ID: 922784978

View in Genome Browser
Species Human (GRCh38)
Location 1:228278244-228278266
Sequence AGGGCTAATCAGAGGTATGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 107}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922784978 Original CRISPR AGGGCTAATCAGAGGTATGC GGG Intronic
904863754 1:33560406-33560428 AGGGGGAATCAGAGGGATGCAGG - Intronic
906278963 1:44540161-44540183 AAGGCTGCTCAGAGGTATCCTGG - Intronic
906554859 1:46701546-46701568 ATGGCTAATCAGAAGTATCTCGG + Intronic
907886228 1:58594486-58594508 GGGGCTACTCAGTGGTATTCAGG - Intergenic
910624572 1:89292808-89292830 AGGTGTGATCAGAGGAATGCTGG + Intergenic
911848899 1:102789405-102789427 ATGACTGATCAGTGGTATGCAGG + Intergenic
915382959 1:155459872-155459894 AGGGTTTATCAGAGGTTGGCTGG + Exonic
916211350 1:162362534-162362556 AGTGCCAGTTAGAGGTATGCAGG + Intronic
916933413 1:169603183-169603205 AGGGCTTAGCAAAGGTGTGCAGG + Exonic
917778499 1:178364647-178364669 AGTGCTAATCATAGGTATATTGG + Intronic
920373719 1:205495165-205495187 AGGGCTGATGAGATGCATGCTGG - Intergenic
922784978 1:228278244-228278266 AGGGCTAATCAGAGGTATGCGGG + Intronic
1062987069 10:1778981-1779003 AGGGATAACCAGAGGGAAGCTGG + Intergenic
1068768931 10:60798624-60798646 AGTGCTAATGAGAGGTCTGTAGG - Intergenic
1069878599 10:71578073-71578095 AGGGCTAAGGAGAGGTCTGCGGG + Intronic
1070052753 10:72905133-72905155 AGGCCTAATGAGAGGTGTTCAGG - Intronic
1071794547 10:88990893-88990915 AGGGCTCACCAGAGGTAGGAGGG - Exonic
1075583586 10:123640938-123640960 AGGGCTAACCAAAGGTTTTCTGG - Intergenic
1078070153 11:8103092-8103114 AGGGCTACTCAGCAGTAAGCAGG + Exonic
1080068949 11:28055587-28055609 AGGGCAAATCAGAAATAGGCAGG + Intronic
1084959125 11:72707021-72707043 AAAGCTAATCACAGGTGTGCAGG + Intronic
1085697269 11:78715586-78715608 AGGACAAATCTGAGGTCTGCTGG + Intronic
1087281104 11:96211589-96211611 AGGGAAGATCAGAGGTATGGGGG + Intronic
1091295110 11:134468350-134468372 AGGGCCAGGCAGAGGCATGCAGG - Intergenic
1102627594 12:114247925-114247947 AGGGCTACTGAGAGGGATTCAGG - Intergenic
1107260566 13:38485552-38485574 GGGCCTAATGAGAGGTATTCAGG - Intergenic
1107691839 13:42961196-42961218 AGTGCTAAGCAGTGGTGTGCTGG + Intronic
1110097785 13:71552008-71552030 AGGACTAATCTGAGGGAGGCAGG - Intronic
1112215775 13:97430493-97430515 ATGTTTAATCAGAGGCATGCAGG + Intergenic
1116672638 14:47862889-47862911 AGGTCTAATGAGAGGACTGCTGG - Intergenic
1122735760 14:103840171-103840193 AGGGCTAAACAGAGGAATGGTGG - Intronic
1123705020 15:22944954-22944976 AGGGCAAATCAAAGGCAGGCGGG + Intronic
1125392350 15:39207652-39207674 AAGGCTACTCAGAGGTAATCTGG + Intergenic
1131662967 15:94538496-94538518 AGGGGACATCAGAGGTAGGCTGG + Intergenic
1133192856 16:4147178-4147200 GGGGCCAATCAGAGGCATCCTGG - Intergenic
