ID: 922786881

View in Genome Browser
Species Human (GRCh38)
Location 1:228287256-228287278
Sequence GCGGCTCCTGCAGGTGGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 408
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 360}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922786881_922786889 10 Left 922786881 1:228287256-228287278 CCTCTGCCACCTGCAGGAGCCGC 0: 1
1: 0
2: 2
3: 45
4: 360
Right 922786889 1:228287289-228287311 TGTCTCCTCTGCGTCCCTGAGGG 0: 1
1: 0
2: 1
3: 20
4: 203
922786881_922786888 9 Left 922786881 1:228287256-228287278 CCTCTGCCACCTGCAGGAGCCGC 0: 1
1: 0
2: 2
3: 45
4: 360
Right 922786888 1:228287288-228287310 CTGTCTCCTCTGCGTCCCTGAGG 0: 1
1: 0
2: 3
3: 50
4: 382
922786881_922786890 11 Left 922786881 1:228287256-228287278 CCTCTGCCACCTGCAGGAGCCGC 0: 1
1: 0
2: 2
3: 45
4: 360
Right 922786890 1:228287290-228287312 GTCTCCTCTGCGTCCCTGAGGGG 0: 1
1: 0
2: 1
3: 13
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922786881 Original CRISPR GCGGCTCCTGCAGGTGGCAG AGG (reversed) Intronic
900206372 1:1433536-1433558 GCTGTGCCTGCAGGAGGCAGAGG + Intergenic
900208528 1:1441749-1441771 GAGCACCCTGCAGGTGGCAGCGG + Exonic
900531005 1:3153166-3153188 GCAGATCCCTCAGGTGGCAGGGG - Intronic
900638135 1:3675679-3675701 AGGGCCCCTGCAGGTGGGAGTGG + Intronic
900667635 1:3826032-3826054 GCCTCCCTTGCAGGTGGCAGAGG + Intronic
900971003 1:5992395-5992417 GCTCCTCCCGCGGGTGGCAGCGG - Exonic
901194054 1:7430307-7430329 GCTGCTGCTGCTGATGGCAGTGG + Intronic
901207889 1:7507806-7507828 GAGGCTGGCGCAGGTGGCAGAGG - Intronic
901649481 1:10735460-10735482 GCTGAGCCTGCAAGTGGCAGCGG - Intronic
902006545 1:13236859-13236881 GCGGCTGCTGCAAGTGGTTGGGG - Intergenic
902025598 1:13381250-13381272 GCGGCTGCTGCAAGTGGTCGGGG - Intergenic
902511288 1:16968187-16968209 TCTTCTCCTGCAGGTGGCATGGG - Exonic
902515266 1:16986552-16986574 GCGGCCCCTGCAGGAGGCCGGGG + Exonic
902767164 1:18625026-18625048 GCTCCTCCTGCATGTGGGAGAGG + Intergenic
902810108 1:18883259-18883281 GAGGTACCTGCAGGAGGCAGTGG - Exonic
903534865 1:24060240-24060262 GAAGCTCCTGCAGGGGGCTGAGG - Intronic
903772800 1:25774539-25774561 GGGGCTCCTGCAGGCGGCAAAGG + Intronic
903954098 1:27012909-27012931 GCGGCTCTCGCTGTTGGCAGCGG - Intergenic
904603326 1:31685483-31685505 GCCGCTCCTGCTGGAGACAGAGG + Intronic
904808341 1:33147122-33147144 AGGGCTCTTGCAGGTGGCAGTGG + Exonic
905794223 1:40806504-40806526 GGGGCTGGTGCAGGTGGGAGAGG + Intronic
907238806 1:53069445-53069467 GTGGCTGCTGGAGGAGGCAGGGG + Intronic
907364873 1:53949800-53949822 GACCCTTCTGCAGGTGGCAGAGG - Intronic
909519598 1:76551992-76552014 GCAGCTGCTGCAGGTGGGGGAGG + Intronic
909587839 1:77311156-77311178 GAGGGTCCTGAAGGTGGCAGTGG - Intronic
910337844 1:86155016-86155038 GCGGCTCACGCAGGTCGCATGGG - Intronic
912410324 1:109476760-109476782 GTGCAACCTGCAGGTGGCAGGGG - Exonic
915747601 1:158176655-158176677 GCAGCAGCTGCAGGGGGCAGAGG + Intergenic
916147195 1:161750265-161750287 ACGCCTCCTGCGGGAGGCAGCGG - Intronic
917790567 1:178496396-178496418 GCTGCTGATGCAGGTGGGAGGGG - Intergenic
919738339 1:200967723-200967745 AAGGCTCCTGCAGGGTGCAGTGG - Intergenic
920379932 1:205529388-205529410 GCGGCTGCGGGAGGTAGCAGGGG - Exonic
920852493 1:209637883-209637905 GTGCCTCCTGGGGGTGGCAGTGG - Intronic
920913039 1:210234531-210234553 CCGGCTCCTGGTGGTGGTAGTGG - Intronic
921097381 1:211898825-211898847 GAGGCAGCTGCTGGTGGCAGTGG - Intergenic
922786881 1:228287256-228287278 GCGGCTCCTGCAGGTGGCAGAGG - Intronic
923921192 1:238565910-238565932 GCATCTCCCTCAGGTGGCAGTGG - Intergenic
924615906 1:245611857-245611879 GTGGCTCCTGCGGGAGGCAATGG - Exonic
