ID: 922785610

View in Genome Browser
Species Human (GRCh38)
Location 1:228280982-228281004
Sequence GGGTGCAAGCAGGTGGACCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 233
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 213}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922785599_922785610 19 Left 922785599 1:228280940-228280962 CCTTCTGGGGGAGCCATGGCTTG 0: 1
1: 0
2: 1
3: 9
4: 113
Right 922785610 1:228280982-228281004 GGGTGCAAGCAGGTGGACCCGGG 0: 1
1: 0
2: 2
3: 17
4: 213
922785601_922785610 6 Left 922785601 1:228280953-228280975 CCATGGCTTGATGTGGTCCTGTG 0: 1
1: 0
2: 1
3: 18
4: 156
Right 922785610 1:228280982-228281004 GGGTGCAAGCAGGTGGACCCGGG 0: 1
1: 0
2: 2
3: 17
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922785610 Original CRISPR GGGTGCAAGCAGGTGGACCC GGG Intronic
900402845 1:2479670-2479692 GGCTGCCAGCAGGGGGACGCTGG + Intronic
900687615 1:3958635-3958657 GGGTGGAAGCAGGTGGCCCCTGG + Intergenic
901216828 1:7559758-7559780 GGGTGCAATCAGTTGCATCCTGG - Intronic
901671229 1:10857411-10857433 AGGTGGAGGCAGGTGGAGCCCGG - Intergenic
901676562 1:10888996-10889018 GGCTCCAAGCAGGCGGCCCCTGG + Intergenic
902038583 1:13475687-13475709 TGGTCCCAGCAGGTGTACCCAGG + Exonic
902400321 1:16153800-16153822 GGGGGCAGGCAGGAGGACACAGG - Intronic
902448709 1:16483794-16483816 GGATGCAAGGAGGAGGAGCCTGG - Intergenic
903264904 1:22152213-22152235 GGGTGCAAGCCTGTAGTCCCAGG - Intergenic
903755611 1:25658390-25658412 GAGTGAAGGCAGGTGGCCCCAGG + Intronic
904356998 1:29946778-29946800 GGGTACCTGCAGGTGGACCCTGG + Intergenic
905395986 1:37666945-37666967 GTGTGCAAACAGCTGCACCCTGG + Intergenic
907294173 1:53439155-53439177 TGCCGCATGCAGGTGGACCCCGG - Intergenic
909392380 1:75132380-75132402 GGGTGCGCGCAGCTGCACCCCGG + Intronic
910739010 1:90494799-90494821 GGGGGAAAGCTGGTGGTCCCAGG + Intergenic
916627547 1:166574620-166574642 GGGTGCATGGATGTGGAGCCAGG + Intergenic
916677172 1:167073733-167073755 GGGTGGAGTCAGGTGGACCAAGG - Intronic
917652258 1:177089556-177089578 GTGTGCAAACATGTGTACCCTGG - Intronic
920526661 1:206672099-206672121 GGGAGGAAGCAGGTGGTTCCAGG - Intronic
922785610 1:228280982-228281004 GGGTGCAAGCAGGTGGACCCGGG + Intronic
923277004 1:232405209-232405231 GGGTGCACTCAGGAGGGCCCAGG - Intronic
924041429 1:239988099-239988121 GGGTCCAAGGCGGTGGACCAAGG + Intergenic
1063064971 10:2599475-2599497 GGGTGGAAGCAGGAGGCACCCGG + Intergenic
1063482070 10:6384986-6385008 GGGGGCAGGCAGGTGGGGCCAGG - Intergenic
1063722327 10:8596783-8596805 GGGTGGAAGGAGGTGGGCACTGG + Intergenic
1064149011 10:12847843-12847865 GGCTGGAAGCAGGTGAAGCCAGG + Intergenic
1064260863 10:13785096-13785118 GGTTGCAAGCTGGTGGGCCATGG - Intronic
1064320182 10:14297590-14297612 GGGTCCAGTCAGGAGGACCCAGG - Intronic
1067450982 10:46381670-46381692 GGGTGCAAGCAGCTCGACTGAGG - Intronic