1136428820 16:30185648-30185670 AGGGCTGATCATGGGTCTGCAGG - Intronic
1139370637 16:66467222-66467244 AGGGCTAATCAGAAGTCAACAGG + Intronic
1139516304 16:67454312-67454334 AGGGCAAATGAGTGGCATGCGGG + Intronic
1139600487 16:67983592-67983614 AGGGCTAATCAGGGTCATGGGGG + Intergenic
1140589642 16:76336472-76336494 AGTTCTGATCAGTGGTATGCTGG - Intronic
1150445497 17:65224745-65224767 AGGGCTAAGCAGTTGTATCCCGG - Intronic
1153507113 18:5812237-5812259 TGGGCTATTCAGAAGGATGCTGG + Intergenic
1155078395 18:22383308-22383330 AGAGATAATGAGAGGTCTGCTGG + Intergenic
1155341068 18:24814649-24814671 AGTGCTAAGCAGAGATTTGCTGG - Intergenic
1156514787 18:37670511-37670533 AGGGCAAATCAGAGCCAGGCAGG + Intergenic
1157861726 18:51147225-51147247 AGGACTAATCAGAATTATGTTGG + Intergenic
1158414840 18:57241022-57241044 AGGTGGAAGCAGAGGTATGCAGG + Intergenic
1161226626 19:3149966-3149988 AGGACAAATCAGAAGTGTGCGGG + Intronic
1161542404 19:4859980-4860002 GGAGCTGATCAGAGGCATGCTGG + Exonic
1167721670 19:51184132-51184154 AGGACTGAGCAGAGGGATGCGGG - Intergenic
926233399 2:11021711-11021733 ATGGGTAATCAGAGCTATCCGGG + Intergenic
930602099 2:53455277-53455299 AGGGCTGTTCAAAGGTATGCTGG - Intergenic
933044508 2:77518714-77518736 AGGGATAATCAGAGGTTTCTGGG + Exonic
936749148 2:115619582-115619604 AGGGTTACACAGAGCTATGCTGG - Intronic
937151367 2:119688685-119688707 AGGCCTACTCAGAGGTACCCTGG + Intergenic
937882329 2:126877830-126877852 AGGGACACTGAGAGGTATGCCGG + Intergenic
1170634914 20:18095752-18095774 TGGGCTAATGAGAAGTAGGCAGG - Intergenic
1171029194 20:21661908-21661930 AGGGGTAAGCAGAGCTCTGCTGG + Intergenic
1172751117 20:37251999-37252021 AGGGCTAATCCTAAGAATGCAGG - Intronic
1175420079 20:58826342-58826364 AGTGCTAACCAGGGGGATGCTGG - Intergenic
1177701063 21:24639955-24639977 GGGGCTGAGGAGAGGTATGCTGG + Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
957943709 3:87036907-87036929 AGGGCCATTCAAGGGTATGCTGG - Intergenic
959144321 3:102525478-102525500 AGGACTAATGAGAGGGATGGAGG - Intergenic
961324013 3:126099155-126099177 AGGGCTAATCAGATCTGTCCTGG - Intronic
961547458 3:127645157-127645179 TGAGCTAATCAGATGCATGCTGG - Intronic
965508453 3:169541746-169541768 TGGGCTGATAAGAGGTGTGCTGG - Intronic
966365682 3:179184877-179184899 AGGGCTAATCAGTGAGATGCAGG + Intronic
972827777 4:42780925-42780947 AGGGATACTCAGAGTTATGTGGG + Intergenic
979132241 4:117061943-117061965 AGAGATAATCAGGGATATGCAGG - Intergenic
984962482 4:185111165-185111187 AGGGCTAATCTGAGATTTGAAGG + Intergenic
986855516 5:11864534-11864556 AGTGCTAATCCTAGGTCTGCTGG - Intronic
987142218 5:14958106-14958128 AGAGCAAATCACAGGTAAGCAGG - Intergenic
992906956 5:81356363-81356385 GGGACTAATCAGAGGGGTGCAGG - Intronic
1000101809 5:158023839-158023861 AGGGCTAAGGGGAGGTATGCAGG - Intergenic
