGACAGCCTGGGCTTGG - Intronic
906461698 1:46039522-46039544 GGGGAGAAAAGACATAGGCAAGG + Intergenic
906514116 1:46428972-46428994 GGGAAGAGCAGGCAAGGGCAGGG - Intergenic
906641879 1:47445814-47445836 GGGGAAGGAAGGCGTGGGCCGGG - Intergenic
906718455 1:47987970-47987992 TGGGAGAAAAGGCTTCGGCACGG + Intronic
907191078 1:52649516-52649538 GAGTACAGAATGCCTGGGCAGGG - Intronic
907319827 1:53595197-53595219 AGGAAGAGAAGGGCTGGGGAGGG + Intronic
907336732 1:53704567-53704589 AGGGAGAGAAGGGGTGGGGAGGG + Intronic
907351782 1:53838077-53838099 GTGGAGAGAACGCGTGGGGAAGG - Intronic
907479721 1:54737060-54737082 GGGGCCAGCAGGCCTGAGCAGGG - Intronic
907661470 1:56396704-56396726 GGTGAGAGAATGCCTTGGCTGGG - Intergenic
907931664 1:59006643-59006665 TGGGAGAGAGGGCCTGGGCCGGG + Intergenic
907939837 1:59076995-59077017 GAGGAGAGATGGGCTGGGCAAGG + Intergenic
908269839 1:62412008-62412030 GGGTAGAGAAGCCCTGGAGAGGG + Intergenic
908510124 1:64844679-64844701 GCAGAGAGAAGGGCTGGGCTGGG - Intronic
909444278 1:75730815-75730837 GGGTAGAGAAAGTCTGGGCACGG - Intronic
910163056 1:84294434-84294456 GAGGACAGCAGGCATGGGCATGG - Intergenic
910747625 1:90590910-90590932 GGGTGGAGAATCCCTGGGCAGGG - Intergenic
911054202 1:93696796-93696818 GGGGACACGATGCCTGGGCAAGG - Intronic
911196447 1:94999896-94999918 GAGGAGAGATGGCCTGCGCCAGG - Intronic
911524888 1:98972801-98972823 GGCTAGTGTAGGCCTGGGCATGG + Intronic
912512646 1:110199298-110199320 GGAGAGAGAAGGACAGTGCACGG + Exonic
913680302 1:121183975-121183997 GGGAAGAGGAGGCGTGGGTAGGG - Exonic
914032137 1:143971626-143971648 GGGAAGAGGAGGCGTGGGTAGGG - Exonic
914157308 1:145096341-145096363 GGGAAGAGGAGGCGTGGGTAGGG + Exonic
914731017 1:150370200-150370222 TGGGAAAGAAGGTCTGGGCCTGG - Intronic
914872394 1:151485948-151485970 GGGGAGCAAAGGGCTTGGCATGG + Intergenic
915102338 1:153509448-153509470 GGGGAGAGAGTTCCTGTGCAAGG - Intergenic
915218771 1:154357346-154357368 AGGGAAAGAAAGGCTGGGCACGG - Intergenic
915460186 1:156065878-156065900 GGAGAGATAAGGGCTGAGCATGG - Intronic
915555641 1:156659304-156659326 AGGGGGAGAGGGCCTGGGCTGGG - Exonic
915822776 1:159042907-159042929 GGGCAGGGAAGGTATGGGCAGGG + Intronic
915823139 1:159047064-159047086 GGGCAGGGAAGGTATGGGCAGGG + Intronic
915934925 1:160084880-160084902 GGTGCGAGCAGGCCTGGGGAGGG + Exonic
915962520 1:160279073-160279095 GGGGAGAAACAGCCTGGGCTGGG - Exonic
916371679 1:164103374-164103396 GGAGAGAGAAAGCCTGGGTATGG + Intergenic
916500634 1:165384016-165384038 GGGCAGAGAAGTCCTGGGGCGGG - Intergenic
916673972 1:167050688-167050710 GGGGTGAGATGGCCTGGGTCAGG + Intergenic
916704143 1:167329415-167329437 GGGGAGAGTTGGACTGAGCAGGG + Intronic
916779405 1:168008829-168008851 GGGGAGGGCAGGGCAGGGCAGGG - Intronic
916793476 1:168144918-168144940 GTGGAGAGAAAGCCTGCTCAGGG - Intergenic
917106712 1:171499498-171499520 AGGGAGAGATGGGCCGGGCACGG + Intronic
917517208 1:175718263-175718285 GGTCAGAGAAGGCCAGGACAGGG - Intronic
917660604 1:177173540-177173562 GAGGAGAAAAGGGCTGGGGAAGG + Intronic
917846652 1:179025918-179025940 GGCGAGAGGTGGCCTGGGAATGG + Exonic
918149216 1:181783529-181783551 AGGGAGAGAAGGACTGGGGCAGG + Intronic
919803019 1:201364851-201364873 GGGAAGAGGAGGCAAGGGCAGGG + Intronic
919803171 1:201365572-201365594 GGGTTGAGTAGGCCTGGGCTGGG - Intronic
920247793 1:204601268-204601290 GGGGAGAGAGGGCTTGGGCTCGG + Intergenic
920254920 1:204648262-204648284 AGTGAGAGAGGGCCTGGGCAGGG + Intronic
920467614 1:206202510-206202532 GGGAAGAGGAGGCGTGGGTAGGG - Exonic
921932351 1:220765094-220765116 GGAGAAGGGAGGCCTGGGCATGG + Intronic
922410768 1:225373207-225373229 GGGGAGAGGAGGGCCGGGCGCGG + Intronic
922440607 1:225652887-225652909 GGCGAGAGAAAGGCTGGGGAGGG + Exonic
922515724 1:226206901-226206923 GAGGAGAGAAGGGCAGGTCATGG + Intergenic
922582625 1:226710076-226710098 GGGGAGAGGAGACAGGGGCAGGG - Intronic
922740284 1:228010574-228010596 AGGGAGAGCAGGGCTGGGTAAGG - Intronic
922780627 1:228249883-228249905 GGGAAGACAAGGCCTGGGAGGGG - Intronic
922781505 1:228256570-228256592 GGGGAGAGAAGGCCTGGAAGGGG - Intronic
922781895 1:228259419-228259441 GGGGAGAGAAGGCCTGGAAGGGG - Intronic
922782467 1:228264034-228264056 GGGGAGAGAAGGCCTGGGCAGGG - Intronic
923342871 1:233022409-233022431 GGGGAGAGGAATGCTGGGCATGG + Intronic
923386107 1:233466316-233466338 GGGGGGCCAAGGCCAGGGCAGGG - Intergenic
923448378 1:234093708-234093730 GGGCAGAGAATGCCCCGGCAGGG - Intronic
923738319 1:236633040-236633062 GGGGAGGGGAGGCCAGGGGAGGG - Intergenic
924011251 1:239667440-239667462 GGGGAGAAAAGGCCTTGTAATGG - Intronic
924309205 1:242722409-242722431 GAGGAGCCAAGGCCGGGGCAGGG - Intergenic
924444089 1:244112477-244112499 GGAGAGAGAAAGGCAGGGCAAGG + Intergenic
924929987 1:248721936-248721958 GGGGAGGCAGGGCCAGGGCAAGG + Intronic
1062939001 10:1407809-1407831 GGGGAAGGAGGGCCTGGGGATGG - Intronic
1062947872 10:1474697-1474719 GGGGAGAGAATGCGTGGGAATGG + Intronic
1063156430 10:3383436-3383458 GGGGAAACATGGCCTGAGCACGG + Intergenic
1063407801 10:5813420-5813442 GGGAAGAGAAGAACTGGGCGGGG + Exonic
1063464932 10:6236918-6236940 GGGGAGAGGAGGGCTGGGGCCGG + Intergenic
1063604246 10:7508444-7508466 GGAGAGAGAGGCCCGGGGCATGG + Intergenic
1063720367 10:8574426-8574448 GGGGAGAGATGACCTGGGTACGG + Intergenic
1064442406 10:15365478-15365500 AGGAAGAAAAGGACTGGGCATGG + Intronic
1064529863 10:16297151-16297173 GGGGAGAGAAGGGAAGGGAAGGG + Intergenic
1065829174 10:29598710-29598732 GGGGAAATAAGGCCTGGAAATGG + Intronic
1066198951 10:33127924-33127946 GGGGAGAGAACGCAAGGGAAGGG - Intergenic
1066410337 10:35162602-35162624 CAGGAGAGAAAGACTGGGCAAGG - Intronic
1066695898 10:38077201-38077223 GGGCAGTGCAGGCCTGGGCCTGG + Intergenic
1067038117 10:42933877-42933899 GGGGAGGAAGTGCCTGGGCACGG - Intergenic
1067524852 10:47032047-47032069 GGAGAGGGAAGGCCTTGGCTGGG + Intergenic
1067534164 10:47095725-47095747 GAGGAGAGAGGGCCAGGACAAGG - Intergenic
1067558624 10:47289184-47289206 GGGAAGAGCAGGCATGGCCACGG + Intergenic
1068806003 10:61194474-61194496 GAGAAGAGAAGGCAAGGGCATGG + Intergenic
1069024137 10:63521651-63521673 GGAAAGGGAAGGCCTGGGCCTGG + Intronic
1069474032 10:68717547-68717569 GGGGAGAGAAGGGGAGGGGAGGG - Intergenic
1069550802 10:69362710-69362732 CGGGAGAGAAGGCCGGGTGAAGG - Intronic
1069602716 10:69718240-69718262 GGGAAGAATAGGCCTAGGCAAGG - Intergenic
1069706175 10:70460182-70460204 GGGGAGGGGAGGCCTGGGGCAGG - Intergenic
1069748530 10:70731449-70731471 GGGGACTGCAGGCCTAGGCAGGG + Intronic
1069873413 10:71547070-71547092 GTGGAGAGCAGACTTGGGCATGG + Intronic
1070320021 10:75347609-75347631 AGGGAGAGAAGGCTGGGGCTGGG - Intergenic
1070325479 10:75386003-75386025 AGGGAGAGCAGGCTTTGGCAGGG - Intergenic
1070754803 10:78985444-78985466 GGGAAAGGCAGGCCTGGGCATGG - Intergenic
1071520523 10:86329268-86329290 GGGGAGAGGCAGCCTGGCCAAGG - Intronic
1071546785 10:86535637-86535659 GGGGCGGGGAGGCCCGGGCAGGG - Intergenic
1071695253 10:87863422-87863444 GGGGAGGGCAGGGCAGGGCAGGG - Exonic
1071737485 10:88318129-88318151 GGGCAGAGATTCCCTGGGCAGGG - Intronic
1072157927 10:92740773-92740795 GAGGAGAGAGAGACTGGGCACGG - Intergenic
1072479464 10:95796786-95796808 AGAGAGAAATGGCCTGGGCATGG + Intronic
1072706170 10:97682609-97682631 GAGCGGAGAAGGCCAGGGCAAGG - Intronic
1073284850 10:102381460-102381482 GGGAAGAGAAGGCTGGGTCAGGG + Intronic
1073349690 10:102810861-102810883 GGGGAGGGAAGGGGAGGGCAGGG - Intronic
1073353334 10:102835177-102835199 AGGGAGAGGAGGGTTGGGCAGGG - Intronic
1073444758 10:103574084-103574106 GGGGAGAGTAGTCAGGGGCAGGG + Intronic
1073718667 10:106139752-106139774 GGCTACAGAAGGCCTGGTCAAGG + Intergenic
1074766979 10:116706722-116706744 TGGTAGAGAAGCCCTGAGCAGGG - Intronic
1075031800 10:119029308-119029330 GGGGAGAGAAGGGCCGGGAAGGG - Intergenic
1075069338 10:119310351-119310373 GGGAAGAGAAAGCCAGGGGAAGG - Intronic
1075080783 10:119382159-119382181 GGAGGGAGCTGGCCTGGGCAGGG - Intronic
1075605451 10:123802114-123802136 GGGGAGCAGAGGCCAGGGCATGG + Intronic
1075614528 10:123881739-123881761 GGGGAAAGAAGACCTGGGTGGGG + Intronic
1075619329 10:123914293-123914315 AGGCAGAGAAGGCCTGGTCAGGG - Intronic
1075680554 10:124328115-124328137 AAGGAGAGAAGGCCTCTGCATGG - Intergenic
1075685877 10:124364787-124364809 GGGGAGGGAGGGCCTGAGAAAGG + Intergenic
1075852225 10:125598504-125598526 GGGGAGAGGTGGCCTTGTCAAGG - Intronic
1076036462 10:127202424-127202446 CGGGGCAGAAGGCCTGGGAAGGG - Intronic
1076110831 10:127858082-127858104 GGATAGTGAAGGCCTTGGCAAGG + Intergenic
1076406325 10:130214537-130214559 GGAGAGGGAAGGTCTGGGCATGG + Intergenic
1076446648 10:130518744-130518766 GGGTAGGGAAGTCCTGGGTAAGG + Intergenic
1076617043 10:131761940-131761962 GGGGAGAGAAGGGGAGGGGAGGG + Intergenic
1076695955 10:132247520-132247542 GGGGAGAGGACGCCTGTGCTGGG + Intronic