1067586261 10:47478081-47478103 GGGTGCAAGCAGCTCGACTGAGG + Intronic
1067820600 10:49525912-49525934 GGGTGAAGGAAGGTGGACACAGG - Intronic
1067917744 10:50418738-50418760 GGGTGCAAAGAGGTGGGACCTGG + Intronic
1068632471 10:59311903-59311925 GGGTACAGGAAGGTGGTCCCAGG - Intronic
1071772438 10:88744164-88744186 TGCTGCAAGCAGGTGCAGCCAGG - Intronic
1072248883 10:93566559-93566581 GGGTGCAGGGAGCTGCACCCGGG - Intergenic
1072784602 10:98270989-98271011 GGGTTCAACCAGGTGCACCCTGG - Intergenic
1074765114 10:116694800-116694822 GGGCACAACGAGGTGGACCCAGG - Intronic
1075193227 10:120330521-120330543 GGGAGCAGGCATGTGGAGCCTGG - Intergenic
1075311960 10:121421833-121421855 GGGTCTCAGCAGGTGGACTCTGG + Intergenic
1075382546 10:122031006-122031028 GGGTGGAAGTAGGTGGAGTCAGG - Intronic
1075438611 10:122462247-122462269 GGGGACAGGCAGGTGGGCCCCGG + Intronic
1077104180 11:834846-834868 GCGTGGAGGCAGGTGGAGCCTGG - Intronic
1077536957 11:3129091-3129113 GGGTGGAGGAAGGTGGACACAGG + Exonic
1078906671 11:15694029-15694051 GGGTGCCAGAAAGTGGATCCTGG + Intergenic
1080030116 11:27651429-27651451 GGGTGCTCGCAGGTGGAGCAAGG - Intergenic
1081525644 11:43925722-43925744 GGCTTCAGTCAGGTGGACCCAGG + Intronic
1081667707 11:44926263-44926285 GGGTGCCAACAGGTGGTCCCTGG - Intronic
1084068368 11:66718507-66718529 TGGTGAAAGCAGGAGGCCCCCGG + Intronic
1084195283 11:67521073-67521095 GGGTGCCTGCATGCGGACCCTGG - Exonic
1084582434 11:70032356-70032378 GGGTGCAGGCAGGTGCCCCTGGG + Intergenic
1084642172 11:70432460-70432482 CGGTGACATCAGGTGGACCCTGG + Intronic
1089195635 11:116692684-116692706 GGGTCCAGGCAGGTGGCCCAAGG + Intergenic
1089602277 11:119623444-119623466 GGGTGGAGGGAGGTGGAGCCTGG + Intronic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1093101969 12:15038459-15038481 GGCTGCAAGCAGATGCAACCAGG + Intergenic
1097694478 12:62763214-62763236 GGGTGGAATCAGGCGGACCGGGG + Intronic
1100471242 12:94895146-94895168 GGGTGCAAACTGGTGGCTCCAGG + Intergenic
1103600449 12:122051259-122051281 GGCAGCAGGCAGGTGGATCCTGG - Intronic
1103796995 12:123510060-123510082 GGGTGTCAGCAGGTGGCCGCAGG + Intronic
1104020498 12:124988967-124988989 GGGCGCCAGCAGGCGGGCCCCGG - Exonic
1104790754 12:131480681-131480703 GGGTGGGGGCAGGAGGACCCAGG - Intergenic
1107014057 13:35694964-35694986 GGTTGCCAGGAGATGGACCCTGG - Intergenic
1107836768 13:44417980-44418002 AGGTGGCAGCAGGAGGACCCAGG - Intergenic
1113854439 13:113435953-113435975 GGGTGAATACAGGTGTACCCCGG + Intronic
1113854825 13:113437381-113437403 GGGTGAACACAGGTGTACCCCGG + Intronic
1113966700 13:114156580-114156602 GGGGGCAAGCAAGGAGACCCAGG - Intergenic
1114730457 14:24987453-24987475 AGGTGGGAGCAGTTGGACCCAGG - Intronic
1114886832 14:26863117-26863139 GGGAACAAGGAGGTGGACCATGG - Intergenic
1117285584 14:54283001-54283023 GGGTGGCAGCAGCTGCACCCAGG + Intergenic
1118918949 14:70132530-70132552 GTGGGCAAGCAGGTGGGCTCTGG + Intronic