1062962364 10:1582266-1582288 GCGTTACCTGCTGGTGGCAGAGG + Intronic
1063129923 10:3169365-3169387 GCTGCTGCTGCTGGGGGCAGAGG - Intronic
1063611195 10:7563292-7563314 TCTGCTCCTTCAGGTGGGAGAGG - Exonic
1064117120 10:12587675-12587697 GTGGCTCATGCAGGCTGCAGTGG + Intronic
1064259483 10:13773825-13773847 TCAGCCCCTGCAGGAGGCAGCGG - Intronic
1064622511 10:17229653-17229675 GCGGCTCCTGCAGGACTCGGTGG + Exonic
1066657747 10:37711486-37711508 GCAGTGCCTGCAGGTGCCAGAGG + Intergenic
1067771908 10:49132401-49132423 GCGGCTCCTGAAGGTAGATGTGG - Intronic
1070923899 10:80205544-80205566 GCGGCTGCCCCAGGTGCCAGAGG + Exonic
1072542723 10:96410529-96410551 GCAGCTCCCGCACGGGGCAGCGG + Intronic
1073027966 10:100502174-100502196 GCTTCTCCTGCAGTTGACAGAGG + Intronic
1073363510 10:102918594-102918616 GGGGATCCTGCAGGCGGCTGCGG + Exonic
1074242943 10:111657180-111657202 GCGGATCCTGCAGTTGGGTGGGG - Intergenic
1074295455 10:112183592-112183614 GCGACTCCTGCAAGTTGCTGGGG - Intronic
1075021708 10:118956965-118956987 GTGGCCCCTCCAGGTGTCAGTGG + Intergenic
1076680668 10:132169704-132169726 GTGTCTCCTGCAGTGGGCAGCGG + Intronic
1076724877 10:132408603-132408625 GCCGCTCCTGCAGCTGCCCGAGG + Intronic
1076736805 10:132462648-132462670 GAGGCACCTGCTGCTGGCAGAGG + Intergenic
1076795698 10:132797194-132797216 CAGGTTCCTGCGGGTGGCAGCGG + Intergenic
1076799175 10:132812692-132812714 GCAGCACCAGCAGGTGACAGTGG + Intronic
1077081748 11:727434-727456 GGGGCTCCAGCAGGAGGCCGTGG + Exonic
1077143083 11:1033409-1033431 GGGGCTGGTGCGGGTGGCAGGGG + Intronic
1077356313 11:2120534-2120556 CCGGCCCCAGCAGGTGGGAGCGG - Intergenic
1077383946 11:2260292-2260314 GCGGCTCCAGGTGGGGGCAGGGG - Intergenic
1077478939 11:2803903-2803925 GTGGCTGGAGCAGGTGGCAGAGG - Intronic
1078061352 11:8047143-8047165 GGGGCTGGTGCAGCTGGCAGTGG - Intronic
1081686526 11:45046970-45046992 GCGGCTCGGGCAGGTGGCAGTGG + Intergenic
1082824565 11:57568148-57568170 GCGGCTCCGGCAGCTTGCTGGGG - Intronic
1083192067 11:61059322-61059344 GAGGCTCACACAGGTGGCAGAGG - Intergenic
1083463714 11:62831958-62831980 GCGGCGGCGGCAGGCGGCAGAGG - Exonic
1083596212 11:63919286-63919308 GCGGCTGTAGCAGGTGGGAGGGG - Intergenic
1083751714 11:64764522-64764544 GCTGCTGCTGCTGGTGGTAGAGG + Intergenic
1084183098 11:67456223-67456245 GTGGCTCTTGCTGCTGGCAGGGG + Intronic
1084550992 11:69841988-69842010 GTGGCTGCTGCTGGTGGGAGTGG - Intergenic
1085811807 11:79689822-79689844 GAGGCTCCTGCGGGGGACAGTGG - Intergenic
1086079590 11:82889488-82889510 ACAGCTCCTGGAGGAGGCAGAGG + Intronic
1087061762 11:93985725-93985747 GGGTCTCCTGCAGGTGGCATGGG + Intergenic
1089494807 11:118902631-118902653 GGGTCTCCTCCAGGAGGCAGAGG + Exonic
1089524452 11:119087863-119087885 GTGGGGCCTGCAGCTGGCAGGGG - Intronic
1091266495 11:134276065-134276087 GCGGGACCTGCAGGAGGCAGAGG - Intronic
1091289995 11:134434070-134434092 GTGGCAGCCGCAGGTGGCAGGGG + Intergenic
1091668325 12:2435206-2435228 GCGAGGCCTGAAGGTGGCAGGGG - Intronic
1091689109 12:2583770-2583792 GTGGCTTCTGAATGTGGCAGAGG - Intronic
1092257974 12:6937353-6937375 GAGGGCCCCGCAGGTGGCAGGGG - Exonic
1097267569 12:57755086-57755108 GCGGCTCCTTCCGGCGGCGGCGG - Exonic
1097350217 12:58540657-58540679 ACAGCTCCTGTAGATGGCAGTGG + Intergenic
1102748443 12:115271094-115271116 GGGGCGATTGCAGGTGGCAGTGG - Intergenic
1103565177 12:121811808-121811830 GAGGGTGCTGCAGGTGGCTGGGG + Intronic
1103978256 12:124718209-124718231 GCAGCGCCTGCAGCTGGCATTGG + Intergenic
1104017709 12:124971669-124971691 GGGACTCCTGGGGGTGGCAGTGG - Intronic
1104481378 12:129111025-129111047 AGGGGTCCTGAAGGTGGCAGGGG - Intronic
1104769737 12:131353937-131353959 GTGGTTGCTGCAGGTGGCAGGGG - Intergenic