1076846174 10:133070568-133070590 GAGGAGAGAAGTCGTGGGAAGGG - Intergenic
1077036075 11:495109-495131 CGGCAGAGCAGGCCTGGGCCTGG + Intronic
1077073721 11:690253-690275 GGGGAGGGGAGGGCAGGGCAGGG + Intronic
1077099674 11:816529-816551 GGGGAGGGAGGGCCAGGGTATGG - Intergenic
1077218289 11:1404244-1404266 GAGGAGTGAGGCCCTGGGCAGGG - Intronic
1077268816 11:1665676-1665698 AGGGTGAGAAGGCCTGGACCAGG + Intergenic
1077271937 11:1685504-1685526 AGGGTGAGAAGGCCTGGACCAGG - Intergenic
1077282412 11:1751615-1751637 GGGGAGAGTGGGACAGGGCAGGG + Intronic
1077515948 11:3002343-3002365 GTGCAGGGAAGGCCTGGCCAAGG - Intronic
1077823261 11:5773897-5773919 GTGTAGTGAAGGTCTGGGCATGG - Intronic
1079564433 11:21864831-21864853 GGGGAGAGAAGGGGAGGGAAGGG - Intergenic
1079564441 11:21864851-21864873 GGGGAGAGAAGGGGAGGGAAGGG - Intergenic
1079564449 11:21864871-21864893 GGGGAGAGAAGGGGAGGGAAGGG - Intergenic
1079564457 11:21864891-21864913 GGGGAGAGAAGGGGAGGGAAGGG - Intergenic
1079564465 11:21864911-21864933 GGGGAGAGAAGGGGAGGGAAGGG - Intergenic
1079564473 11:21864931-21864953 GGGGAGAGAAGGGGAGGGAAGGG - Intergenic
1079564481 11:21864951-21864973 GGGGAGAGAAGGGGAGGGAAGGG - Intergenic
1079803206 11:24896555-24896577 GGGGTGAGGAGGCTGGGGCATGG - Intronic
1079861748 11:25681151-25681173 GGGGAGAGCAGGGGTGGGAAGGG + Intergenic
1080584336 11:33667837-33667859 GGGGAGAGAAGGACAGGGCCTGG - Intronic
1080706575 11:34701251-34701273 CAGCAGAGGAGGCCTGGGCAGGG + Intergenic
1080887126 11:36377196-36377218 TGGGAGAGAAGGGCAGGGCAGGG + Intronic
1080898331 11:36464067-36464089 GGGGGCAGCAGGCCTTGGCACGG + Exonic
1081261846 11:40971267-40971289 GGGCAGAGAGGCCCTGGGCCTGG - Intronic
1081794573 11:45810746-45810768 GGGGAGAGGAGGAGTGGGGAAGG - Intronic
1081937273 11:46913663-46913685 GGGGTGAGAGGGGCTGGCCAGGG - Intronic
1081986598 11:47309351-47309373 GGAGAGAGAAGGGATGGGTATGG + Exonic
1081989455 11:47329921-47329943 AGGGAGAGACAGCCTGGGTATGG + Exonic
1082022404 11:47545819-47545841 TGAGAGAGAGGGGCTGGGCATGG - Intronic
1082043333 11:47705252-47705274 GGGGAGAGAAGGCATGAGATGGG + Intronic
1083148371 11:60774835-60774857 GGGGATTGAAGGTCTGAGCAGGG + Intronic
1083212162 11:61194847-61194869 GTAGAGAGGAGGGCTGGGCATGG - Intergenic
1083217880 11:61231746-61231768 GGGGTTAGAACGCCAGGGCAGGG + Exonic
1083220870 11:61251496-61251518 GGGGTTAGAACGCCAGGGCAGGG + Intergenic
1083293042 11:61700356-61700378 GTGAAGAGAAGGTCAGGGCAGGG - Intronic
1083294483 11:61707736-61707758 GAGGAGGAAATGCCTGGGCATGG + Intronic
1083304372 11:61754908-61754930 TGTGAGAGAAGGCCTGGGAGTGG + Intronic
1083489029 11:63001180-63001202 GAGGAGAGAAGGCAAGGTCAAGG - Intronic
1083713703 11:64564008-64564030 GGGCACAGGTGGCCTGGGCATGG - Intronic
1083789209 11:64973162-64973184 GGGGAGTGGGGGCCTGGGCGCGG + Intergenic
1083889614 11:65589405-65589427 AGGGAGGAAAGGCCTGGGCTGGG + Intronic
1083989994 11:66241012-66241034 CTGGAGAGAAGGCCTGAGCCCGG - Intronic
1084085506 11:66853200-66853222 GGGGAGGGGAGGGCAGGGCAGGG + Intronic
1084183587 11:67458605-67458627 CGGGAGAGAAGGGCAGGGCTTGG - Intronic
1084431112 11:69111939-69111961 GGAGAGCGAAGGCCTGTGCATGG + Intergenic
1084551236 11:69843377-69843399 GGGGAGCAAAGGAGTGGGCAGGG + Intergenic
1084568428 11:69944633-69944655 GGTCAGAGAAGGCCGGGGCTGGG + Intergenic
1084904365 11:72334640-72334662 GGGGAGGTCAGGCCAGGGCACGG - Intronic
1084945600 11:72636752-72636774 GGGGTGATGAGGCCTGGACAGGG - Intronic
1084959745 11:72710174-72710196 GGGGAGCAAGGGCCAGGGCAGGG + Intronic
1085226847 11:74929334-74929356 GGGGAGATGAGGCCTGAGCCAGG - Intronic
1085252940 11:75155409-75155431 GGGAAGAGAAGGCTGGAGCACGG - Intronic
1085319135 11:75563571-75563593 GGAGAAACAAGGCCAGGGCAGGG - Exonic
1085463030 11:76706664-76706686 GGGAAGAGAGGGGATGGGCAGGG + Intergenic
1085779310 11:79393974-79393996 GGGGAGAAGAAGCCTTGGCAGGG + Intronic
1086092557 11:83019522-83019544 GGTGAGAGAAAGACGGGGCAGGG - Intronic
1087337786 11:96866166-96866188 GGGGAAAGAAGGCCCTTGCAGGG + Intergenic
1088224615 11:107606059-107606081 GAGGAGAGAAGGAACGGGCAAGG - Intronic
1088667526 11:112108297-112108319 GGGGAAAGAAGGCCCTGGCTTGG + Intronic
1088724091 11:112619292-112619314 GGGGAGAGAAGGCAGAGTCATGG - Intergenic
1088782630 11:113150850-113150872 GGGGAAAGATGAGCTGGGCAAGG + Intronic
1089256074 11:117194796-117194818 TGGGTGAGGAGGGCTGGGCACGG + Intronic
1089326999 11:117664107-117664129 TGGGAGAGGAGGCCAGGGGAGGG + Intronic
1089330875 11:117688228-117688250 GGGCAGAGAAGGCAGGGACAGGG + Intronic
1089587749 11:119520837-119520859 GGGGAAAGGGGGCCTGGGGAGGG + Intergenic
1089640251 11:119843210-119843232 AGGGAGAGCAGGCCTGGGGGTGG + Intergenic
1089868433 11:121651829-121651851 GGTCAGAGCAGGCCTGGGGAAGG + Intergenic
1090859877 11:130643306-130643328 GGGGAGAGAGGGGAAGGGCAGGG + Intergenic
1091211418 11:133864442-133864464 GGGGAGAAGAGACCTGGGCATGG - Intergenic
1091239585 11:134043546-134043568 AGGCTGAGAAGGCCTGGGCTGGG + Intergenic
1091296169 11:134475382-134475404 GGAGTGAGAAGGCAGGGGCATGG + Intergenic
1091605556 12:1948706-1948728 GGTGGGAGCAGTCCTGGGCAAGG - Intronic
1092119364 12:6033396-6033418 TGGGAAAGCTGGCCTGGGCAGGG + Intronic
1093032240 12:14298776-14298798 GTGGAAAGACGGCCTGGGCCAGG + Intergenic
1093256416 12:16873551-16873573 GGGGAGTGGGGGCCTGGGGAGGG - Intergenic
1094070729 12:26410274-26410296 GGGGAGAGAAGTGCTGGTGACGG + Intronic
1094233476 12:28136085-28136107 GGAGAGCCTAGGCCTGGGCAAGG + Intronic
1094257400 12:28447755-28447777 GGGGAGGGAAGGGAAGGGCAGGG + Intronic
1094257402 12:28447760-28447782 GGGAAGGGAAGGGCAGGGCAGGG + Intronic
1094493423 12:30975417-30975439 GGGGAGTGAGGGCCTGGCCTGGG - Intronic
1095431537 12:42139889-42139911 GGGGGGAAAAGGGCTGGGCACGG + Intronic
1095960385 12:47830760-47830782 GAGGAGAGAAGGGGAGGGCAGGG + Intronic
1095990544 12:48031341-48031363 GGGGAAACAAGGCATGGGCTGGG - Intergenic
1096230880 12:49896162-49896184 CGGGAGAGGAGGCCTCTGCAGGG - Intronic
1096473186 12:51891346-51891368 GGGGAAAGAAGCCCTGGGAGGGG - Exonic
1096538191 12:52288566-52288588 GGGGAGGAAAGGCATGGGAATGG - Intronic
1096660132 12:53119033-53119055 GGGAAGAGAAGGCCAGTGCTGGG + Intronic
1096707346 12:53430521-53430543 GAGGAGAGACAGGCTGGGCAAGG - Intronic
1096870560 12:54589687-54589709 GTGGAGAGAAGAACTGGGGATGG + Intergenic
1097195909 12:57242458-57242480 GGGAAGAGGAGGCCTGGGACGGG - Intergenic
1100262902 12:92949567-92949589 GGGGAGGGAAGGGAAGGGCAGGG + Intergenic
1100262904 12:92949572-92949594 GGGAAGGGAAGGGCAGGGCAGGG + Intergenic
1101898034 12:108770322-108770344 GGGCACAGAAGGCCAGGGCTGGG + Intergenic
1101898084 12:108770471-108770493 GGGCACAGAAGGCCAGGGCTGGG + Intergenic
1102229650 12:111253494-111253516 GGTGACAGGAGTCCTGGGCAGGG - Intronic
1102248082 12:111367787-111367809 GGGGAGATAAGGCAGGGGCCAGG - Intronic
1102300229 12:111766356-111766378 GGAGAGAGGCGGCCAGGGCAAGG - Intronic
1102484104 12:113244462-113244484 AGAAAGAGAAGGCCTGAGCAGGG + Intronic
1102559804 12:113754159-113754181 GGGGAGAGAAGGGGAGGGGAGGG + Intergenic
1103800480 12:123534112-123534134 GGGGAGGGGCGGCCGGGGCACGG - Intergenic
1103831391 12:123782344-123782366 GGGGAGAGAAGGGGAGGGGAGGG - Intronic
1104075398 12:125384940-125384962 GGGTAGAAAATGGCTGGGCATGG - Intronic
1104395626 12:128429957-128429979 GGGGAGAGGAGGACCAGGCATGG + Intronic
1104623155 12:130333315-130333337 GGATACAGCAGGCCTGGGCAGGG + Intergenic
1104920163 12:132286380-132286402 GGGGCCAGGAGGCCTGGGCCAGG - Intronic
1104933864 12:132354319-132354341 GGCGTGACAAGGGCTGGGCAGGG + Intergenic
1105471432 13:20698333-20698355 GGGGAGAGAAGGGGAGGGGAGGG + Intergenic
1105472262 13:20704329-20704351 GGGGAGGGCAGGGCTGGGCGGGG + Intronic
1105504517 13:20998637-20998659 GGTTAGAGGAGGCCTGGGCCCGG - Intronic
1106821440 13:33468862-33468884 AGGCAGAGAAGGCCTTAGCAAGG - Intergenic
1106998511 13:35517177-35517199 GGGGAGCGGAGGACTTGGCAAGG - Intronic
1107086546 13:36432366-36432388 GGGCAGGGAAGGGCAGGGCACGG - Exonic
1108464936 13:50706091-50706113 TGGGAGAGTCGGCCTAGGCAGGG - Intronic
1110329073 13:74250555-74250577 GGGCAGAGAAGGCCAGAGCTAGG + Intergenic
1110508298 13:76315769-76315791 GAGGAGAGAAGGCATGGTGATGG + Intergenic
1110737688 13:78957001-78957023 GGGGAGAGAAGGTCTGAGGAAGG + Intergenic
1110826165 13:79974454-79974476 GAGAAGAGATTGCCTGGGCAGGG + Intergenic
1111504821 13:89174147-89174169 GGGGAGAGAAGGGAAGGGAAGGG - Intergenic
1112028791 13:95438398-95438420 GGGAAAAAAAGGCCTTGGCAGGG - Intronic
1112435405 13:99388451-99388473 GGAGAGAGGAGGGCTGGGGATGG + Intergenic
1113562316 13:111291495-111291517 GGGCAGAAAAGGATTGGGCAGGG - Intronic
1113670169 13:112170801-112170823 GGTGAGAGGAGGCCTTGGGAGGG + Intergenic
1113768952 13:112896500-112896522 GGTGGGAGAAGGCCTGGGATTGG + Intronic
1113796384 13:113061101-113061123 GATGAGAGAAGGGCTGGGGAGGG + Intronic