1119705223 14:76779059-76779081 TGGTTCCAGCAGGTGGATCCTGG - Exonic
1121482680 14:94290969-94290991 GGGTCCAAGCAGGTGGAATCAGG + Intronic
1123013006 14:105358228-105358250 GGGTGCCAGGAGCTGGACGCCGG + Intronic
1124244681 15:28058869-28058891 GGGTGCAAGCCTGTGGTCCAGGG + Intronic
1129002636 15:72346981-72347003 GGAGGCAAGCAGTGGGACCCAGG + Intronic
1129515784 15:76156539-76156561 GGGGACAAGAGGGTGGACCCCGG - Intronic
1129774813 15:78229791-78229813 GGGTGCAAGCAGCAGAAGCCTGG - Intronic
1131516332 15:93079875-93079897 GGGTGCATGCCTGTGGACACAGG + Intronic
1132247025 15:100305540-100305562 GAGGGCAGGCAGGTGCACCCAGG + Intronic
1132302833 15:100787152-100787174 GGGTGGCAGCAGGTCGACCAGGG - Intergenic
1132558808 16:584303-584325 TGGTGTAGGCAGGTGAACCCGGG + Intergenic
1133383599 16:5351067-5351089 TGGTGGAAGCAGGTTGACCCCGG + Intergenic
1133580616 16:7141167-7141189 GGGAGCAAGTAGGAGGATCCTGG + Intronic
1134183227 16:12063973-12063995 GGGAGAGAGCAGGTGGTCCCAGG + Intronic
1136619447 16:31418369-31418391 CAGTGCAAGCAGGTGGGTCCAGG + Exonic
1136674874 16:31893707-31893729 GGCTGCATGCAGCTGGAGCCAGG + Intronic
1143178191 17:4968453-4968475 GGGTGCAGGCAGGAGGAGCTGGG + Exonic
1145960583 17:28884487-28884509 GGGTGGGTGCAGGTGGCCCCAGG + Intronic
1146163460 17:30571856-30571878 GGGAGCTAGCAGGTGGCCCATGG - Intergenic
1147180987 17:38685636-38685658 GGGTGGAAGCAGATGGAAGCGGG - Intergenic
1147977206 17:44254713-44254735 GGGTGGGAGCAGGAGGAGCCAGG + Intronic
1148441069 17:47711849-47711871 GGGTGCAGGGAGGTGGGGCCTGG - Exonic
1150330591 17:64291120-64291142 GGGTGCAAGCAGGTAGAGGTTGG + Intergenic
1151122554 17:71808743-71808765 GGCTGCAGGCATGTGTACCCTGG - Intergenic
1151310544 17:73290069-73290091 GGGTGCAGGCAGGTGGAAGATGG - Intronic
1152120138 17:78413439-78413461 GAGGGCAAGCAGGTGGCCACGGG - Intronic
1152195944 17:78918435-78918457 GGGTCCAGGCAGGTGGGCCCTGG + Intronic
1152286636 17:79416579-79416601 GGGGGCCAGCAGGTGAACCCTGG + Intronic
1152392567 17:80011410-80011432 GGCTGCAGGCAGGTGAGCCCTGG - Intronic
1152829195 17:82486683-82486705 GTGTGCAAGCGGGTGGAGCTGGG + Intronic
1152926409 17:83089747-83089769 GGGTGGACGCCGGTGGACGCCGG - Intronic
1160312784 18:77811447-77811469 GGCTGGAAGAAGGTGGAGCCAGG - Intergenic
1160452007 18:78972762-78972784 GGGCGCCAGCACGTGGCCCCTGG + Intergenic
1160800965 19:968578-968600 AGGTTCAAGCAGGTGGGACCAGG - Intronic
1162423776 19:10581651-10581673 AGGGACAAGCAGCTGGACCCAGG + Intronic
1165138491 19:33685556-33685578 GGGTGTAAGCAGGTGAAGGCAGG + Intronic
1165153370 19:33773530-33773552 GCGTGGGAGCACGTGGACCCTGG + Intergenic
1165177547 19:33941277-33941299 GGGTCCGGGCAGGTTGACCCAGG - Intergenic
1165804549 19:38572607-38572629 AGGTGCAAGGAGGTGGAAGCAGG - Intronic
1166203043 19:41251020-41251042 AGTTGTGAGCAGGTGGACCCTGG + Intronic
1168133767 19:54337363-54337385 GGGTTCAGTCAGGGGGACCCAGG - Intronic