1104769746 12:131353977-131353999 GTGGTTGCAGCAGGTGGCAGGGG - Intergenic
1105442693 13:20428753-20428775 GCCTCACCTGCAGATGGCAGGGG + Intronic
1110558525 13:76886295-76886317 GCGGCTCTAGGAGGTGGCGGCGG - Exonic
1112285927 13:98104465-98104487 CCGGCTCAGGCAGGAGGCAGAGG + Intergenic
1113144565 13:107193615-107193637 GCCCCTCCTGCATGTGGGAGGGG - Intronic
1113428641 13:110230588-110230610 GTGGCTTCTGCAGGAGGCTGGGG - Intronic
1113960777 13:114124706-114124728 GCGGCTCCGTCAGGCCGCAGCGG - Intronic
1113977057 13:114235300-114235322 GCGGTCCCTGCAGCTGGGAGGGG + Intronic
1114613775 14:24057867-24057889 GCTGCTCCCACAGGTGGGAGAGG + Exonic
1115769951 14:36658012-36658034 GCAGATCCTGCAGGGGCCAGCGG + Intronic
1117441690 14:55766164-55766186 GCGGCTGCGGAAGATGGCAGAGG + Intergenic
1118992480 14:70809199-70809221 GCGGCTCCTGCGGGCGGCGGCGG - Exonic
1119959199 14:78835325-78835347 GCTGCTCCTGCAGTTGGTGGTGG + Intronic
1122540768 14:102496584-102496606 GCAGCACAGGCAGGTGGCAGGGG + Intronic
1122889082 14:104724330-104724352 GCGGCTGCAGCAGGAGGCGGCGG + Intronic
1123041768 14:105493151-105493173 TGGGGTCCTGAAGGTGGCAGGGG + Intronic
1123711206 15:22989069-22989091 ACGGCTCCTAAAGGTGGAAGAGG - Intronic
1124801498 15:32837368-32837390 GCGGCTCCTGGGGGTGGCGGTGG + Intronic
1125453029 15:39828502-39828524 GCGGCCCCTCCAGCTGGCAGAGG - Intronic
1129459830 15:75694974-75694996 GCCGCTCCAGCAGGTGACGGTGG - Intronic
1129719724 15:77871527-77871549 GTGGGGCCTGCAGGTGGCGGGGG - Intergenic
1129844683 15:78762769-78762791 TCGGCTCCTGCAGAGGGAAGGGG + Intronic
1131098972 15:89673372-89673394 GCGGGTCCTGCAGCTGCCGGTGG - Exonic
1132810152 16:1793460-1793482 GCGGCTGCTGGGGTTGGCAGGGG - Intronic
1132909131 16:2299359-2299381 GGGGGGCCTGCTGGTGGCAGGGG + Intronic
1133043464 16:3073092-3073114 ACGGCGCCTGCTGGTGGCGGGGG + Intronic
1133128525 16:3662359-3662381 GCAGCTCCTGGAGGCAGCAGCGG - Exonic
1133239200 16:4404540-4404562 GCGGTACCTGGAGGTGTCAGTGG - Intronic
1134007495 16:10827980-10828002 GCTGCTCCAACAGGAGGCAGAGG - Intergenic
1134080470 16:11321362-11321384 GTGGGTGCTGCAGGTGGCACTGG - Intronic
1135354331 16:21757066-21757088 ACAGCTCCTGCAGGAGGCAAAGG - Exonic
1135452822 16:22573206-22573228 ACAGCTCCTGCAGGAGGCAAAGG - Intergenic
1136546513 16:30957952-30957974 GGGCCTCGCGCAGGTGGCAGTGG + Exonic
1136546665 16:30958403-30958425 GCGGGGCCTGCAGGGGGCGGGGG + Intronic
1137730807 16:50688196-50688218 GCGGCTGCTGCTGCTGACAGTGG - Intergenic
1139572342 16:67821083-67821105 GCAGCTCCTGCAGGGGACAGTGG - Exonic
1139941624 16:70609808-70609830 GTGCCTCTTGCAGGTGCCAGTGG + Intronic
1140358445 16:74325238-74325260 TCGTCTCCTGCAGCTGGGAGCGG - Intergenic
1140415032 16:74768451-74768473 GAAGCCCCTGCAGGTGGTAGAGG + Intronic
1140525981 16:75623228-75623250 GCGTTTCCTGAAGGTGGGAGGGG - Exonic
1141840102 16:86568514-86568536 GCGGCGCCTGCGGGTGGTGGTGG - Exonic
1142289622 16:89187615-89187637 TGGGCTCCTGCAGAAGGCAGCGG + Intronic
1142605293 17:1078046-1078068 GCAGCTCCCGCAGCTGGCTGGGG - Intronic
1142699122 17:1649032-1649054 GCTGCTCCTGCAACTGGGAGCGG + Exonic
1142807628 17:2379805-2379827 GCTGCGGCTGCAGGTGGCAGTGG - Exonic
1142856931 17:2736043-2736065 CAGGCTCCTCCAAGTGGCAGAGG + Intergenic
1144960030 17:19039659-19039681 GGGGCTCCTGGGGTTGGCAGGGG + Intronic
1144975130 17:19134865-19134887 GGGGCTCCTGGGGTTGGCAGGGG - Intronic
1145162630 17:20585942-20585964 GCAGCTCTTGGAGGTGGCTGAGG + Intergenic
1147188274 17:38724676-38724698 GCAGCGCCTGCAGATGGCTGGGG + Exonic
1148722499 17:49763922-49763944 GCGGCTGCTGCAGCTGGAAGGGG + Exonic
1150200797 17:63355145-63355167 GCCTCTCCTGAATGTGGCAGTGG + Exonic