1113808746 13:113124499-113124521 GGAGAGAGATGGCCTGGCCCTGG - Intronic
1114183214 14:20382242-20382264 GGGCAGTCAAGGCCTGGGGAAGG + Exonic
1114402914 14:22426426-22426448 GGGGAGAGGAGGCAGGGGGAAGG - Intergenic
1115192592 14:30761505-30761527 GGGGAGACAAGGCCAGAACAGGG - Intergenic
1116788922 14:49318867-49318889 GGGGAGAGGAGGGGAGGGCAGGG + Intergenic
1117253492 14:53956352-53956374 GGACAGAGAAGGCCTGGGCAGGG + Intronic
1118125706 14:62901365-62901387 GGGGAGAGAGGGAGGGGGCAAGG - Intronic
1118609407 14:67528447-67528469 GGGGAGGGAGGAACTGGGCAGGG - Intronic
1119341525 14:73883157-73883179 GGGGAGGGAAGGGCAGGGAAGGG - Intronic
1119373103 14:74164642-74164664 GGAGAGTGAAGGCCTGGGTGTGG - Intronic
1119485242 14:74982518-74982540 GGAGAGAGCCAGCCTGGGCAAGG - Intergenic
1119663258 14:76466123-76466145 GCGGAGAGCAGCCCTGGGGAAGG - Intronic
1119673732 14:76538904-76538926 GGGGAGAGAAGGGAAGGGAAAGG - Intergenic
1119729103 14:76939895-76939917 GGGCAGCCAAGGCCTGGGCTGGG + Intergenic
1120880776 14:89413878-89413900 GGGCAGGGAAGGGCAGGGCAGGG + Intronic
1120882944 14:89428781-89428803 GGGGCGTGGAGGCCTGCGCAGGG - Intronic
1121249102 14:92486360-92486382 GGGCTCAGAGGGCCTGGGCATGG + Intronic
1121250113 14:92493142-92493164 CTCTAGAGAAGGCCTGGGCAAGG + Intronic
1121337858 14:93088177-93088199 AGGGAGAGCAGGCCTGGGTGGGG - Intronic
1121337982 14:93088924-93088946 GGGGAGAGCGGGCCTGGGTGGGG - Intronic
1121416001 14:93779747-93779769 CTGGAGAGAAGGCCAGGGCTTGG - Intronic
1121464894 14:94109360-94109382 GGGCAGAGAAGGGCAGGGAAGGG + Intronic
1121566314 14:94912602-94912624 GGTGAGGGGAGGCTTGGGCATGG + Intergenic
1122007765 14:98719276-98719298 GGGGAGAGGAGGCCAGGGAAGGG + Intergenic
1122036979 14:98956158-98956180 GATGACAGAAGGCATGGGCAGGG + Intergenic
1122428289 14:101624154-101624176 TGGGAGATGAGGCCAGGGCAGGG - Intergenic
1122542417 14:102505759-102505781 GGGGGGAGCACACCTGGGCATGG - Exonic
1122831145 14:104396569-104396591 GGAGAGAAAGGGCCAGGGCAAGG - Intergenic
1122916866 14:104863549-104863571 AGGTAGAGAAGCCCTGGGTAGGG + Intergenic
1122921523 14:104882355-104882377 GGGTCGGGAAGGCCGGGGCAGGG + Intronic
1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG + Exonic
1124713083 15:32030872-32030894 AAGGAGAGAAGACCCGGGCAGGG - Intronic
1124963943 15:34419394-34419416 GGGGAGAGGGGGCCTGGAGACGG - Intronic
1124980557 15:34565625-34565647 GGGGAGAGGGGGCCTGGAGACGG - Intronic
1125518850 15:40337403-40337425 GAGGGGAGAAGGCCCGGCCAGGG - Exonic
1125770210 15:42160154-42160176 TGGGAGAGAAAGCCTGGGTAGGG + Exonic
1126167540 15:45666775-45666797 GGGGAGAGAAGGGGAGGGGAGGG - Intronic
1127260474 15:57323373-57323395 GTGGGGAGCAGGCCTTGGCAGGG + Intergenic
1127335440 15:57979412-57979434 GGGGAGAAGAGACCTGGGCTTGG - Intronic
1127367055 15:58300926-58300948 GGAGAGATAAGACCAGGGCATGG - Intronic
1127512632 15:59657579-59657601 GGCGAGAGCAGGGCTGGGCGGGG - Intergenic
1127735795 15:61838256-61838278 GTAGTGAGAAGGTCTGGGCAAGG - Intergenic
1127969576 15:63947799-63947821 GAGGAAAGAAGGTTTGGGCAGGG - Intronic
1127981751 15:64040405-64040427 GGTGAGAAAAGGCTTGAGCAGGG - Intronic
1128147872 15:65342676-65342698 GGGGAGTGCAGGCAAGGGCAAGG - Intronic
1128350748 15:66886851-66886873 GGGGGCAGAAGGGCTGGGAAGGG + Intergenic
1128637945 15:69315150-69315172 GGGGAAAGGAGCTCTGGGCAAGG - Intronic
1129301728 15:74629357-74629379 GGGGAGGGAAGACCTAGACATGG + Intronic
1129363526 15:75040069-75040091 GAGAAGAGAACGGCTGGGCATGG - Intronic
1129384641 15:75189281-75189303 GGGGACAAAAGGCCTGGAAAGGG - Intergenic
1129446250 15:75620565-75620587 GGGGAGTGAAAGTCTGGGCGTGG + Intronic
1129890966 15:79071728-79071750 GGGGAGGGAAGACCTGGGAAGGG - Intronic
1130921103 15:88345274-88345296 GGGGAGAGAATGACTGGGATGGG - Intergenic
1131158708 15:90090647-90090669 GGGGACAGAGGGCCAGAGCAAGG + Intronic
1132046502 15:98567131-98567153 GGGGAGAGATGGCCTATGCATGG + Intergenic
1132300254 15:100770966-100770988 GGGAGGGGAAGGCCTGGCCAAGG - Intergenic
1132426020 15:101718076-101718098 GGGGAGAGTAGGGCTGGGCGTGG + Intronic
1132570993 16:643917-643939 GGCTAGAGGAGCCCTGGGCAGGG + Intronic
1132603491 16:784112-784134 GGGGAGGGGAGGCCGGGGCCAGG + Intergenic
1132884627 16:2177217-2177239 GGGCAGGGGAGGTCTGGGCAAGG - Exonic
1133770267 16:8863653-8863675 GGCCAGAGTAGGCCTGGCCAAGG + Intronic
1133801968 16:9091823-9091845 GGGGTGGGAAGGCCTGGGGCGGG + Exonic
1134091142 16:11392297-11392319 GAGGTGAGAGGGCCTGGGCTGGG - Exonic
1134386987 16:13782469-13782491 GGGTAGAGAGGTCCTGGGGATGG - Intergenic
1134412413 16:14014084-14014106 GGGGAGAGGAGGGGAGGGCATGG - Intergenic
1134488547 16:14678359-14678381 GGAGAGAGGTGGCTTGGGCAGGG - Intronic
1134518830 16:14908544-14908566 GGGCAGAGCCAGCCTGGGCAGGG - Intronic
1134555098 16:15157680-15157702 GGGCAGAGCCAGCCTGGGCAGGG + Intergenic
1134706501 16:16307199-16307221 GGGCAGAGCCAGCCTGGGCAGGG - Intergenic
1134751725 16:16630705-16630727 GGGGAGGGAAGGGCAGGGAAGGG - Intergenic
1134961039 16:18404925-18404947 GGGCAGAGCCAGCCTGGGCAGGG + Intergenic
1134965341 16:18487528-18487550 GGGCAGAGCCAGCCTGGGCAGGG + Intronic
1134993731 16:18722965-18722987 GGGGAGGGAAGGGCAGGGAAGGG + Intergenic
1135100026 16:19597068-19597090 GGGAAGGAAAGGGCTGGGCATGG + Intronic
1135182569 16:20288434-20288456 GGGTGGAAAAGGCCTGGGCTTGG + Intergenic
1135866771 16:26110429-26110451 GGGAGGAGAAGACTTGGGCATGG - Intronic
1135891943 16:26365328-26365350 TGGGAGGGAGGGTCTGGGCAGGG + Intergenic
1136051064 16:27650334-27650356 GGGCAGAACAGGCCTGGGCCAGG + Intronic
1136117453 16:28103719-28103741 GGGATGGGAAGGCCAGGGCAAGG + Intronic
1136270865 16:29147519-29147541 GTGGAAAGTGGGCCTGGGCAGGG - Intergenic
1136561145 16:31039932-31039954 TGGGAGAGAAGGCCAGGCCCTGG - Exonic
1136993159 16:35169562-35169584 GGGGAGGCAAGGCCAAGGCAGGG + Intergenic
1137044716 16:35644301-35644323 GGGGAGAGAAGGGCTGAGCTGGG - Intergenic
1137617015 16:49854696-49854718 GGGGAGAGGAGGCCAGGGGAGGG + Intronic
1137617136 16:49855115-49855137 GCCGGGAGAAGGCCTGGGCAGGG + Intronic
1138422630 16:56909530-56909552 GGGGTGGGACGCCCTGGGCAGGG - Intronic
1138450692 16:57092275-57092297 GGGCAAAGCAGGCCTGGGGAGGG + Intergenic
1138600385 16:58050495-58050517 AGAGAGAGAAAGGCTGGGCATGG + Intergenic
1139004216 16:62551377-62551399 GGGGAGAGAAGGGGAGGGGAAGG - Intergenic
1139290325 16:65852470-65852492 GGGGAGAGGAGAACTGGGTATGG - Intergenic
1139325733 16:66151464-66151486 GGTGAGAGAAGGACAGGGCAGGG + Intergenic
1139495489 16:67314145-67314167 AGGGAGAGAGGGGCTGGGCACGG - Intronic
1139505499 16:67396323-67396345 GGGGAAAGCAGGCCCGGGAAGGG + Intronic
1139529328 16:67535257-67535279 GGGCAGTGAGGGCCTGGCCAAGG + Intronic
1139545685 16:67648544-67648566 GAGGGGCGAAGGCCAGGGCAGGG - Intronic
1139602273 16:67993842-67993864 GGAGAGAGAAGGTCAGGGCCAGG - Exonic
1139692597 16:68650716-68650738 GGGGAGAAGAGACCTGGGCGTGG - Intronic
1140066499 16:71615792-71615814 GGAGAAAAAAAGCCTGGGCATGG + Intergenic
1140297638 16:73724915-73724937 GGAGGGAGAAGGCCCAGGCAAGG - Intergenic
1140516238 16:75544320-75544342 GGTCAGAGAAGGACTGGGCTTGG + Intronic
1140666570 16:77233664-77233686 GAGGAGAGAAGCCCTGGACTTGG + Intergenic
1140765603 16:78154059-78154081 AGGGAGAAATGGCTTGGGCATGG - Intronic
1141600116 16:85120608-85120630 AGGGAGGGAAAGGCTGGGCACGG - Intergenic
1141676885 16:85522385-85522407 GGGGAGGGATGGGCTGGGGAGGG - Intergenic
1141952503 16:87348063-87348085 ATGGGGTGAAGGCCTGGGCAGGG - Intronic
1141968583 16:87464177-87464199 GGGGAGAGGAGGGCTGAGCAGGG + Intronic
1142030434 16:87835834-87835856 AGGGAGAGATGGTCCGGGCAGGG + Intronic
1142213932 16:88821746-88821768 GAGCATAGAAAGCCTGGGCAGGG + Intronic
1142288653 16:89182262-89182284 GGGGAGGGGAGGCTTGGGGAGGG - Intronic
1142504936 17:357250-357272 GGTGAGAGATGTCCTGGCCACGG - Intronic
1142598650 17:1041926-1041948 GGGGAGAGAAGGCCGAGGCAGGG + Intronic
1142737577 17:1910984-1911006 GGGGACAGTGGGGCTGGGCACGG + Intergenic
1142872299 17:2828732-2828754 GGGGAGATAAGCCCTGGCCGGGG + Intronic
1143118412 17:4593219-4593241 GGAGAGGGAAGGCCGGGGCTGGG + Intronic
1143127710 17:4654878-4654900 GGGGAGAGAAGGGGAGGGGAGGG + Intergenic
1143376282 17:6469454-6469476 CGGAAGAGCAGGGCTGGGCAGGG - Intronic
1143499298 17:7329545-7329567 GGGGGACGAAGACCTGGGCAGGG + Intergenic
1143501438 17:7341842-7341864 GGGGAGCGCCGCCCTGGGCAAGG + Intronic
1143514207 17:7411312-7411334 GAGGAGAGGAAGCCTGGGTAAGG + Intronic
1144398020 17:14864791-14864813 TGAGGGAGCAGGCCTGGGCATGG + Intergenic
1144666072 17:17103074-17103096 AGGGAGACAAGGCCTTGGCATGG - Intronic
1144751625 17:17652854-17652876 GGAGAAAGCAGGCCTTGGCAGGG + Intergenic
1144838672 17:18172147-18172169 GCGCTGAGGAGGCCTGGGCAGGG - Exonic
1145092505 17:19997704-19997726 GGGGAGATCAGGCCTGTTCAGGG - Intergenic
1145962636 17:28896618-28896640 GGGGATAGAAGCCCTGAGCCAGG - Intronic