1001885978 5:175290652-175290674 AAGGCTGATCAGAGCTCTGCAGG + Intergenic
1003336808 6:5181259-5181281 AGGACAAATGAGAGCTATGCAGG - Intronic
1003685419 6:8297578-8297600 AGGATTAATCAGAGCTCTGCAGG - Intergenic
1005013256 6:21355828-21355850 AGGGCCACTCCGGGGTATGCTGG - Intergenic
1012436232 6:99217924-99217946 AGGGACAATCAGATGTCTGCAGG + Intergenic
1014338922 6:120177499-120177521 AGTGCTAATCAAAAGTATTCAGG + Intergenic
1015001397 6:128221007-128221029 AGTACTAATCAGTGGAATGCTGG - Intronic
1016816677 6:148309292-148309314 AAGGCTAAGCAGTGGTTTGCTGG + Intronic
1019260824 7:81026-81048 GGGGCTGATCAGAGGGAGGCCGG - Intergenic
1019490575 7:1311386-1311408 TGGGCTAAGCAGAGGCAGGCAGG + Intergenic
1027768975 7:82382507-82382529 AGGCCTAAACAGAGGCGTGCTGG + Intronic
1028814602 7:95130103-95130125 AGGGCATATCAGAGGTCTTCAGG + Intronic
1033760041 7:144427791-144427813 AGGGCATATCAGAGGTCTTCTGG - Intergenic
1033932515 7:146541823-146541845 AGGGCAAATGAGAGGTTTTCTGG - Intronic
1035098749 7:156378950-156378972 AGAGCTGATCAGAGGAATGGCGG + Intergenic
1040715208 8:50243544-50243566 ATGGTTAATCAGTGGTATCCAGG - Intronic
1041499979 8:58529897-58529919 AGGGCCATTCAAGGGTATGCTGG - Intergenic
1041756558 8:61319619-61319641 AGGACTCATCAGAGGAATGAGGG - Intronic
1041958408 8:63583051-63583073 AGAGCTACTAAGAGGTAAGCTGG - Intergenic
1042329045 8:67558667-67558689 AGGGCTAAGCATAGTTTTGCTGG + Intronic
1043555132 8:81421494-81421516 AGGGCCATTCAAGGGTATGCTGG + Intergenic
1044549093 8:93492531-93492553 AGGCATGATCAGAGGCATGCTGG - Intergenic
1047631053 8:126708916-126708938 AGGGCTACTCAGAAGTGTGATGG + Intergenic
1048592433 8:135833278-135833300 AGGGCCAATCAGAGGAAAGGAGG - Intergenic
1050768923 9:9172423-9172445 AGGGTTAATCAGATTTATTCAGG - Intronic
1052210227 9:25894420-25894442 AGGGCATATCAGAGGTCTTCAGG - Intergenic
1052523984 9:29588890-29588912 GGGCCTAATCAGAGGTGTTCAGG + Intergenic
1053603420 9:39632878-39632900 AGGGGAAATAAGAGGGATGCTGG - Intergenic
1053861050 9:42386598-42386620 AGGGGAAATAAGAGGGATGCTGG - Intergenic
1054250117 9:62709546-62709568 AGGGGAAATAAGAGGGATGCTGG + Intergenic
1054564228 9:66744075-66744097 AGGGGAAATAAGAGGGATGCTGG + Intergenic
1056276847 9:85001935-85001957 ATGGAGCATCAGAGGTATGCGGG + Intronic
1059742579 9:117166651-117166673 AGAGCTAATCAGAGATCTGAAGG - Intronic
1060915331 9:127385590-127385612 AGGGCAAAACGGAGGGATGCAGG + Intronic
1187758397 X:22550946-22550968 AGGGCTTATCTCAGGAATGCAGG + Intergenic
1191650306 X:63529747-63529769 AGGGAAGATCAGAGGTATTCTGG + Intergenic
1194823446 X:98532448-98532470 AGGGCTTATCAGTGGTAGTCTGG + Intergenic
1199332953 X:146582899-146582921 ATGGCAGATTAGAGGTATGCTGG + Intergenic
1199354579 X:146846971-146846993 AGGGCTAATTAGAGGAAAGTTGG - Intergenic