1168639181 19:58019530-58019552 GGCTGCAAGCATGGGGACCAGGG - Intergenic
926748488 2:16179858-16179880 GTCTGGAAGCAGGAGGACCCAGG + Intergenic
929549296 2:42879356-42879378 GGATGCAGGCAGGTGGAGGCGGG + Intergenic
932470190 2:71949938-71949960 GGGTGGAAGCATTTGGAACCTGG - Intergenic
934922856 2:98359808-98359830 GAGTGCAAGCTGGTGCACTCAGG + Intronic
937220586 2:120341151-120341173 AGGTGTAAGCAGGTGGACACAGG - Intergenic
937264888 2:120609138-120609160 GGCTGCGAGCAGGTGGAGACAGG + Intergenic
937984133 2:127630988-127631010 GGGTGCAATGAGGTGGAGCGGGG - Intronic
938369457 2:130760267-130760289 GGGTGGGAGCGGGTGGAGCCTGG + Intronic
938388205 2:130882783-130882805 GGGTGCAGGCAGGAGGGCCAGGG + Intronic
939883081 2:147651920-147651942 GCCAGCAAGCAGGTGGAGCCGGG + Intergenic
940366422 2:152853163-152853185 GGGTGAAACCACGTGGAGCCTGG + Intergenic
945146999 2:206748668-206748690 GGCAGGAAGCAGGTGGAACCAGG - Intronic
947726237 2:232402649-232402671 GGGTGCAGGCAGGAGGACCCAGG + Intergenic
947735802 2:232454772-232454794 GGGCGCAGGCAGGAGGACCCGGG + Intergenic
948049397 2:234968039-234968061 TGGTGGAACCAGGTGGACCTGGG - Intronic
948118221 2:235509678-235509700 GGGTGCAAGCAGACGGACAGAGG - Intronic
948319504 2:237058286-237058308 GGCTGCGAGGAGGTGGCCCCAGG - Intergenic
949060442 2:241953579-241953601 GAGTGGAAGCTGGAGGACCCAGG + Intergenic
1173479141 20:43385469-43385491 GAGTGCAAGCAGGTGTGCGCTGG + Intergenic
1173905160 20:46622284-46622306 GGGATCAAGCAGGTGGATGCCGG + Intronic
1174171176 20:48619081-48619103 TGGTGCAAGCCTGTGGTCCCAGG - Intergenic
1175753485 20:61514931-61514953 TGGTGCAGGCAGGTGTGCCCTGG - Intronic
1175917749 20:62434800-62434822 GGGTGGAAGGAGCTGGTCCCTGG - Intergenic
1175952280 20:62589763-62589785 GGGAGCAACGAGGCGGACCCCGG + Intergenic
1176076104 20:63248936-63248958 GGATGCAAGCAGGTGTGCCCGGG - Intronic
1176138980 20:63536959-63536981 GGGTGCAGGAAGATGGAACCGGG + Intronic
1178266583 21:31148144-31148166 GGGTGTCAGCAGGAGTACCCTGG + Intronic
1179609131 21:42537967-42537989 GGGTTCAAGCAGGTGCAGCGTGG + Intronic
1179638548 21:42731588-42731610 GGGAGCAACCGGCTGGACCCAGG + Intronic
1179722602 21:43324134-43324156 GGGTGCAATCAGCTTGTCCCTGG - Intergenic
1180085333 21:45505584-45505606 TGGGGGAATCAGGTGGACCCAGG + Intronic
1180994496 22:19958946-19958968 GGGTGCAGGCCGGAGGACCGAGG - Intronic
1181031887 22:20152311-20152333 GGGTTCAAGAAGGAGGACACGGG - Intergenic
1181511561 22:23391513-23391535 GGGTTCAAGAAGGAGGACACGGG + Intergenic
1184241370 22:43212753-43212775 GGGTGCAGGAAGCTGGGCCCTGG + Intronic
1184685861 22:46096054-46096076 GGTGGCAGGCAGGGGGACCCAGG + Intronic
949737826 3:7194666-7194688 GGCTGAAAGCAGGTAGAGCCAGG - Intronic
949986647 3:9546417-9546439 GAATGGAAGCTGGTGGACCCTGG - Intronic
950283576 3:11727264-11727286 GGGCATAAGCAGGTGGACTCCGG - Intergenic