1146396756 17:32474006-32474028 TGGCAGAGATGGCCTGAGCAGGG + Intronic
1146889024 17:36492962-36492984 GGGGAGAGTGGGGCTGGTCAGGG + Intronic
1147015471 17:37488955-37488977 GGTGAGTCAAGGACTGGGCATGG + Intergenic
1147312473 17:39603712-39603734 GGGGAGAGAAGGTTTGAGCTGGG - Intronic
1147353514 17:39870331-39870353 GTTCAGAAAAGGCCTGGGCACGG - Intronic
1147600057 17:41739781-41739803 CGGGAGAGAATGCCAGGGGAGGG - Intergenic
1147614679 17:41820992-41821014 GGTGATCGAAGGCCTGGACACGG + Exonic
1147971859 17:44222378-44222400 GGGGATGAAAGGCCTGGACAGGG + Intergenic
1148495095 17:48048646-48048668 GGGGTGGGATGGACTGGGCAGGG + Intronic
1148557546 17:48587469-48587491 GGGGAGACTAGCCCTGGGAAGGG + Intronic
1148794749 17:50191653-50191675 GGGGGGAAAAGACCAGGGCAGGG - Intronic
1148821428 17:50361955-50361977 GGGGAGAGGAGGCTTGGGAAAGG - Intronic
1150056675 17:62023113-62023135 GGGGAGAGAAAGGATGGTCAAGG + Intronic
1150133602 17:62682178-62682200 GGGCAGAGCAGGGCAGGGCATGG - Intronic
1150626404 17:66843959-66843981 GGGGGGAGAGAGCCTGGGCTGGG + Intronic
1151422879 17:74009928-74009950 TGGGAGAGAAGACATTGGCAGGG - Intergenic
1151823282 17:76508867-76508889 GGGAAGAGGAGGCTTTGGCAGGG + Intergenic
1151828621 17:76537323-76537345 GGGCAGAGGAGGGCTGGGCCCGG - Intronic
1152259658 17:79260203-79260225 GGGGTGTGAGGGTCTGGGCAAGG - Intronic
1152438096 17:80288374-80288396 CGGGAGAGATGGCCTGGGAGTGG + Intronic
1152460806 17:80441426-80441448 TGGGAGAGATGGCCTGGGCTGGG - Intergenic
1152495365 17:80667303-80667325 AGGGAGACCAGGGCTGGGCAAGG + Intronic
1152512460 17:80799731-80799753 GGGGAGGGAAGGGGTGTGCAGGG - Intronic
1152512472 17:80799762-80799784 GGGGAGGGAAGGGGTGTGCAGGG - Intronic
1152538728 17:80964233-80964255 GGAGAGAGAAGGGGTGAGCAGGG - Intronic
1152636563 17:81432769-81432791 GGGGAGGGTGGGCCTGGGGATGG - Intronic
1152636588 17:81432818-81432840 GGGGAGGGTGGGCCTGGGGATGG - Intronic
1152699176 17:81810782-81810804 GGGCAGAGCAGGGCAGGGCAGGG - Intronic
1152716530 17:81903147-81903169 GGGGAGCGAAGGGCTGGGGGAGG - Intronic
1152793238 17:82293252-82293274 GAGGAGAGAGGGCGCGGGCAGGG + Intergenic
1152794802 17:82301648-82301670 GTGGAGAGAGGGCCCAGGCAGGG + Intergenic
1152799571 17:82324507-82324529 GAGGGGAGGGGGCCTGGGCAGGG - Intronic
1153656509 18:7287549-7287571 GGTGAGAGAAGGTAGGGGCATGG + Intergenic
1153960691 18:10137541-10137563 TGGGAGAGAGGGCCTGGCCAGGG + Intergenic
1154206846 18:12344802-12344824 GGTGAAAGCAGGCCTGGGGATGG - Intronic
1154373265 18:13785805-13785827 AGGGAGGGAGGGCCAGGGCAAGG - Intergenic
1154437449 18:14357729-14357751 GGGGAGACGAGACCTGGGCATGG - Intergenic
1155324071 18:24648473-24648495 GGGGAGAGCAGCCTTGGACAAGG + Intergenic
1155626038 18:27835539-27835561 GGTGAGAGAGGGTCAGGGCAAGG + Intergenic
1156059473 18:33056229-33056251 GGGGAGAGAAGGGATGAGCAGGG + Intronic
1156836540 18:41561915-41561937 GAGGAGAGAAAGAATGGGCAGGG - Intergenic
1156904053 18:42333558-42333580 GGGCAGAGTGGGGCTGGGCATGG - Intergenic
1157110193 18:44813378-44813400 GGGGAGACAAGTGCTGGACAGGG + Intronic
1157428273 18:47602439-47602461 GGAGCCAGAAGGCCTTGGCAGGG - Intergenic
1157499178 18:48178021-48178043 GGAGAGGGAGGGGCTGGGCAAGG - Intronic
1157619340 18:49007097-49007119 GGAGAGAAAAGGTCTGTGCATGG - Intergenic
1158256273 18:55552560-55552582 GAGGAGAAAAGGCCAGGCCACGG + Intronic
1158543231 18:58375154-58375176 GGGCACAGCAAGCCTGGGCACGG - Intronic
1158850557 18:61492238-61492260 AGGGAGAGAATGTGTGGGCAGGG - Intronic
1158949050 18:62475006-62475028 TGGGAGCGAAGGCCTGGGAAGGG + Intergenic
1159005413 18:63005813-63005835 GGGGAGAGGAGACCACGGCAAGG - Intergenic
1160015849 18:75139812-75139834 AGGGAGTGAAGGCCTGAGGAAGG - Intergenic
1160526894 18:79543623-79543645 AGGGAGACCAGGCCTGGGGAGGG + Intergenic
1160703147 19:517832-517854 GGGGAGGGGAGGCCCGGGCTGGG + Intronic
1160776682 19:859742-859764 GCGGTGAGGAGGCCTGGGCCTGG + Exonic
1160984603 19:1832495-1832517 GGTGGGAGGAGGCCTGGTCACGG + Intronic
1161104067 19:2434615-2434637 GCAGAGACCAGGCCTGGGCATGG + Intronic
1161348241 19:3778425-3778447 GCGGACAGCAGGCGTGGGCAGGG + Intronic
1161427191 19:4210138-4210160 GGTGAGAGATGCTCTGGGCACGG + Exonic
1161857052 19:6772159-6772181 GGGGAGAGAGGGAGTGGGGAGGG + Intergenic
1161894999 19:7073725-7073747 GGGGAGAGAAGGATTGGGAGAGG - Intronic
1161965323 19:7544660-7544682 GGGGAGAGAAGCCTGGGGCAGGG + Intronic
1162212984 19:9107907-9107929 GGGTACAGAAGTCCTGGGTAAGG + Intergenic
1162422375 19:10573126-10573148 GGGGAGAGGGGGGCCGGGCACGG + Intronic
1162478615 19:10915399-10915421 GGGGAGGCCAGGCCTGTGCAAGG + Intronic
1162551070 19:11358553-11358575 AGGGAGAGAAGAGATGGGCATGG - Intronic
1162612681 19:11768191-11768213 GAGGAGAGAAAGCCTGAGGAAGG - Intronic
1163314254 19:16531573-16531595 GGGGAGCAAGGGCCTGGGCTGGG + Intronic
1163339302 19:16694419-16694441 GGGGAAAGAAGGACAGGGTAGGG + Intergenic
1163365934 19:16876228-16876250 GGTGAGAGGAGGCCTGGGGCTGG + Exonic
1163507792 19:17718558-17718580 GGGGAGAGAAGGGGAGGGGAGGG + Intergenic
1163585454 19:18161254-18161276 GCGGACAGATGGCCAGGGCAGGG - Intronic
1163612021 19:18306609-18306631 GGGGAGGGAAGTCCCAGGCAGGG - Exonic
1163668518 19:18614048-18614070 GGGGAGAGGTGGCCTGGGAAGGG + Intronic
1164500339 19:28814444-28814466 GAGGAGAGAGGGACTGGGCATGG - Intergenic
1164546125 19:29164529-29164551 GGAGGGAGAAGGAATGGGCAGGG + Intergenic
1164578731 19:29421264-29421286 GTGCAGACACGGCCTGGGCAGGG + Intergenic
1164650648 19:29888684-29888706 TGGGAGAGAAGGGCGGGGAAAGG + Intergenic
1164769077 19:30794484-30794506 GGTTAGAGGAGGGCTGGGCAGGG + Intergenic
1164782731 19:30906544-30906566 GGGGAGGGGAGGGCAGGGCAGGG + Intergenic
1165171071 19:33891968-33891990 GGGTAGAGATGGCCTAGGTAGGG - Intergenic
1165412468 19:35670504-35670526 GGGGAGAGGAGGCGAGGGGAGGG - Intronic
1165440696 19:35825212-35825234 GGGGAGAGAAGGGAAGGGAAGGG + Intergenic
1165793878 19:38507435-38507457 GAGGAGAGAAGGGCTGAGAAGGG + Intronic
1165941416 19:39416466-39416488 GGGGAGAGCAGGCTTGGGCTAGG + Intronic
1166046211 19:40232567-40232589 AGGGAGGGGAGGCGTGGGCAGGG + Exonic
1166064754 19:40350945-40350967 AGAGAGAGTAGGGCTGGGCACGG + Intronic
1166524362 19:43501874-43501896 GCGGAGAGAATGCCAGGGCTGGG + Intronic
1166539395 19:43595353-43595375 GGGTAGAGAAGACCTGGGTCAGG + Intronic
1166676564 19:44745016-44745038 GGAGAGAGTAGGGCTGGTCAGGG - Intergenic
1166679814 19:44759418-44759440 GCGGAGAGAAGACCTGAGGAAGG - Exonic
1166690359 19:44818731-44818753 GGGGAGTGGAGTCCTGGGAAGGG - Exonic
1166712874 19:44948550-44948572 GGGGAGGGAAGCCTTGGGGAGGG + Intronic
1166794232 19:45416732-45416754 GAGAAGGGAAGGGCTGGGCAGGG + Intronic
1167158309 19:47752487-47752509 GTGGAGAAAAGGCCGAGGCAGGG - Intronic
1167211400 19:48136130-48136152 GGAGAGAGCAGGCCAGGGAAGGG + Intronic
1167237787 19:48325531-48325553 GGGAGGAGAAGGGCGGGGCACGG + Exonic
1167375114 19:49107068-49107090 GGGGAGACCAGTCCAGGGCAAGG + Intronic
1167463294 19:49637602-49637624 AGAGAGAGAAGGACAGGGCAGGG - Intronic
1167538761 19:50072279-50072301 GGCAAGACGAGGCCTGGGCAGGG + Intergenic
1167599645 19:50447043-50447065 AGGGAAGGAAGGCCTGGGCCAGG - Intronic
1167715514 19:51140608-51140630 GGGGAGAGAGTGGCTGGGCAAGG + Intergenic
1168107654 19:54174272-54174294 GGGGCCAGAAGGCCTGGGACTGG - Exonic
1168721221 19:58555960-58555982 GGGGAGGCAAGGCCAAGGCAGGG + Exonic
1202714255 1_KI270714v1_random:33653-33675 GGGGAGAGAGGGGCGGGGGATGG + Intergenic
925018629 2:551601-551623 GGGTTGAGAAGGGCTGGGCTGGG - Intergenic
925121654 2:1422876-1422898 GGGAAGTGAAGGCCTGTGGAGGG + Intronic
925146930 2:1588091-1588113 GGGGACAGAGGGACAGGGCAGGG - Intergenic
925184622 2:1838574-1838596 GGGGAGTGAAGACCTGGGATGGG - Intronic
925817348 2:7767022-7767044 AGGGAGACAGGGCCTGGGCTGGG - Intergenic
925833959 2:7924643-7924665 GAGGACAGCAGGCCAGGGCAGGG - Intergenic
925911002 2:8573636-8573658 TGGGAGTGAAGGCCTGTGCAAGG + Intergenic
926035426 2:9631825-9631847 GGGGAGAGATGTTATGGGCAGGG - Intergenic
926053083 2:9757147-9757169 GGGGATTCAAGCCCTGGGCAGGG - Intergenic
926133584 2:10320664-10320686 GGAGAGAGAATCCCTGGGGAGGG + Intronic
926169957 2:10546807-10546829 GGAGAGAGAAAGCCTGCGCCTGG - Intergenic
926219448 2:10925298-10925320 ATGGAGAGAAGCCCTGTGCATGG - Intergenic
927199572 2:20569980-20570002 GGCCAGAAAAGCCCTGGGCAGGG - Intronic
927872229 2:26630934-26630956 GGGGAGAGCAGGTCTGGGTCAGG - Intronic
927992369 2:27457277-27457299 TGGGAAAGAAGGGCTGGGCAAGG + Intronic
928264756 2:29802321-29802343 GGGGAGAGGAGGGGAGGGCAGGG + Intronic
928398699 2:30962727-30962749 GGGGCCAGAGGGTCTGGGCAGGG + Intronic
929013247 2:37469051-37469073 GGGGAGGGCAGGGCAGGGCAGGG - Intergenic
929574043 2:43041276-43041298 GGGGAGGGAAAGGCAGGGCAGGG - Intergenic
929936337 2:46297072-46297094 GGGGAGAGGCAGCCTGCGCAGGG - Intronic
930021468 2:47004420-47004442 GGGGAGAGCAGTCCTGCCCAAGG + Intronic