1150586367 17:66522149-66522171 ACGGGTCCTGCAGGTGGATGTGG + Intronic
1151370208 17:73643024-73643046 GCGGCGCCTGCTGGGGGCGGAGG - Intronic
1151477389 17:74351854-74351876 GCGCCTCCTGCAGCTGGCGCTGG + Exonic
1152013540 17:77735263-77735285 TCAGCTCCTGCAGGCCGCAGAGG + Intergenic
1152032767 17:77854276-77854298 GGGGCTCCTGCAGGTGCAGGGGG - Intergenic
1152123665 17:78433765-78433787 CCGGCTCCTGCAGGAGGTGGGGG + Intronic
1152219338 17:79053396-79053418 GAGGCTGATGCAGGTGCCAGGGG + Intergenic
1152234472 17:79131473-79131495 GAGGCTCCTGCGGGTGGTGGTGG - Intronic
1152305454 17:79517827-79517849 GCGGCTCCTGAAGTTGCCAGAGG - Intergenic
1152376213 17:79920135-79920157 GCCCCTCCTGCAGCGGGCAGGGG + Intergenic
1152395271 17:80029148-80029170 GCAGCACCTGCAGCTGGCAGGGG + Intronic
1152549353 17:81021596-81021618 GGGGCATCTGCAGGTGGTAGAGG - Intergenic
1152732142 17:81977650-81977672 GCGGCCCCGGCAGGCGGCGGAGG + Exonic
1152733797 17:81986935-81986957 GAGGCCCCTGGAGATGGCAGCGG + Intronic
1152822059 17:82442403-82442425 GGGGCTCCTGCTGGAGGCTGGGG + Exonic
1152853189 17:82649156-82649178 GCAGCTCCTGCAGGACGCAGAGG + Intergenic
1153350652 18:4077639-4077661 GCTGCTTCTGCTTGTGGCAGAGG - Intronic
1153820442 18:8827150-8827172 GCTGCTCCCGCAGATGGCGGGGG + Intronic
1155152774 18:23135788-23135810 GCCGCTGCTGCAGGCGGCCGTGG - Exonic
1155497898 18:26460589-26460611 GCAGCTCCATCAGGTGGCACAGG - Intronic
1155929861 18:31695473-31695495 GCCTCTCCTACAGGAGGCAGTGG - Intergenic
1157745738 18:50133757-50133779 CAGGCTCCTGGAGGTGGGAGGGG - Intronic
1158579874 18:58671730-58671752 GCGGCTCCCGCAGGCGGTTGAGG - Exonic
1159106056 18:64002826-64002848 GCGGCGACTGCAGGCGGCGGTGG - Intronic
1159420051 18:68206258-68206280 GCGGTCCCTGCATTTGGCAGGGG - Intergenic
1159511298 18:69400945-69400967 GGGGCTCCCGCAGCTGGCGGAGG + Intergenic
1159829471 18:73256838-73256860 CCAGCTCCTGCAGGAGGCAGAGG + Intronic
1159937642 18:74381859-74381881 GCGGCTCCTGCAGTAGGACGAGG - Intergenic
1160234505 18:77075467-77075489 GCTGCTCCTGGAGGGGACAGAGG - Intronic
1160528169 18:79549181-79549203 GCAGCTCCTGCAGGTGGTGTGGG + Intergenic
1160779512 19:871692-871714 TAAGCCCCTGCAGGTGGCAGTGG - Intronic
1160829006 19:1094157-1094179 GCGGCTGCTGCAGAGGACAGAGG + Intronic
1160874839 19:1292154-1292176 GTGGCGCCTGCAGGGGGGAGGGG - Intronic
1160923925 19:1533949-1533971 CCGGGTCCAGCAGGTGGCACAGG - Exonic
1160932692 19:1578121-1578143 GCGGCTCCAGCAGGCAGCACGGG + Exonic
1160950347 19:1663971-1663993 GCGGATCCTGCAGGAGGAGGGGG - Intergenic
1161315947 19:3617750-3617772 TGTGCTCCTGCTGGTGGCAGCGG - Intronic
1161595868 19:5150747-5150769 GCGGGTCCTGCAGGGCACAGGGG - Intronic
1161597079 19:5156090-5156112 CCCGCTCCTGCGGGTGGCAGCGG - Intergenic
1161616653 19:5274558-5274580 GTGGCTGTTGCAGGTGGAAGTGG - Intronic
1161630399 19:5352096-5352118 GGGCTTCCTGGAGGTGGCAGGGG - Intergenic
1162706051 19:12555581-12555603 GCAGCGCCTCCAGGTGGCTGCGG + Intronic
1162757455 19:12868737-12868759 GCGGCACCAGCAGATGTCAGGGG + Exonic
1162778864 19:12996350-12996372 GCGGTTCCCGAGGGTGGCAGTGG + Intronic
1163182743 19:15615673-15615695 GCTGCTCCTGCTGGTGGTCGGGG + Exonic
1163193467 19:15696892-15696914 GCAGTTCCTGCAGGCGGGAGTGG - Exonic
1163200030 19:15760414-15760436 GCAGTTCCTGCGGGTGGGAGTGG + Intergenic
1163202652 19:15779833-15779855 GCTGCTCCTGCTGCTGGCTGGGG - Intergenic
1163455268 19:17402870-17402892 GCCGCCCCTGCAGGTGAGAGTGG - Intergenic
1164402837 19:27913473-27913495 CTGGAGCCTGCAGGTGGCAGAGG + Intergenic
1164426372 19:28145559-28145581 GCAGCGGCAGCAGGTGGCAGAGG - Intergenic
1164700776 19:30282403-30282425 CCGTCTCCTGCAGTTGGCACCGG - Intronic