950575252 3:13828339-13828361 GGGTGCATGCAGCTGGGTCCTGG + Intronic
952165115 3:30739374-30739396 GGGTGCAGGCAGGTGGGCACAGG - Intronic
954870019 3:53760804-53760826 GGGTGCAAGTTGGTGGACAAAGG + Intronic
955208555 3:56919298-56919320 GGGTGCAAACTGGTGGCCCCTGG - Intronic
956701334 3:71961570-71961592 AGGTGCATGCAGGTGGACCATGG + Intergenic
957350714 3:79019262-79019284 GGGTGCAGGCAGCTGCCCCCAGG - Intronic
963655853 3:148049402-148049424 GGGTAGAAGAAGGTGGTCCCTGG + Intergenic
964296552 3:155240102-155240124 CAGTACAAGCAGGTGCACCCAGG + Intergenic
964796756 3:160506535-160506557 GGGTGCATTCAGGTGGAACATGG - Intronic
966512638 3:180781397-180781419 GGCTGCAAGCAGATGCACACTGG + Intronic
969048846 4:4358277-4358299 GGGTGGCAGCAGGGTGACCCAGG - Intronic
969289759 4:6231049-6231071 GGGTGAACGGGGGTGGACCCAGG - Intergenic
969666606 4:8560981-8561003 GGGTGAGAGCAGGAGGCCCCAGG - Intronic
970261397 4:14228615-14228637 GGGAGGAGGCAGGTGGAACCTGG + Intergenic
970429201 4:15973102-15973124 AGGAGGAAGCAGGTGGATCCCGG - Intronic
971150604 4:24027558-24027580 GGATGCAACCAGGTTTACCCTGG + Intergenic
972509094 4:39750970-39750992 GGGTGAAATCACTTGGACCCAGG - Intronic
981005040 4:139865986-139866008 AGGGGCATGCAGGTGGACCTTGG + Intronic
983784460 4:171715065-171715087 GGCTGCAAGGAGGTGCAGCCAGG + Intergenic
984980560 4:185276794-185276816 GGCAGCCAGCAGGTGGATCCTGG - Intronic
985871397 5:2560153-2560175 GGGGGCAGGAAGGTGGGCCCTGG - Intergenic
992172180 5:74114225-74114247 GGTTGCAAGCTGGTGGCCCATGG + Intergenic
992174803 5:74139549-74139571 TGGTGCATGCATGTGGACCACGG + Intergenic
992474207 5:77086929-77086951 GTGAGAAAGCAGGTGGGCCCGGG - Intronic
994245536 5:97471725-97471747 GGCTGCAAGGAGGTGCAGCCAGG - Intergenic
994510084 5:100691309-100691331 GGGATCAAGCAGGTGGACTTGGG - Intergenic
995533320 5:113112060-113112082 GGTTGGAATCAGGTGGACCAGGG - Intronic
998377333 5:141699856-141699878 GGTGGAAAGGAGGTGGACCCAGG + Intergenic
1001086329 5:168702390-168702412 GGGAGCAAGCAGCTGAACCCAGG + Intronic
1001136039 5:169103668-169103690 GGCTGCAAGCAGTTCCACCCTGG - Intronic
1001341051 5:170845729-170845751 GGGTTCAAGCAATTGAACCCAGG - Intergenic
1001803824 5:174566461-174566483 GGCTGCATGCAGGTGGACGATGG - Intergenic
1002691319 5:181052832-181052854 GGGTGCGAGCAGGAGCTCCCCGG + Intronic
1003054427 6:2805654-2805676 GTGGGTACGCAGGTGGACCCTGG - Intergenic
1004649182 6:17592092-17592114 GGGAGCAGGCAGGTGGAATCGGG + Intergenic
1007277228 6:40683519-40683541 AGGTGCAAGTAAGTGGACCTGGG + Intergenic
1010606254 6:77892518-77892540 GGGTGCATGCAGGTGTTCTCTGG + Intronic
1011674911 6:89723090-89723112 GGGGGCAAAAAGGAGGACCCTGG - Exonic
1012103727 6:95125696-95125718 AGGTGAAAGCAGGTGGGTCCAGG + Intergenic
1014172335 6:118292274-118292296 GGCTGCAAGCAGGTAGAACTGGG + Intronic
1016023563 6:139260925-139260947 GGGTGCCAGCATGTGGTCCGAGG + Intronic