930374020 2:50541232-50541254 GGGGAAAAAAGCCCTGGGAAAGG + Intronic
931358283 2:61555970-61555992 GGGGAGGGAAGGGCTGGGCGTGG - Intergenic
932885282 2:75543597-75543619 GGGGAGAGAAGTTCTGGGTGGGG + Intronic
933229242 2:79786960-79786982 GGGGAGATAATGCCAAGGCAGGG - Intronic
933782170 2:85810562-85810584 GGTCAGACAAGGCCTGGGCCTGG - Intergenic
934461890 2:94217192-94217214 GGGTAGAAAAGGCCAGGGTAGGG - Intergenic
934488388 2:94738530-94738552 GGGGAGAAGAGACCTGGGCATGG + Intergenic
934714838 2:96537462-96537484 GGGAAGAGAAGGAAGGGGCAGGG - Intronic
935590472 2:104842949-104842971 GGGGAGCGAAGGGGTGGGGAGGG + Intergenic
936117035 2:109710770-109710792 GGTGAGAGGAGACCTGGGGAAGG + Intergenic
938120878 2:128632264-128632286 TGAGAGAGCAGGCCTGGGAAGGG - Intergenic
938339583 2:130526729-130526751 GGGCAGGGCAGGCCTGGTCAGGG + Intronic
938350253 2:130594021-130594043 GGGCAGGGCAGGCCTGGTCAGGG - Intronic
938771197 2:134502720-134502742 GTGGAGAGAAACACTGGGCAAGG - Intronic
938850374 2:135253361-135253383 AGGGGGAGAAAGCCTGGACAGGG + Intronic
938968343 2:136408037-136408059 GGGGAGAGAACACCTGGAGAGGG + Intergenic
941158891 2:162012814-162012836 GTGGAGAGATGGGCTGGGGAGGG - Intronic
941203208 2:162540649-162540671 GGGGAGAGTAGGCAAGGTCAAGG + Intronic
941350364 2:164425366-164425388 GGGGGTAGGAGGCCTGGGCAGGG - Intergenic
942149035 2:173056691-173056713 GTTGAGAGAAGGAGTGGGCAGGG + Intergenic
944408757 2:199415800-199415822 GGAAAGAGAAGGGCTGGGCCAGG - Intronic
944597662 2:201276246-201276268 GGGAAGAGATGGGCTGGTCAGGG - Intronic
945196250 2:207239981-207240003 GGAGAGAGAAGAGCTGGACAGGG + Intergenic
945221810 2:207491138-207491160 AGGGACAGAAGGACTGGGGAGGG - Intergenic
945944408 2:215980857-215980879 GGGGAGGGGAGGGCAGGGCAGGG + Intronic
945944410 2:215980862-215980884 GGGGAGGGCAGGGCAGGGCAGGG + Intronic
946042227 2:216792250-216792272 GGGGAGAGGAGACTGGGGCAAGG + Intergenic
946173518 2:217909124-217909146 GGGTAGAGAGGGCCTGGGGTGGG - Intronic
946306096 2:218857868-218857890 GGTGGGAGCAGGGCTGGGCAGGG + Intergenic
946326390 2:218986604-218986626 GGGTGGAGGAGGCCTGGGAATGG + Intergenic
946529814 2:220559022-220559044 GGGGAGAGCAGGGCTAGGCTAGG - Intergenic
946685972 2:222270322-222270344 GGGGAGAGAAGCCCTGACAATGG - Intronic
947752819 2:232541587-232541609 GGTGGGGTAAGGCCTGGGCAAGG + Intronic
948232111 2:236356254-236356276 GGCAAGGGAAGGCCAGGGCAGGG - Intronic
948232333 2:236359066-236359088 GGCAAGGGAAGGCCAGGGCAGGG + Intronic
948464801 2:238147358-238147380 GGGGAGAGCAGGCCCTGGCCTGG - Intronic
948610616 2:239164002-239164024 AGGGAGGGAAGGGCTGGGGACGG + Intronic
948691400 2:239707123-239707145 GGGCAGGGAAGGGCAGGGCAAGG - Intergenic
948691461 2:239707303-239707325 GGGCAGAGCAGGGCAGGGCAGGG - Intergenic
948691478 2:239707353-239707375 GGGCAGGGAAGGGCAGGGCAAGG - Intergenic
948691540 2:239707533-239707555 GGGCAGAGCAGGGCAGGGCAGGG - Intergenic
949022966 2:241751869-241751891 GGAGGGGCAAGGCCTGGGCAGGG + Intronic
949064181 2:241979862-241979884 GGGGAGGGAAGGGTTGGGGAGGG + Intergenic
1168756487 20:322030-322052 AGGGAGGGAGGGGCTGGGCAAGG - Intergenic
1168935929 20:1665250-1665272 GGGGATAGAAGGGCTGGCCAAGG - Intergenic
1168998051 20:2147166-2147188 GGGCAGAGATGCCCGGGGCAGGG + Exonic
1169285041 20:4300791-4300813 GGGGGCAGAAGGGCTGGGGATGG - Intergenic
1169439934 20:5625598-5625620 GGGGAGAGAAGTTCCAGGCAGGG + Intergenic
1170306476 20:14944231-14944253 AGGGAGAGGAGGGCTGGGGAAGG + Intronic
1170735212 20:19008378-19008400 TCAGAGACAAGGCCTGGGCAGGG - Intergenic
1170917551 20:20642136-20642158 GGGGAGAGAAGGGGAGGGGAGGG + Intronic
1171377337 20:24702526-24702548 GGGGAGAGGAGACAGGGGCAGGG + Intergenic
1171411851 20:24952953-24952975 GAGGAGAGAAAACATGGGCAGGG - Intronic
1171467112 20:25337388-25337410 TGGGAGAGGAGGGCTGGGCTTGG - Intronic
1171469994 20:25362605-25362627 GGGGAGGGAAGGACAGGGGAGGG + Intronic
1172187000 20:33037042-33037064 GGGGAGGGTAGGGCTGGGCTAGG + Intronic
1172693848 20:36808451-36808473 GGGGAGAGAGGGACAGGGAAGGG - Intronic
1172799437 20:37565680-37565702 GTGGAGAGTGGGCCTGGGCAGGG + Intergenic
1172876290 20:38166307-38166329 GGGAAGAGAAGGCCGAGGGAGGG - Intronic
1173088042 20:39943281-39943303 GTGGAGAGCTGGCCTGCGCACGG + Intergenic
1173285838 20:41670869-41670891 TGGTGGAGAAGGGCTGGGCAGGG - Intergenic
1173522738 20:43711614-43711636 GGGGTGGGAGAGCCTGGGCAGGG + Intronic
1173596369 20:44261078-44261100 GGGGAGAGAGGGGGTGGGCTGGG - Intronic
1173904181 20:46613804-46613826 GGGGGAAGGAGGCCTGGGCTGGG + Intronic
1174040255 20:47694354-47694376 GGGTAGAGAAGGCCTGGGCCGGG + Intronic
1174169091 20:48605123-48605145 GGAAAGAAAAGGCCTGGGGAGGG + Intergenic
1174261812 20:49301620-49301642 GGGAAGAGAGGGACGGGGCAGGG - Intergenic
1174353028 20:49981858-49981880 GGAGAAAGAAGGCATGGGCCGGG - Intergenic
1174408424 20:50318025-50318047 AGGGAGAGGAGGTATGGGCAGGG + Intergenic
1174571326 20:51503746-51503768 AGGGAGAGGAGGCTGGGGCAGGG + Intronic
1175196222 20:57245015-57245037 AGGGAGACAGGGGCTGGGCATGG - Intronic
1175276168 20:57772397-57772419 GGGCAGAGAAGGACTGGTGAAGG + Intergenic
1175303076 20:57956784-57956806 GGGCAGAAAGGGGCTGGGCAAGG - Intergenic
1175413856 20:58788638-58788660 GGAGGGAGAAGTCCTGGGCCTGG + Intergenic
1175595243 20:60225672-60225694 TGGGGGAGAAGGCCTAGGCTTGG + Intergenic
1175838930 20:62014489-62014511 GTGGGGAGAGGGGCTGGGCAGGG + Intronic
1175877486 20:62237212-62237234 GGGGAGACAAGGCCTGAGGAGGG + Intronic
1175921136 20:62451092-62451114 GGGGACAGAGTGCCTTGGCAAGG + Intergenic
1175973472 20:62698844-62698866 GGGGACAGCAGGGCTGGCCAGGG + Intergenic
1176239038 20:64067464-64067486 GGGAAGGGAAGGGCTGGGCTGGG + Intronic
1176839604 21:13827910-13827932 GGGGAGACGAGACCTGGGCATGG + Intergenic
1178202160 21:30419508-30419530 GGGGAGAGAAGAAAGGGGCAAGG + Intronic
1179575984 21:42308741-42308763 GGAGGGGGAAGGCATGGGCATGG + Intergenic
1180732391 22:17992011-17992033 GGTGGGAGCAGTCCTGGGCATGG - Intronic
1180832001 22:18911243-18911265 GGGCACAGCAGGCCTGGGGAGGG - Intronic
1180898438 22:19353898-19353920 GTGGAGACCAGGCCTGGGCAGGG + Intronic
1181164047 22:20974053-20974075 CGGGACAGAACGCCTGGGAAGGG - Exonic
1181340882 22:22178932-22178954 GAGGAGAGAAGTTCTGGCCATGG - Intergenic
1181534079 22:23532881-23532903 GGGCAGAGACAGCCTGGGGAAGG + Intergenic
1181596255 22:23916814-23916836 GGGGAGGGAAGGCGAGGGGAGGG + Intergenic
1181666519 22:24402147-24402169 GGGGAGAGAAGGGAAGGGGAGGG - Intronic
1182146205 22:27998432-27998454 GGGGAGGGGAGGGCAGGGCAAGG - Intronic
1182344363 22:29650611-29650633 GGGGAGAGAAGGGAAGGGAAGGG - Intronic
1182397333 22:30045969-30045991 GGGGAGAAGAGACCTGGGCTTGG - Intergenic
1182446889 22:30394960-30394982 GGGAAGGGCAGGCCTGGGGAAGG + Intronic
1182477304 22:30583171-30583193 GAGGAGAGGAGGGCTGGGGAAGG + Intronic
1182567351 22:31210324-31210346 GGGTAGAGAAAGCCTGGGCAGGG - Intergenic
1182747537 22:32617016-32617038 CGGGAGGGAAGGGCTGGCCAAGG + Intronic
1183050640 22:35257870-35257892 GGGCGGAGACGGCCCGGGCAGGG - Intronic
1183078501 22:35441649-35441671 GGGCAGAGGAGGACTGGGCAAGG + Intergenic
1183153203 22:36053864-36053886 GGGGAGGGAAGGGCAGGGAAGGG - Intergenic
1183248571 22:36712172-36712194 AGGCAGAGAAGGCCAGGGAAAGG + Intergenic
1183282171 22:36937768-36937790 GTGGAGAGAAGGCCGAGCCAGGG + Exonic
1183290580 22:36999545-36999567 GGGGAGAGAAGGGGAGGGGAGGG + Intronic
1183578383 22:38706569-38706591 GGGGCGAGGGGGCCCGGGCAGGG + Intronic
1183613259 22:38925605-38925627 GGCATGAGTAGGCCTGGGCACGG - Intergenic
1183666960 22:39251689-39251711 GGGTAGAGAAGTGCAGGGCAGGG - Intergenic
1184549701 22:45197952-45197974 GAGGAAAGAAGGCCAGGTCAAGG + Intronic
1184989089 22:48155155-48155177 GGGGAGGGCAGGCCAGGCCAGGG + Intergenic
1185121593 22:48974776-48974798 GAGGAGCGCAGCCCTGGGCAGGG - Intergenic
1185219137 22:49620413-49620435 GGGTGGGGAAGGGCTGGGCAGGG - Intronic
1203282079 22_KI270734v1_random:136514-136536 GGGCACAGCAGGCCTGGGGAGGG - Intergenic
1203296241 22_KI270736v1_random:45375-45397 GGGGATGCAAGGCCTGGTCAGGG - Intergenic
949221772 3:1642907-1642929 GGGGAGAGAAGGGAAGGGAAGGG + Intergenic
949858685 3:8485770-8485792 GGAGACAGAAGGCCTGCCCATGG + Intergenic
950109022 3:10406824-10406846 GAGAAGGTAAGGCCTGGGCAGGG + Intronic
950118283 3:10465108-10465130 GGGGAGAGGAGGCTTGGGGCTGG - Intronic
950193089 3:10991766-10991788 GGGGAGGTCAGGCCTTGGCAAGG + Intergenic
950305053 3:11910797-11910819 GTGGGGAGCAGGCCTGAGCAGGG + Intergenic
950469113 3:13173707-13173729 GGAGAGAGATGGCCTGTCCAAGG - Intergenic
950764309 3:15262001-15262023 GGGGAAAGAGAGCCTGAGCAGGG + Intronic
950813603 3:15674444-15674466 GGGGAGAGTAGGTCTGGCAAGGG + Intronic
952167652 3:30768552-30768574 GGAGAGAGAAGGGGTGGGGAGGG + Intronic
952183844 3:30946918-30946940 AGGAAGAGAAGACATGGGCAAGG - Intergenic
952584363 3:34873120-34873142 GGAGAGAGATGGCCTGGAAAGGG + Intergenic