1164846399 19:31436720-31436742 CAGGCTCCAGCAGGTGGAAGTGG - Intergenic
1166339484 19:42129161-42129183 GGGGCTTCTGAAGGTGCCAGGGG - Intronic
1166521959 19:43486638-43486660 GCGGCTCCTGCAGCAGGCCATGG - Exonic
1166705028 19:44903766-44903788 GCGCCCCCTGCAGGCGGCTGGGG - Intergenic
1167259469 19:48450387-48450409 GCGGCTTCTGCAGGTGGTGGAGG + Exonic
1167715562 19:51140966-51140988 GGGGCTCCTTCAGGAGGGAGCGG + Intergenic
1168103286 19:54152471-54152493 GCCGCCCCTGCAGCTGTCAGAGG + Exonic
1168404895 19:56105569-56105591 CCGGCACCTGCAGGAGGCAGGGG + Intronic
925054046 2:842369-842391 GCTGCTCCTGCAAGGCGCAGTGG + Intergenic
925237367 2:2291717-2291739 TCGGCGCCTGCACGTGGCAAGGG - Intronic
925249542 2:2421056-2421078 GAGCCTCCTGGAGCTGGCAGTGG + Intergenic
925430574 2:3788906-3788928 GCGGAGCTTGCAGGTGACAGAGG - Intronic
926289663 2:11518503-11518525 GCTGCTGCTGCAGTGGGCAGGGG + Intergenic
927289677 2:21393345-21393367 GCTGCTCCTAGAGGTGCCAGGGG + Intergenic
927809376 2:26173128-26173150 GCGGCCCCGGGAGGTGGCGGCGG + Exonic
927852641 2:26510089-26510111 AAGGGTCCTGCAGGTGGGAGGGG - Intronic
928946130 2:36773800-36773822 GCTGCTTGTGTAGGTGGCAGTGG - Exonic
929201714 2:39243842-39243864 GCGGATTCTGCCGGTGGCGGGGG - Intergenic
929452841 2:42048202-42048224 GCGGCGCCGGCGGGCGGCAGTGG + Exonic
929501316 2:42493710-42493732 GCGGTACCTGCGGGTGGCCGGGG + Exonic
929946832 2:46378053-46378075 GCTGCTGCTGCTGGTGGCACTGG - Exonic
930085937 2:47497300-47497322 TCGGTTCCTTCATGTGGCAGGGG + Intronic
931757094 2:65384110-65384132 GCGGCCGTTGCAGGTGGCTGAGG - Intronic
932278267 2:70467941-70467963 CCAGCTGCTTCAGGTGGCAGAGG - Intronic
932801466 2:74745938-74745960 GCTGCACCTGCAGGAGGAAGTGG + Intergenic
935133071 2:100275695-100275717 GGGGCTTCTGCAGGTCTCAGGGG - Exonic
937207314 2:120245094-120245116 ACAGCTCCTGCAGATAGCAGAGG + Intronic
938337684 2:130513720-130513742 GGGACTCCTGAATGTGGCAGGGG - Intergenic
938352155 2:130607015-130607037 GGGACTCCTGAATGTGGCAGGGG + Intergenic
939705766 2:145450953-145450975 GCTACTTCTTCAGGTGGCAGAGG - Intergenic
940918895 2:159286573-159286595 CCCGCTCCTGCAGGTGAGAGCGG - Exonic
942249754 2:174037684-174037706 GAGGCTCCTGAAGGCAGCAGGGG - Intergenic
942765169 2:179446662-179446684 GTGGCTGCTCCAGGTGGCAGGGG + Exonic
943669921 2:190649252-190649274 CCGGCTCCTGCAGCCGCCAGAGG + Exonic
944077766 2:195751617-195751639 GCGGCTCCAACAGATGGAAGTGG + Intronic
945339367 2:208633268-208633290 GGGACTTCTGGAGGTGGCAGGGG - Intronic
947612522 2:231532764-231532786 GCAGCTCCTGGAGGTCCCAGTGG - Intergenic
947915241 2:233828332-233828354 GTGGCTCTTGCATTTGGCAGTGG + Intronic
948323278 2:237088928-237088950 GAAGCTCCTGGAGGTGGCGGAGG + Intronic
948336361 2:237210527-237210549 GAGGGTCATGCTGGTGGCAGTGG - Intergenic
948495319 2:238345139-238345161 AAGGCTTGTGCAGGTGGCAGCGG + Intronic
948613345 2:239183563-239183585 GAGGCACATGCACGTGGCAGTGG - Intronic
948949860 2:241242465-241242487 GCAGCTCCTGCATCTGGCGGAGG - Exonic
949048353 2:241882544-241882566 GCCGCGCCTGCGGGGGGCAGAGG - Intergenic
1169118582 20:3082671-3082693 GCGGCTGGTGCAGCTGGCCGGGG - Exonic
1172164746 20:32892337-32892359 GCGGCTGCTGCAGGAGGCCTGGG - Intronic
1172952536 20:38731114-38731136 GCGAATCCTGAGGGTGGCAGGGG + Intergenic
1173221771 20:41137505-41137527 GCGGCTCCTGCAGGCGGACACGG - Exonic
1173865157 20:46308350-46308372 CCGGCTCCTGCGGGCGGCCGCGG - Exonic
1174136420 20:48383071-48383093 GTGTCTCTTGCAGTTGGCAGAGG - Intergenic
1174540473 20:51285437-51285459 GGTGCCCCTTCAGGTGGCAGAGG + Intergenic
1175825415 20:61934064-61934086 CCGGCTGCTGCAGCTGGCTGAGG - Exonic
1176130487 20:63494722-63494744 GAGGCACCGGCAGGTGGCACGGG - Intronic