1022012053 7:26316708-26316730 GAGGGTAAGCAGGTGGACCAGGG + Intronic
1023907423 7:44532266-44532288 GGGGGCAAGAAGGTGGTCCCTGG - Intronic
1026513646 7:71048456-71048478 GAATGCCAGCCGGTGGACCCAGG - Intergenic
1029100281 7:98124227-98124249 GGACGAAAGCAGGTGGAGCCAGG - Intronic
1036285723 8:7442905-7442927 TGGTGCATGCCGGTGGTCCCAGG + Intronic
1036335750 8:7868624-7868646 TGGTGCATGCCGGTGGTCCCAGG - Intronic
1036663932 8:10726510-10726532 CTGTGCAAGCGCGTGGACCCGGG - Exonic
1036751716 8:11447661-11447683 AGGTGCCAGCAGCTGGACCTGGG + Intronic
1037690644 8:21178745-21178767 ATGTGCAAGCAGGGAGACCCTGG + Intergenic
1039348213 8:36731692-36731714 GGGTGCAAACACATGGACACAGG + Intergenic
1040848195 8:51868447-51868469 GGGTGAAAACAGGTGAAGCCAGG + Intronic
1041196208 8:55403917-55403939 GGGTGCAGCCAGGTGTGCCCTGG - Intronic
1045721432 8:105115177-105115199 GTGTGCAAGCATCTGGCCCCTGG + Intronic
1046195626 8:110860068-110860090 GGGTGGCAGCAGCTGCACCCAGG - Intergenic
1048919616 8:139215996-139216018 GGGTGAAGGCAGCTGGGCCCAGG - Intergenic
1049320498 8:141993692-141993714 GGCTCCCAGCAGGTGCACCCAGG - Intergenic
1049502475 8:142974785-142974807 GCCTGCAAGCCGGTGCACCCAGG - Intergenic
1049849395 8:144822740-144822762 GGGTTCAAGCAGGAGAAACCTGG - Intergenic
1051583863 9:18706489-18706511 GGGAGCAAGCAGGTGGTCTCTGG + Intronic
1056824573 9:89867934-89867956 GGGAGCAGGCAGGGTGACCCAGG - Intergenic
1056941531 9:90960627-90960649 AGGTGCAAACAGCTGAACCCAGG + Intergenic
1057124074 9:92602526-92602548 TGGTGCCAGCAGCTGCACCCAGG + Intronic
1057124266 9:92603777-92603799 GGGAGAAAGCAGGGGGACCATGG - Intronic
1060104586 9:120865839-120865861 GGGGGCAAGGAGGTGGGACCAGG + Intronic
1060643445 9:125258369-125258391 CGGTGCAAGCCTGTGGTCCCAGG + Intergenic
1061574212 9:131496025-131496047 GGGTGCAAGCTGGTTGACAACGG - Exonic
1061911874 9:133729297-133729319 AGGTGCCAGGAGGTGAACCCAGG + Intronic
1062034221 9:134375647-134375669 GGTGGCCAGCAGGTGGGCCCGGG + Intronic
1062322776 9:135998464-135998486 GGGTGCAAGGAGCTGGAGCCCGG + Intergenic
1185695686 X:2192734-2192756 GGATGCTAGCAGGTGGAGGCCGG + Intergenic
1188261867 X:28032910-28032932 GGCTGGAAGCAGAAGGACCCTGG + Intergenic
1189954393 X:46262902-46262924 GGGAGCACGCAGGAGCACCCAGG + Intergenic
1190213919 X:48467840-48467862 GGGTCCAAGGAGGTGGGCTCAGG - Intronic
1192139822 X:68638123-68638145 GGAGGCCAGCAGGTGGGCCCAGG - Intergenic
1193916499 X:87370860-87370882 TGCTGCAAGCAGGTGCAGCCAGG - Intergenic
1194752913 X:97704664-97704686 GGGTCAAAGCAGGTTGAACCCGG + Intergenic
1195289215 X:103414964-103414986 GGGTGGAAGCAGGAGGAAGCTGG - Intergenic
1195466264 X:105182913-105182935 GGGTGCATGCAGGTGGGTGCAGG + Intronic
1196646036 X:118117801-118117823 AGGTGTAAGAAGGTGGCCCCAGG - Intergenic
1197703242 X:129615768-129615790 GTGTGCAAGCACCTGGGCCCTGG + Intergenic
1200246566 X:154529709-154529731 GGGTGGAGGCAGGAGGTCCCAGG - Intergenic