952971288 3:38651757-38651779 GGGGAGAGAAGCCCAGGGGATGG + Intergenic
952977443 3:38708208-38708230 GGGGAGAGAAGGAAAGGGCAAGG + Intronic
953535423 3:43773612-43773634 GAGGAGAGAATGCCTGGGCTGGG - Intergenic
953596472 3:44318995-44319017 GGGGAGAACAGACCTGGGCATGG - Intronic
953919276 3:46940808-46940830 AGGCAGAGAAGGCCTCGACAAGG + Intronic
953933216 3:47017484-47017506 GGGGAGGGAAGGTTTGGGGAGGG - Intronic
954130655 3:48559080-48559102 GAGGACAGCTGGCCTGGGCAGGG + Intronic
954456281 3:50601405-50601427 GGGCAGAGAAGGCCTGGCGTGGG - Intergenic
954459916 3:50620441-50620463 GGGCAGAGATGGCCTGAACAAGG - Intronic
954535744 3:51358162-51358184 GGAGAGAGGGAGCCTGGGCAGGG + Intronic
954590708 3:51779073-51779095 GAGGAAAGAAGGCCTGGCCCAGG + Intronic
954630902 3:52047199-52047221 GGGGACAGAGGGCCAGGTCATGG - Intergenic
954693773 3:52409904-52409926 GGGGAGGGAGGGCCTGGACATGG - Exonic
954898412 3:53997099-53997121 GGGGAGGGAAGGGCAGGGAAGGG - Intergenic
954964529 3:54598584-54598606 TGGGAGAGATGTCCTGGGAAAGG - Intronic
955099259 3:55831351-55831373 GGGGAGAGAAGGGGAGGGGAAGG + Intronic
955127395 3:56126893-56126915 GGGCAGGGAAGGGCAGGGCAGGG + Intronic
955290678 3:57689770-57689792 GATCAGAGAAGGGCTGGGCATGG + Intronic
956122291 3:65978435-65978457 TGGAAGAGAAGGCCAGGGGAGGG + Intronic
956432743 3:69204086-69204108 GGGGAGGGAGGGGCTGGTCACGG + Intronic
956622241 3:71233214-71233236 GGGGAGGGAAGGCATGGGAGGGG + Intronic
956778548 3:72586774-72586796 GGGCAGAGAAGTGCTGGGAAGGG + Intergenic
957740731 3:84265012-84265034 GGGGAGGGAAGGGCAGGGGAGGG - Intergenic
958762369 3:98324927-98324949 GGGTAAAGGAGTCCTGGGCAAGG + Intergenic
959115902 3:102177850-102177872 GGGTAAAGGAGTCCTGGGCAAGG - Intronic
959117122 3:102191595-102191617 GGTAAGAGAAGGGCTGGGAAAGG - Intronic
960043419 3:113173299-113173321 GGCCAGAGCAGGCCGGGGCAGGG + Intergenic
960043636 3:113175410-113175432 GGGGAGAATAGGCTTGGGCTAGG - Intergenic
960222371 3:115128754-115128776 GGGGAGGGAAGGGATGGGAAGGG + Intronic
961407583 3:126692621-126692643 GGGGAGAGAAAATCTGGGAAAGG - Intergenic
961459108 3:127039080-127039102 GGGCAGGGAAGGCCTGAGGAGGG + Intergenic
961490442 3:127253706-127253728 GAGGAGAGTGGGCCAGGGCAGGG - Intergenic
961635552 3:128330597-128330619 GGGGTGAGGAGAGCTGGGCAGGG + Intronic
961681677 3:128603945-128603967 GGGATGTGAAGGCCTGGGGATGG + Intergenic
961713196 3:128842674-128842696 GGTGGGAGCAGGCCTGAGCAGGG - Intergenic
962260283 3:133897672-133897694 GGGGAGGGAGGGCTGGGGCAGGG + Intergenic
962629833 3:137264504-137264526 AGGGAGAGAAAGCCCAGGCAAGG - Intergenic
963084750 3:141426518-141426540 GAGGAGAGGAGGCCGGGGGAGGG + Intronic
964011135 3:151893221-151893243 GGGGAGAGTGGGCCTGGAAACGG - Intergenic
964570961 3:158106697-158106719 GGGGAGAGAAGGCCGGTCCCCGG + Intronic
965638882 3:170812430-170812452 GGAGTGAGAAGGCCTGGGGTGGG - Intronic
966211163 3:177454790-177454812 TGGGTGAAAAGGCCTGGCCACGG + Intergenic
966676913 3:182599572-182599594 GAGGAGAGAAGGCCTGGAGAAGG - Intergenic
966862223 3:184236854-184236876 GTGGGGAGAAGGCCTGGTGAGGG - Intronic
966912294 3:184566288-184566310 GGGGAAAGAAGCCCAGGGCGGGG - Intronic
967184092 3:186930676-186930698 GGGGAGGGGAGTCCTGGGCAGGG + Exonic
967217396 3:187222073-187222095 GGGGAGAGGAAGCCAGGGCAGGG + Intronic
967219862 3:187239500-187239522 AGGGGAAGAAGCCCTGGGCAAGG - Intronic
968336499 3:197918023-197918045 GAGGAGAAATGGGCTGGGCATGG - Intronic
968521372 4:1036134-1036156 GAGGAGTGAGGGCCGGGGCAGGG - Intergenic
968599706 4:1503205-1503227 GGGGAGAGCTGGCCTGCCCACGG + Intergenic
968705008 4:2073604-2073626 CGAAAGGGAAGGCCTGGGCAGGG + Intronic
968750732 4:2387559-2387581 GCACAGAGGAGGCCTGGGCAGGG + Intronic
969141577 4:5078739-5078761 GGGGAGAGAAGGGGAGGCCAAGG - Intronic
969226258 4:5800501-5800523 GAGGAGAGAAGGGGTGGCCAAGG + Intronic
969439341 4:7208159-7208181 GGGGTGAGGAGGCCAGGCCAGGG - Intronic
969519278 4:7666423-7666445 GGGCAGGGGAGGCCTGGGCTGGG - Intronic
969619653 4:8272731-8272753 GGACAGAGAGGGCATGGGCAAGG + Intronic
970016223 4:11515738-11515760 TGGGAGAGGAGGGCAGGGCAGGG - Intergenic
970417119 4:15870142-15870164 GGGTACAGAAGTCCTTGGCAAGG + Intergenic
971301494 4:25445895-25445917 AGAGAAAGAGGGCCTGGGCAAGG - Intergenic
972230286 4:37064566-37064588 GATGACAAAAGGCCTGGGCATGG + Intergenic
972579903 4:40385951-40385973 GGGGAGGGGAGGCCAGGGGAGGG + Intergenic
973691929 4:53444522-53444544 GGGGTCAGAAGGCCTTGGAATGG - Intronic
973758532 4:54097551-54097573 GGGAACAGTAGGGCTGGGCAGGG + Intronic
975185467 4:71397133-71397155 GGGGAGAGGAGGTCTGGGCCTGG + Intronic
976751836 4:88457214-88457236 GAGGAGAGAACGCCTGGTCCCGG - Exonic
977224174 4:94374814-94374836 TGGGAGAAGAGGGCTGGGCATGG - Intergenic
977551607 4:98449113-98449135 GGTGAGTGCAGGCTTGGGCATGG - Intergenic
978193668 4:105945651-105945673 GGGGAGAGATGGCTTGGGCCAGG - Intronic
978285554 4:107073360-107073382 GGGGAGGGGAGGCTTAGGCATGG - Intronic
978833360 4:113116494-113116516 GGGGTGAGCAGGTCTGGGAAGGG - Intronic
978902598 4:113970662-113970684 GAGGAGAGAGGGGCTGGGCAAGG + Intronic
979890106 4:126081769-126081791 GGATAGAGAGGGCCTGGGGAAGG + Intergenic
981602269 4:146503557-146503579 GGACAGAGAAGACCTGGGAAAGG - Intronic
981636474 4:146886565-146886587 GAGGAGAGAAGGCCTGATAAAGG + Intronic
981857052 4:149307295-149307317 GGGGAGAACATGCCTGGGAATGG + Intergenic
982135766 4:152272651-152272673 GGCGACAGCAGGCATGGGCAGGG + Intergenic
982771587 4:159401719-159401741 GGGGAGTGGGGGGCTGGGCAGGG - Intergenic
984261862 4:177452313-177452335 GGGGAGAGGAGGGGTGGGGAGGG - Intergenic
985391916 4:189498807-189498829 GGAGAGAGAAGGCCAGGGCAGGG - Intergenic
985622612 5:963352-963374 GGGGAGAGGAAGCCAGTGCAAGG - Intergenic
985703387 5:1386870-1386892 GGGGAGAGCAGCCCCAGGCAAGG - Intergenic
985805324 5:2039002-2039024 GGGCAGGGCAGGGCTGGGCAGGG + Intergenic
985813740 5:2111178-2111200 GGGCAGAGAAGCACTGGGCTTGG + Intergenic
986211964 5:5682455-5682477 GGGCTGAGGAGGCCTGGACAGGG + Intergenic
986949969 5:13071101-13071123 GGGGAGTGAGGCCATGGGCATGG + Intergenic
987250623 5:16096924-16096946 AGGGAGAGAAGACCTGTTCAGGG + Intronic
987289520 5:16495464-16495486 GGGAAGAGGTGGCCTGGGCCTGG - Intronic
988042584 5:25909201-25909223 GAAGAGAGAAAGTCTGGGCAGGG + Intergenic
988597459 5:32608017-32608039 TGGGAGAGATGCCCAGGGCAAGG + Intergenic
990201163 5:53376387-53376409 GGGAAGGGAAGGCCAGGGAAGGG + Intergenic
990207970 5:53450691-53450713 GGGAAGGGCTGGCCTGGGCAAGG - Intergenic
990446205 5:55896617-55896639 GGGGAGGGAGGGAGTGGGCAGGG - Intronic
990671007 5:58130252-58130274 GGGGAGAGAAGGGAAGGGAAAGG - Intergenic
990858983 5:60304353-60304375 GGAGAGAGAAGGGCCGGGCGCGG + Intronic
991540294 5:67720434-67720456 GGGGAGGGAAGGCAAGGGGAGGG - Intergenic
991775401 5:70079940-70079962 GTGTACAGAAGGGCTGGGCATGG - Intergenic
991854695 5:70955394-70955416 GTGTACAGAAGGGCTGGGCATGG - Intergenic
992065637 5:73105002-73105024 AGGGAGAGGAGGGCAGGGCAGGG + Intergenic
992389219 5:76314908-76314930 AGGGAGTGAGGGCCTGGGCCAGG - Intronic
992579012 5:78151908-78151930 GGGGAGAGGAGGGATGGGGACGG - Intronic
992579031 5:78151946-78151968 GGGGAGGGAAGGGATGGGGAGGG - Intronic
992812969 5:80408034-80408056 GGGGAAAGAAGCCCTGAGCCGGG + Exonic
993110143 5:83646704-83646726 GGTGAGGGAAGGCCTGGAGATGG + Intronic
993400853 5:87449056-87449078 GGGGAGAGAAGGAAAGGGCATGG + Intergenic
994709120 5:103244734-103244756 GAGGAGAGAAAACCTGGGCTTGG + Intergenic
995533950 5:113117174-113117196 GAGGAGAGAGGGTCGGGGCAGGG - Intronic
995958559 5:117810831-117810853 GGGGAGGGAAGGGAAGGGCAAGG - Intergenic
996598294 5:125230505-125230527 GGGGAGGGAGGGACTGGGAAAGG - Intergenic
997211714 5:132080813-132080835 GGGAAGAGGAGGCTGGGGCAGGG - Intergenic
997367487 5:133335292-133335314 GGGCAGACGAGGCCAGGGCATGG - Intronic
997459909 5:134044921-134044943 GGGGAAGGGAGGCCTAGGCAGGG + Intergenic
997464008 5:134074634-134074656 GAGGAGAAGAGGCCTGGGAAGGG - Intergenic
997638952 5:135435885-135435907 GGGGAGGGCAGCCCTGGGCTTGG + Intergenic
997647127 5:135489098-135489120 GGGGAGAGGACGGCTGGGCAAGG + Intergenic
997816592 5:137025258-137025280 GGTGAGATAAGGCCTGGAAAAGG - Intronic
998040881 5:138950416-138950438 TGGGAGAGAAGGCCTGGGGGAGG + Intronic
998413428 5:141928315-141928337 GGGGACAGGAGGGCTGGGCTGGG + Intronic
998422867 5:142003586-142003608 TGGGATAGCAGGCCTGGGCATGG - Intronic
998498433 5:142611284-142611306 GGTGAGAGGAGTCCTGGGCACGG - Intronic
998934071 5:147215871-147215893 TGGGAGAGAAGGGCTAGGAAGGG + Intergenic
999243711 5:150142038-150142060 GGGAGGAGGAGGCCTGGCCATGG + Intronic
999737555 5:154523967-154523989 AGGGAGAGAGGCCCAGGGCAGGG - Intergenic
999770891 5:154774688-154774710 GGGCAGAAAAGGCCTGGGGCAGG - Intronic
999809599 5:155115067-155115089 GAGGAGGGGAGGCTTGGGCATGG - Intergenic