1176137794 20:63532487-63532509 GGGGCTCTTGCTGGAGGCAGCGG - Intronic
1178983495 21:37284147-37284169 GCGGCTCCTGCAGCTGATACGGG - Intergenic
1179600161 21:42472119-42472141 GGGGGCCCTGCAGGTGGCTGGGG - Intergenic
1179974461 21:44856267-44856289 GCTGCTGCTGCAGGAGGAAGAGG - Exonic
1180842711 22:18966697-18966719 GAGGCTTCTGGAGGAGGCAGAGG + Intergenic
1181025660 22:20125928-20125950 GTGGCTCCTGGAGGAGTCAGTGG + Intronic
1181052081 22:20242697-20242719 CCAGCTCCTGCAGGCCGCAGCGG + Exonic
1181057887 22:20268440-20268462 GCGGCCCCTGCAGGCGGCGGAGG + Exonic
1181087711 22:20449988-20450010 GCGGGTCCAGCAGGTGGCTCAGG - Intronic
1181514424 22:23402871-23402893 GCGGCCCCTGCAGGAGGCCGAGG + Intergenic
1181920825 22:26319228-26319250 GTGGACCCTGCAGGTGGCAGTGG - Intronic
1182149847 22:28020197-28020219 GGGGCTCCAGCAGGTGGCACTGG + Intronic
1182488627 22:30654805-30654827 GCGGCTGCCGAAGATGGCAGAGG - Intronic
1183079336 22:35446627-35446649 GGGGCGCCTGCAGGAGGGAGTGG + Intergenic
1183387771 22:37525022-37525044 GGGACTCCTGCAGGGGCCAGAGG + Intergenic
1183931280 22:41237529-41237551 CCGTTTCCTGCAGGTGCCAGGGG - Exonic
1184128925 22:42505636-42505658 GTGCCTCCTGCATCTGGCAGTGG + Intergenic
1184137720 22:42558951-42558973 GTGCCTCCTGCATCTGGCAGTGG + Intronic
1184597921 22:45525564-45525586 GCAGCTCCTCCAGCTGGCTGTGG - Exonic
1184646576 22:45898596-45898618 GTGGCCCCTGCAGGAGGTAGGGG - Intergenic
1184671633 22:46014902-46014924 GGGGCTGCTGCAGGTGGCTGGGG - Intergenic
1184777143 22:46628855-46628877 GTGGCTCCTGGGGGTGGCAGAGG + Intronic
1184872920 22:47252169-47252191 GGGGCTCCTGCAGGTGGGGTGGG - Intergenic
1185280860 22:49969298-49969320 GCCACTCCAGCAGGTGGCGGGGG + Intergenic
949920750 3:8998396-8998418 GGGGCTCTTGCAGTTGGGAGCGG - Intronic
950122466 3:10490778-10490800 GGGCCTCCTGCAACTGGCAGGGG + Intronic
950451789 3:13069530-13069552 CCGGCCCCCGCAGGAGGCAGTGG - Intronic
951335908 3:21421365-21421387 GCGGCTGCTGCAGCTGCTAGAGG + Exonic
954154911 3:48680070-48680092 GCAGCTCCTCTAGGTAGCAGCGG + Exonic
954289579 3:49642583-49642605 GCCTCTCCTGCAGGTGGCCTGGG - Exonic
954292418 3:49656574-49656596 GCTGCTCCTGGGGGTGGCAGTGG + Exonic
954899959 3:54010449-54010471 CCGGCTACTTCAGGAGGCAGAGG - Intergenic
955063672 3:55516154-55516176 GCTGCTCCTTCTGGGGGCAGCGG + Intronic
960053142 3:113256368-113256390 GCTGCTCCTGAAGGCGGCTGGGG - Intronic
960159164 3:114331238-114331260 AGGTCTCCTGGAGGTGGCAGGGG - Intergenic
960281311 3:115784249-115784271 GCGGCGCCTGCAGCTGCCTGGGG + Intergenic
960688148 3:120314244-120314266 GCTGCTGCTGCAGCTGGCACAGG + Intergenic
960786126 3:121374007-121374029 GGGGCACATGCAGGTGTCAGTGG - Intronic
962820686 3:139044937-139044959 GCGGGTCCTCCAGGGGGCAGAGG - Intronic
963902078 3:150742579-150742601 GTGCTTCCTGCAAGTGGCAGGGG - Exonic
966882255 3:184357201-184357223 GCAGCTCCTGCAGGTCAAAGGGG + Exonic
968131211 3:196193972-196193994 GGGGGCCCTGCAGGTGGCTGAGG - Intergenic
968914587 4:3491892-3491914 ACGGCTCCTGCACTTGGCCGTGG - Intronic
968928425 4:3562462-3562484 GCCACCCCTGCAGGTGGCAGCGG + Intergenic
968960253 4:3739745-3739767 GCGTGGCCTGCAGCTGGCAGAGG + Intergenic
969481209 4:7448019-7448041 GCGGCTCGTGCTGGGGTCAGCGG + Intronic
969588192 4:8106742-8106764 GCGGCTCGTGCTGGTGGGTGCGG - Intronic
969676627 4:8618030-8618052 GAGGCTCCTGAAGGTGGCGTGGG - Intronic
972671142 4:41214731-41214753 GCGACCCCTGCAGGTGGAGGCGG + Intronic
973820315 4:54657479-54657501 GCTGCTCGTGGAGGTGGCATGGG - Intergenic
975650253 4:76586043-76586065 GCAGCTCCTGCAAGTGGCGGCGG + Intronic
976337404 4:83906223-83906245 GCAGCTGCTGCTGCTGGCAGTGG + Intergenic