1000010900 5:157231572-157231594 GAGGAGAGAAGTTCTGGGTAGGG - Intronic
1001080739 5:168665486-168665508 GAGGAGAGAGGGCCAGTGCATGG + Intronic
1001233772 5:170012583-170012605 GTGGAGAGGAGGTATGGGCAGGG + Intronic
1001382275 5:171312426-171312448 GGGGAGTGAAAGGCTGGGCCTGG + Intergenic
1001622183 5:173096491-173096513 GGGGAGAGGAGGGCAGGGGAGGG - Intronic
1001679757 5:173547476-173547498 GTGGGGAGAAGGCCAGTGCAGGG + Intergenic
1001684347 5:173582282-173582304 GAAGGGAGAAGGCCTGGGTATGG + Intergenic
1001707819 5:173754627-173754649 GGGGAGAGAAGGGGAGGGGATGG - Intergenic
1001963840 5:175896380-175896402 GGGGAGGGGAGGGCTGGGGAAGG - Intergenic
1002044981 5:176536747-176536769 GGGGAGATACGGCCCGGCCACGG + Intronic
1002057869 5:176609230-176609252 GGGGTGAGCAGGCCAGGGCAGGG + Intronic
1002103658 5:176869470-176869492 TGGGAGAGAAGGCCTGGGGGAGG - Intronic
1002191712 5:177481731-177481753 GAGACGAGAAGGGCTGGGCACGG - Intergenic
1002599200 5:180344763-180344785 GGGGCAAGAAGGCCTGGCCAGGG - Intronic
1002601020 5:180353869-180353891 GTGGAGAGAACGCCCGGGCTTGG + Intergenic
1002661394 5:180792985-180793007 GGGGAGGGCAGGCCAGGGGACGG + Exonic
1002941053 6:1716593-1716615 CGTGAGAGAAGGCCTGGCCAGGG + Intronic
1003016941 6:2475572-2475594 GGGCACAGAGGGCCTGGCCAAGG - Intergenic
1004005345 6:11632841-11632863 GCTGAGAGCAGGCCTGGGCTGGG + Intergenic
1004440064 6:15641680-15641702 GGGCAGAGAATCCCTGGGCAGGG - Intronic
1005397581 6:25399109-25399131 GTGGAGAGAAGGCCTCTGGAAGG + Intronic
1005953312 6:30647121-30647143 GGGGAAAGGAGGCCGGGGCGGGG - Exonic
1006319635 6:33312964-33312986 GGGGAAAGCAGGGCCGGGCAGGG - Intronic
1006336054 6:33420922-33420944 GGGGAGGGGAGACCAGGGCAGGG + Intronic
1006349763 6:33512512-33512534 GGGGAGGGCAGGGCAGGGCAGGG + Intergenic
1006354060 6:33543374-33543396 GGAGAGAGAATGACTGGGGAGGG + Intergenic
1006436020 6:34026600-34026622 GGGGTGTGGAGGCCTGGGGAGGG - Intronic
1006677390 6:35774209-35774231 CTGGAGAGGAGGCCTGGGGATGG - Intergenic
1006747322 6:36352467-36352489 GGGGTGAGAGGGCCTGGGAAGGG - Intergenic
1007077169 6:39075243-39075265 GGGGAGAAAAGGCCAAGGAAGGG - Intronic
1007289982 6:40778308-40778330 AGTGTGAGAAGGCCTGGGCGGGG + Intergenic
1008328599 6:50217868-50217890 GGGGAGATTTGGCCTGGGCAGGG + Intergenic
1009803593 6:68573555-68573577 GGGCAGAGCATCCCTGGGCAGGG + Intergenic
1011403378 6:86989211-86989233 GGGGAGAGAAGATCTGGGGCTGG - Intronic
1011535235 6:88369641-88369663 GGTGAGACAAGGCCATGGCAGGG + Intergenic
1012945252 6:105459075-105459097 GGTGAGAACAGGCTTGGGCAGGG + Intergenic
1013274998 6:108576113-108576135 GGAGAGAGAAGGGCTGATCAAGG - Intronic
1013358167 6:109365385-109365407 GAGGAGAAAAGGGCTGGGGATGG + Intergenic
1013479702 6:110543244-110543266 GGGGAGAGCTGGCATGAGCAGGG - Intergenic
1013512796 6:110859425-110859447 GGGGAGAAGAGACCTGGGCTTGG + Intronic
1013650881 6:112193302-112193324 GGGTATAGAGGGCCTGGGCTGGG + Intronic
1014382417 6:120758931-120758953 TGGGAGAGAAGTCTTGGCCATGG + Intergenic
1014513561 6:122354818-122354840 GGGGAGAGAAGGGGAGGGGAGGG + Intergenic
1014513570 6:122354838-122354860 GGGGAGAGAAGGGGAGGGGAGGG + Intergenic
1015988549 6:138911573-138911595 AGGGAGAGGAGGACAGGGCAAGG + Intronic
1015988572 6:138911706-138911728 AGGGAGAGGAGGACGGGGCAAGG + Intronic
1016551323 6:145283410-145283432 GAGGAGAAAAGGCCTGGGCGTGG + Intergenic
1017111377 6:150936282-150936304 GCAGGGAGAAGCCCTGGGCAGGG + Intronic
1017259652 6:152371626-152371648 GGGGAGAGGAGGGGAGGGCAAGG + Intronic
1018220116 6:161569645-161569667 GGGGAGAGAAAGCCTGGCCAGGG - Intronic
1018509141 6:164506288-164506310 GGGGAGGGCAGGGCAGGGCAGGG - Intergenic
1018509143 6:164506293-164506315 GGGGAGGGGAGGGCAGGGCAGGG - Intergenic
1018762984 6:166906952-166906974 GGGGAGAGCGGGGCCGGGCAGGG - Intronic
1018762999 6:166907001-166907023 GGGGAGAGCGGGGCCGGGCAGGG - Intronic
1018832146 6:167451357-167451379 GGAGAGGGAAGACCTGGGCTTGG + Intergenic
1018910397 6:168098272-168098294 AGGGAGAGCAGGCCTAGGCTCGG - Intergenic
1018930807 6:168239287-168239309 AAGGAGAGAGGGGCTGGGCAGGG + Intergenic
1018978234 6:168581919-168581941 GGTCAGAGAAGGCCTCTGCACGG - Intronic
1018991418 6:168676771-168676793 TGGGCGAGCAGGCCTGGGCATGG - Intergenic
1019128868 6:169859358-169859380 GGGGAGTTAAGGACGGGGCAAGG + Intergenic
1019140311 6:169938461-169938483 GGGGAGGGAGAGCCTGGGGAGGG + Intergenic
1019261569 7:84686-84708 CTGGAGCCAAGGCCTGGGCAGGG + Intergenic
1019278357 7:187774-187796 GGGGAGACCTGGACTGGGCAAGG - Intergenic
1019301936 7:309781-309803 GTGGAGAGAAACGCTGGGCAGGG + Intergenic
1019426101 7:977583-977605 GGGGAGGGGACGCCTGGGCCAGG - Intergenic
1019499039 7:1355300-1355322 CGGGAGGGAAGGCCTGCGGATGG + Intergenic
1019697237 7:2452538-2452560 GGGGAGGGCAGGGCAGGGCAGGG - Intergenic
1019697239 7:2452543-2452565 GGGGAGGGGAGGGCAGGGCAGGG - Intergenic
1019932694 7:4234337-4234359 TGGCAGAGAAGGCCAGGGCAGGG + Intronic
1020032930 7:4945554-4945576 GGGGAGGGAAGGGCTGGGTGAGG - Intronic
1020083164 7:5297126-5297148 GGGCAGGCCAGGCCTGGGCAGGG + Exonic
1022185968 7:27969306-27969328 GGGGAGAGAGGACGTTGGCAAGG + Intronic
1022548039 7:31207558-31207580 GGGAAGAGAAAGCATGGGCTGGG - Intergenic
1022977759 7:35574728-35574750 GGGGAGAGGAGGTCTCGGCTGGG + Intergenic
1023000479 7:35802023-35802045 GGAAAGAGAACGCCTGGGAAGGG + Intronic
1023290541 7:38664269-38664291 GGGAAGAGAAGGGCAGGGCAGGG + Intergenic
1023864580 7:44232698-44232720 GGGGAGGGGCGGCCAGGGCATGG + Intronic
1024257568 7:47549989-47550011 GGGGAGAGGAGACCAAGGCATGG - Intronic
1024505677 7:50159301-50159323 GGAGAGAGGCGGGCTGGGCAGGG - Exonic
1024554956 7:50595518-50595540 GAGGAGAAAAAGCCTGGGGAAGG + Exonic
1024944871 7:54798435-54798457 TGTGAGAAAAGGCCTGGGCTGGG - Intergenic
1025191556 7:56899437-56899459 GGGGAGAGAAGGGAGGTGCAGGG + Intergenic
1025211119 7:57020061-57020083 GGGCAGGCCAGGCCTGGGCAGGG - Intergenic
1025611333 7:63077768-63077790 GGAAAGAGAAAGGCTGGGCATGG - Intergenic
1025660836 7:63556786-63556808 GGGCAGGCCAGGCCTGGGCAGGG + Intergenic
1025680391 7:63677497-63677519 GGGGAGAGAAGGGAGGTGCAGGG - Intergenic
1025697895 7:63789644-63789666 GGGGAGAGAGGGGCGGGGCCGGG - Intergenic
1025739541 7:64183935-64183957 AGCGGGAGAGGGCCTGGGCAGGG - Intronic
1026282417 7:68933524-68933546 GGGAAGAGAAGGCAAGGGAAGGG + Intergenic
1026470962 7:70694091-70694113 GGGGAGCGAAGTCCGGAGCAAGG + Intronic
1026902803 7:74046371-74046393 GGGGGGAGCAGGCCTGGGATGGG - Intronic
1026990779 7:74584163-74584185 GGGGAAAGAGGGCCTGGGTACGG + Intronic
1027222649 7:76223890-76223912 GGGGAGGGAAGGGGTGGGGAGGG - Intronic
1028391936 7:90326674-90326696 GGGGAGGGGAGGGCCGGGCAGGG + Intergenic
1028969535 7:96842379-96842401 GGGGAGAGAGGGATGGGGCAAGG - Intergenic
1029365123 7:100111835-100111857 GGAGGGAGAAGTGCTGGGCATGG + Intronic
1029462717 7:100705707-100705729 GGTCAGAAGAGGCCTGGGCAGGG - Intergenic
1031196472 7:118620893-118620915 GGGGAGTGGAGGGCTGGGGAGGG - Intergenic
1032667591 7:134052204-134052226 GGGGAGAGATGGAGTGGACATGG + Intronic
1033220675 7:139524575-139524597 GGGGAGGGCAGGGCAGGGCAGGG + Intronic
1033543698 7:142380870-142380892 GGGCAGGTAAGTCCTGGGCAGGG + Intergenic
1033591113 7:142809180-142809202 GGGGAGGGGAGGCCTGCACATGG - Intergenic
1033599263 7:142877120-142877142 GGTGAGAGCAGGGCTGGGCTTGG - Exonic
1034442200 7:151091510-151091532 GGGGCCAGAAGGTCTGGGCTTGG + Intronic
1034814960 7:154164196-154164218 GGGGACAGCAGGTCAGGGCAGGG - Intronic
1034816363 7:154175396-154175418 GGGAGGAGAAGGCCTGAGAAGGG + Intronic
1034925567 7:155118750-155118772 TGGGAGAGATGGGCAGGGCATGG + Intergenic
1035153267 7:156892768-156892790 GGGGAGAGGAGGGGTGGGGAGGG + Intronic
1035183498 7:157108027-157108049 GGAGAGTGAAGGGCTGAGCAGGG + Intergenic
1035315998 7:157997877-157997899 GGGGAGAGTAGTGCAGGGCAGGG + Intronic
1035627522 8:1082568-1082590 GGTGTGAGCAGGGCTGGGCATGG + Intergenic
1036062717 8:5342279-5342301 GAGGAGAGAAGGACTGGAGAGGG - Intergenic
1036235328 8:7034993-7035015 GTGGGGTGAAGGGCTGGGCATGG - Intergenic
1036638026 8:10564844-10564866 GGGGAGAGAAGGCCCTGGAAAGG + Intergenic
1036707422 8:11055824-11055846 TGGGCAAGAAGGCCTGGGCTGGG + Intronic
1037508854 8:19561612-19561634 AGGGAGAGAAGGCCTGCACGTGG - Intronic
1037569996 8:20149893-20149915 GGGGAGACAAGGAAAGGGCAGGG - Intronic
1037907768 8:22725516-22725538 GGAGAGAGAAGGACTGGGAGAGG - Intronic
1037916988 8:22778782-22778804 AAGGAGAGAAGGCCAGGGTAGGG - Intronic
1038381068 8:27095067-27095089 GGGTAAAGGAGTCCTGGGCAAGG + Intergenic
1038433862 8:27521032-27521054 GGGCAGAGTGGGCATGGGCAGGG + Intronic
1038862306 8:31401217-31401239 GGGGAGGGAAGTGCTGGGAAGGG + Intergenic
1038884963 8:31653013-31653035 GGGGAGAGAAGGGGAGGGGAGGG - Intronic
1039012066 8:33104615-33104637 GGGTAAGGAAGGCCTTGGCAAGG - Intergenic
1039047863 8:33466517-33466539 GGGGAAAGAAGGGCAGGGCAGGG + Intronic