978515011 4:109560298-109560320 GCGGCTCCCGCAGGCGTCAGCGG - Exonic
979195597 4:117916798-117916820 GCAGCTCCTGTGGGTGTCAGTGG + Intergenic
979600017 4:122577203-122577225 GCTGCTCCTGCAGGTGCCAGGGG - Intergenic
981348280 4:143700049-143700071 CCGGCACCTGCGGGTGGCCGTGG + Exonic
984704163 4:182835572-182835594 GTGGCTGGTGCAGGTGGTAGTGG - Intergenic
984814682 4:183825403-183825425 GCGCGTGCTGCAGATGGCAGCGG + Intergenic
984891620 4:184498904-184498926 GGGGCTCCTGGAGGCAGCAGAGG - Intergenic
985524927 5:396899-396921 GAGGCTGCTGCAGGTGTCTGGGG + Intronic
985792453 5:1937545-1937567 TGGGCTCCTGCAGGTTACAGGGG + Intergenic
985801147 5:2005927-2005949 CTGCCTCCTGCAGGTGTCAGCGG - Intergenic
990382845 5:55233160-55233182 GCGCCTCCCGCGGGTGGAAGTGG + Exonic
991674180 5:69075476-69075498 GGAGCTCCTGCCGCTGGCAGGGG + Intergenic
992001217 5:72438274-72438296 GCATCTCCTGCAGGTTCCAGTGG - Intergenic
993107996 5:83622151-83622173 GCTGCTGCTGCTGCTGGCAGAGG - Intergenic
994094010 5:95832530-95832552 GGGGCACCTGCAGTGGGCAGAGG - Intergenic
994844072 5:104963059-104963081 GGGGCTCCTCAAGGTGGGAGAGG - Intergenic
995574373 5:113513929-113513951 CCGGCTCCTGGCGGTGGCGGAGG + Exonic
996702839 5:126466921-126466943 GCGGTTCCTGCAGTTGGAAAGGG + Intronic
997647183 5:135489332-135489354 GCGGGGCCTGCAGGTGGAGGAGG + Intergenic
998106173 5:139470854-139470876 CAGGCTCCTGAAGCTGGCAGGGG + Intergenic
1001819447 5:174698574-174698596 GGGGCTTCTGCTGGTGGCCGGGG + Intergenic
1001858472 5:175033007-175033029 GCTGCCCCTGCAGGAGACAGAGG + Intergenic
1002196647 5:177504850-177504872 CCGGCCCCTTCAGCTGGCAGCGG + Exonic
1005191554 6:23229180-23229202 GCTGCTCCTGCAGGACCCAGGGG - Intergenic
1006143249 6:31943590-31943612 AGGGCTCCTGCAGGGGCCAGAGG - Intronic
1006320375 6:33316219-33316241 GCAGCTTCTGCAGTGGGCAGTGG - Exonic
1006614688 6:35318381-35318403 GCGGCTGCTGCAGGAGGAGGAGG + Exonic
1007749936 6:44065652-44065674 GCGGCTCCAGCACATGGGAGAGG + Intergenic
1007781558 6:44257481-44257503 GCCGCTCCTGGAGGCGGCGGCGG - Exonic
1013234557 6:108185937-108185959 GTGGATGCTGCAGATGGCAGAGG + Intronic
1018471378 6:164101216-164101238 GGGGGTCCTGCAGGTGGAGGAGG - Intergenic
1018719736 6:166563458-166563480 GCAGCCCCTGGGGGTGGCAGGGG - Intronic
1018804674 6:167249500-167249522 GGGGCTCCAGCAGCTGCCAGAGG + Intergenic
1019174515 6:170153480-170153502 CCGGCTCATGCAGGTGGGACTGG - Intergenic
1019210600 6:170401541-170401563 CTGGCTCCTGCAGGGGACAGCGG - Intronic
1019876059 7:3811782-3811804 GCTGCTTCTGCAGGTGGCGTGGG - Intronic
1021100822 7:16584967-16584989 GTGCCTCCTGCTGGTGCCAGGGG + Intergenic
1023270423 7:38456192-38456214 GCTGCTGCTGCAGGTTGCAGCGG + Intronic
1023741550 7:43285676-43285698 GTGGCTCATGCAGGTGGCTGAGG + Intronic
1024423809 7:49202214-49202236 ACAGCTCGTGCAGGTGGCATGGG - Intergenic
1024576856 7:50771429-50771451 GTGGCTTATGCAGGAGGCAGGGG - Intronic
1024981270 7:55159353-55159375 CCTGCTCCTCCAGGTGGCTGAGG + Intronic
1031447536 7:121873075-121873097 GCGGCTCCTGGAGGGGGCGGGGG - Exonic
1032090727 7:128910368-128910390 GCGGTTCCTGCAGCCGGCGGCGG - Intronic
1032795199 7:135270813-135270835 GCTGCTCCTGCAGTGGGCAGAGG - Intergenic
1034202451 7:149290968-149290990 CAGGCACCTGCAGGGGGCAGGGG + Intronic
1034271854 7:149806923-149806945 GCTGCCCGTGCAGCTGGCAGGGG - Intergenic
1034699029 7:153080790-153080812 CTGGCTCCTGCAGGAGGCTGAGG + Intergenic
1034932222 7:155171698-155171720 TTGGCTGCTGCAGGTGGGAGAGG + Intergenic
1035987762 8:4453652-4453674 GCGGGACCTGCAGGTGTCGGGGG - Intronic
1036660103 8:10702314-10702336 GGGACTCCTGCAGATGCCAGTGG - Intronic
1036913792 8:12785320-12785342 GCAGCACGTGCAGGTGCCAGTGG + Intergenic