1039076313 8:33693391-33693413 GGGCAGGGAAGTCCTGGGAAGGG - Intergenic
1039436056 8:37559994-37560016 GTGAAGAGAAGCTCTGGGCAGGG - Intergenic
1039436151 8:37560711-37560733 GGAGAGAGAATGCATGGCCATGG - Intergenic
1040027719 8:42796869-42796891 GGGGTGGGGAGGCTTGGGCATGG - Intergenic
1041542028 8:58995989-58996011 GGGGAGAGCAGGCCTGGAAACGG - Intronic
1041855656 8:62451307-62451329 GGGGAGAGAAGGAGAGGGGAGGG - Intronic
1042477560 8:69266272-69266294 GGTGAGAGAAGGCCTGAGGAGGG + Intergenic
1045327035 8:101125003-101125025 GGAGAGAGGAGGCGTGGTCAAGG + Intergenic
1045351586 8:101345682-101345704 GGGGAGAAAACTCCTTGGCATGG - Intergenic
1047066070 8:121284488-121284510 GGGGAGAGGAAGCAGGGGCAAGG + Intergenic
1047208166 8:122819942-122819964 TGGGAGGGGAGGCCTGGGGAGGG - Intronic
1047416963 8:124672513-124672535 GGGAAGGAAAGGGCTGGGCATGG + Intronic
1047935644 8:129775785-129775807 GTGGAGACAAGGGATGGGCAGGG - Intronic
1048472388 8:134714795-134714817 GGGGAGAGGAACACTGGGCATGG - Intergenic
1048861308 8:138726199-138726221 CGGTAGAAAAGGGCTGGGCATGG + Intronic
1049120774 8:140735217-140735239 CGGGAGAGAGGGCCTGGGGGTGG - Intronic
1049188117 8:141270045-141270067 GGTGTGAGAAGGGCAGGGCAAGG - Intronic
1049221575 8:141431105-141431127 GGGCAGAGCAGGGCTGGGCAGGG - Exonic
1049248719 8:141576891-141576913 GTGGAGAGAAAGCGTGGGCTTGG + Intergenic
1049287701 8:141785458-141785480 GGGTACAGAAGGGATGGGCAAGG + Intergenic
1049326782 8:142025622-142025644 GGGGATGGGAGGGCTGGGCAGGG + Intergenic
1049393206 8:142382587-142382609 GCAGAGAGAAGGTCTGGCCATGG + Intronic
1049434264 8:142579243-142579265 GGGGAGACAGGTCCTGTGCAGGG + Intergenic
1049450758 8:142660260-142660282 TGGGAGGCAGGGCCTGGGCAGGG - Intronic
1049452629 8:142670178-142670200 GAGGGGAGAAGGCGCGGGCAGGG + Intronic
1049463025 8:142738898-142738920 GGGGAGCGGCGGCCTGGGCCTGG - Intergenic
1049787174 8:144456533-144456555 GGGGAGAGGTGGCCTGGCCTGGG - Intronic
1049832756 8:144712880-144712902 GGGAAGAGGCGCCCTGGGCATGG - Intergenic
1050606378 9:7305656-7305678 GTGGAGAGAGGGCCTGTGAATGG - Intergenic
1050853715 9:10323213-10323235 GGGGAGAGAAGGGAAGGGGAGGG - Intronic
1050853729 9:10323243-10323265 GGGGAGAGAAGGGAAGGGGAGGG - Intronic
1052231067 9:26153425-26153447 GGGGAAAGAAGGGCAGGGGAAGG + Intergenic
1052323040 9:27188905-27188927 GGGTAGAGAATGCTGGGGCAGGG + Intronic
1052856261 9:33408385-33408407 GGAGAGAGAAGGCTGGAGCATGG + Intergenic
1052862417 9:33445256-33445278 TGGGAGAGGAGACCAGGGCAAGG - Intronic
1053131386 9:35617627-35617649 GGGGAGATAAGGGCTGCGGAGGG - Intronic
1053214325 9:36258226-36258248 GGGGAGGGGAGGCCTGGGGCAGG + Intronic
1053305610 9:36982451-36982473 AAGGAGAGAAGGCCTGGAGATGG + Intronic
1053318602 9:37075157-37075179 GGTAAATGAAGGCCTGGGCACGG - Intergenic
1053322748 9:37114859-37114881 GGTAAATGAAGGCCTGGGCATGG - Intergenic
1053387221 9:37702610-37702632 CTGGAGTGAAGGCCTGGGAAGGG + Intronic
1053669402 9:40345835-40345857 GGGGAGAAGAGACCTGGGCATGG - Intergenic
1053692372 9:40592876-40592898 GGGTAGAAAAGGCCAGGGTAGGG - Intergenic
1053919198 9:42972076-42972098 GGGGAGAAGAGACCTGGGCATGG - Intergenic
1054272438 9:63044641-63044663 GGGTAGAAAAGGCCAGGGTAGGG + Intergenic
1054380532 9:64485855-64485877 GGGGAGAAGAGACCTGGGCATGG - Intergenic
1054402398 9:64720320-64720342 GGGTAGAAAAGGCCAGGGTAGGG - Intergenic
1054436002 9:65204635-65204657 GGGTAGAAAAGGCCAGGGTAGGG - Intergenic
1054494390 9:65817052-65817074 GGGTAGAAAAGGCCAGGGTAGGG + Intergenic
1054515214 9:66030456-66030478 GGGGAGAAGAGACCTGGGCATGG + Intergenic
1055231177 9:74067584-74067606 GGTGAGAAAAGGCCTGGGGCTGG - Intergenic
1056571569 9:87821095-87821117 GGAGAGAGAAGGCCAAGGCTGGG - Intergenic
1056578012 9:87870646-87870668 GGGGAGAGAACCCCAGGGCTAGG + Intergenic
1056757399 9:89390406-89390428 GGCTACGGAAGGCCTGGGCAGGG + Intronic
1056766379 9:89447032-89447054 TGGGAGAGATGGTCTGGGCCTGG - Intronic
1057349190 9:94280638-94280660 GGTGAGAGCACACCTGGGCAAGG + Intronic
1057961071 9:99457777-99457799 GGGGAGGGGAGGGCAGGGCAGGG + Intergenic
1058903357 9:109460716-109460738 AGGGAGAGAGTGCCAGGGCAAGG - Intronic
1059027965 9:110657587-110657609 GAGGAGAGAAGTGCTTGGCAAGG - Intergenic
1059700659 9:116772689-116772711 GAGGAGGGAAGTCCTGGGAATGG - Intronic
1059701793 9:116782108-116782130 AGGGAGAGAAAGTGTGGGCAGGG + Intronic
1059738915 9:117130424-117130446 GTAGAGAGAAAGCCTGAGCAAGG - Intronic
1060506300 9:124200759-124200781 AGGAAGAGAAGGGCTGGGCATGG - Intergenic
1060596442 9:124851907-124851929 TGGGAGTGAAGGGCTGGGCTGGG + Intergenic
1060602579 9:124888047-124888069 GGGGAGAAGAGGGCTGGGGAGGG + Intronic
1060660191 9:125400888-125400910 GGGTACTGAAGGCCTGGGAAGGG + Intergenic
1060758677 9:126230569-126230591 GAGGAGAGAAAACCTTGGCAAGG - Intergenic
1060779206 9:126399366-126399388 GGAGAGAGCTGGCCTGGGGACGG + Intronic
1060822030 9:126666784-126666806 GGGACAAGGAGGCCTGGGCAGGG + Intronic
1061099174 9:128479086-128479108 TGGGACAGAAGGCTTGGCCACGG - Intronic
1061315134 9:129790707-129790729 ATGGAAAGAAGGCCTGGGAAAGG - Intergenic
1061452914 9:130678301-130678323 GGACAGAGATGGCCTGGGCAGGG + Intronic
1061503187 9:131015342-131015364 AGGGAGAGCAGGGCAGGGCAGGG - Intronic
1061718668 9:132537751-132537773 GAAGAGAGAAGGGCTGGCCAGGG + Intronic
1062049020 9:134437725-134437747 CCAGAGAGAAGGCCTGAGCAGGG - Intronic
1062076758 9:134593944-134593966 GGGAAGCGCTGGCCTGGGCAGGG + Intergenic
1062174676 9:135154584-135154606 GGCAAGAGAAGCCCTGGGCTGGG + Intergenic
1062242659 9:135548504-135548526 GGGGAGAGGAGGCCTGAGAATGG - Intronic
1062264095 9:135678902-135678924 GGGGAGAGAAGGCCTGGGCCTGG - Intergenic
1062465144 9:136677610-136677632 GGGGCGCGAAGGCCTGGGGGTGG + Intronic
1062482621 9:136759462-136759484 GGGGTGAGAGGCCCTGGGGAGGG - Intergenic
1062629877 9:137458856-137458878 GGGGAGGGAAGAGCAGGGCAGGG + Intronic
1062690157 9:137837512-137837534 GGGGAGTGCAGGCCTGGGAAGGG + Intronic
1185502454 X:608373-608395 GGGGAGAGAAGGGAAGGGAAGGG - Intergenic
1186081924 X:5942694-5942716 GGGGAGAGAAGGGGAGGGAAGGG + Intronic
1186423484 X:9444859-9444881 GGGGAAAGAGGTCCTGAGCAGGG + Intergenic
1187105946 X:16241948-16241970 TGGGAGAGAAGGACTGGGAAAGG - Intergenic
1187192987 X:17054443-17054465 GGGGTGAAAAGCCCTGGACATGG - Intronic
1188786342 X:34351436-34351458 GGGGAGAGAAGGGGAGGGAAGGG + Intergenic
1189779666 X:44502055-44502077 GGGAAGAGGAGGCCTGAGGAGGG - Intergenic
1190225472 X:48541308-48541330 GGGGAGAGAAGACATGGGGTAGG - Intronic
1190477202 X:50840031-50840053 GGAGAGAGAAGGGCTGACCAAGG - Intergenic
1192183242 X:68929414-68929436 AGGGAGAGAGGGCCTTGGCTGGG + Intergenic
1192229561 X:69255802-69255824 GGCCAGAGAAGGGCTGGGAAAGG + Intergenic
1192278828 X:69662398-69662420 GGCAAGAGAAGGCATGTGCAGGG - Intronic
1192318177 X:70067649-70067671 GGGGAAAGGGGCCCTGGGCAAGG + Intergenic
1192450944 X:71244477-71244499 GGGAAGAGAAAGCAGGGGCATGG + Intronic
1192557409 X:72101557-72101579 GGGGAGAAAAGGCTGGGGGAGGG - Intergenic
1192578541 X:72261930-72261952 GGGGAGAGAAGGACTTTCCAGGG - Intronic
1192809372 X:74535951-74535973 GGGGAGAGCAGTACTGGGCCGGG + Intergenic
1194319012 X:92419968-92419990 GGGGAGAGAGAGGCTGGGCGTGG - Intronic
1195113419 X:101670044-101670066 GAAGAGAGATGGCCTGGGCAAGG - Intergenic
1195116775 X:101707175-101707197 GAAGGGAGATGGCCTGGGCAAGG + Intergenic
1195431161 X:104791174-104791196 GGGAAGGGAAGGGCAGGGCAAGG - Intronic
1197028750 X:121788337-121788359 GGGGAGAGAAGGGAAGGGAAGGG - Intergenic
1197186316 X:123591261-123591283 GGGGAGAGAGGGCCTGGACAGGG - Intergenic
1197703151 X:129615060-129615082 GGGGAAGGAAGGCCTGTGCCAGG - Intergenic
1198275548 X:135095228-135095250 GGGGAGAGAAGAGGTGGGGAGGG + Intergenic
1198509981 X:137340814-137340836 GGAGAGAGATGGCCAGAGCATGG + Intergenic
1199179622 X:144838492-144838514 GGGGAGGGCAGGGCAGGGCAGGG - Intergenic
1199179624 X:144838497-144838519 GGGGAGGGGAGGGCAGGGCAGGG - Intergenic
1199268033 X:145850074-145850096 GGGAAGGGAAGTCCTGGGAAGGG - Intergenic
1199476700 X:148254392-148254414 GGGCAGAGGAGCCCTGGGCCTGG - Intergenic
1199731589 X:150638162-150638184 GGGAAGAGCAGGACTGGGTAGGG + Intronic
1200104750 X:153706090-153706112 GGGAACTGAAGGCCTGGGCTGGG - Intronic
1200128457 X:153829185-153829207 GGGGAAGGAGGGGCTGGGCACGG - Intronic
1200440468 Y:3206663-3206685 GGGAAGGGAAGACCTGGGCCTGG - Intergenic
1200627146 Y:5533119-5533141 GGGGAGAGAGAGGCTGGGCGTGG - Intronic
1200690467 Y:6303561-6303583 GGGTAGAGAAGTGCTGGGTAGGG - Intergenic
1201044807 Y:9871155-9871177 GGGTAGAGAAGTGCTGGGTAGGG + Intergenic
1201109716 Y:10790388-10790410 GGGGAGAGAAGGGATTGGAAGGG - Intergenic
1201521760 Y:14883289-14883311 CGGGACAGAAGGCATGGGCAAGG - Intergenic
1202379581 Y:24263516-24263538 GGGCAGAGGTGGCCTGGGCCTGG + Intergenic
1202491201 Y:25406605-25406627 GGGCAGAGGTGGCCTGGGCCTGG - Intergenic