1037952757 8:23029440-23029462 GAGGCTGCTGCAGGGGGCAGGGG + Intronic
1037963307 8:23115793-23115815 GGGGCTGCTGCAGGGGGTAGGGG - Intronic
1037967709 8:23146764-23146786 GGGGCTGCTGCAGGGGGTAGGGG + Intronic
1038459396 8:27703268-27703290 GCAGCACCTGCACCTGGCAGAGG + Intergenic
1039394589 8:37214540-37214562 GAGGCTCCTGGGGTTGGCAGAGG + Intergenic
1039770733 8:40684412-40684434 GCGGCACCTGCAGTGGGCATTGG - Intronic
1039792990 8:40890679-40890701 TCTGCTCCTTCATGTGGCAGTGG + Intronic
1039981897 8:42415276-42415298 GTGGCTCCTGTGGGTGGCTGGGG - Intergenic
1040555179 8:48471913-48471935 GGGACTCCTGCAGGGGACAGGGG - Intergenic
1041167205 8:55102135-55102157 GCTGCTCCTGCTGCTGGCGGCGG + Intergenic
1042189801 8:66174507-66174529 GCAGCTCCAGCGAGTGGCAGTGG + Exonic
1042964767 8:74338619-74338641 GCGGAGGCTGCAGGTTGCAGAGG - Intronic
1044474657 8:92612176-92612198 CTGGCCCCTGCAGGAGGCAGAGG + Intergenic
1046022886 8:108687762-108687784 GCTGATCTTGCAGGAGGCAGAGG + Intronic
1049198267 8:141327166-141327188 GCAGCCCCGGCAGGTGACAGGGG + Intergenic
1049621735 8:143601355-143601377 GCTCTTCCTGCAGGTGGCGGTGG - Exonic
1049681950 8:143923034-143923056 GCGACTGCGGCAGCTGGCAGAGG - Exonic
1049710782 8:144062427-144062449 GGGGCTCCTGCATGTGGGCGTGG - Intronic
1049712735 8:144073411-144073433 GCTGCTCCTCCAGGTGGGAGGGG - Intergenic
1050358440 9:4804757-4804779 GCTGCTCCGGCAGGAGTCAGTGG - Intronic
1053007682 9:34614900-34614922 GCTGCAGCTGGAGGTGGCAGTGG + Intronic
1053286078 9:36850314-36850336 GGGGCCCCTCCAGGTGGCTGTGG + Intronic
1053803309 9:41777604-41777626 GCCACCCCTGCAGGTGGCAGCGG + Intergenic
1054141954 9:61537520-61537542 GCCACCCCTGCAGGTGGCAGCGG - Intergenic
1054191602 9:61988914-61988936 GCCACCCCTGCAGGTAGCAGCGG + Intergenic
1054461713 9:65468698-65468720 GCCACCCCTGCAGGTGGCAGCGG - Intergenic
1054646769 9:67598798-67598820 GCCACCCCTGCAGGTAGCAGCGG - Intergenic
1055748259 9:79474683-79474705 GCGGTTCCTGCTGCTGGCTGAGG + Intergenic
1056369945 9:85943478-85943500 GGGGCACCTGCAGGTGGAAAGGG + Intronic
1058445387 9:105050430-105050452 GCGGTTCCTGGAGATGTCAGAGG - Intergenic
1059379649 9:113913117-113913139 GCAGCTCTTACACGTGGCAGCGG - Intronic
1059432244 9:114257278-114257300 GAGGCTCCTGGAGCTGGCAGAGG + Intronic
1060263481 9:122095137-122095159 GCGGCTCCCTCAGGTGGGAGGGG - Intergenic
1060557163 9:124513870-124513892 GCTGCTCGTGCTGCTGGCAGAGG + Intergenic
1060639157 9:125224110-125224132 GCTTCTCCTGGAGGAGGCAGAGG + Intronic
1061052978 9:128206927-128206949 GAGGCTGCTGCAGTGGGCAGGGG + Intronic
1061447847 9:130651379-130651401 GCTGCGGCTGCAGGTGCCAGAGG - Intergenic
1061994362 9:134176249-134176271 GCGGCGCCTGCAGGGAGCGGCGG - Intergenic
1062049659 9:134440745-134440767 GCTGCTCCTCCAAGGGGCAGGGG + Intergenic
1062093449 9:134690550-134690572 GTGGCTCCTGAGGCTGGCAGGGG - Intronic
1062324470 9:136005508-136005530 GTGGCTCCTGTAGGAGGCAATGG + Intergenic
1062472731 9:136713362-136713384 GCGCCTCCGGCAGATGGCTGGGG - Intronic
1062572756 9:137193144-137193166 GCAGCTCCTGCTGGTGTCTGGGG + Intronic
1062596241 9:137301153-137301175 GCGGGTCCTGAAGGCGGCGGCGG + Exonic
1062606635 9:137351438-137351460 GTCACTCCTGCAGGTGGCCGTGG - Exonic
1186481966 X:9902854-9902876 GTGGCTCCTGCAGGCGGGGGCGG - Intronic
1187452612 X:19412122-19412144 CAGCCTCCTGCAGGTGGCTGTGG - Intronic
1187676074 X:21717917-21717939 GCGCCTCCATCAGCTGGCAGAGG + Intronic
1191833063 X:65435904-65435926 GCCGCTCATGCAGGTCCCAGAGG + Intronic
1192189877 X:68984270-68984292 GAGGCTAGTGCAGGTGGCTGGGG - Intergenic
1192698972 X:73447690-73447712 GCGGCTCCTGCTGGGGGAACTGG - Exonic
1194995590 X:100588421-100588443 GTGGCTCCTGTATGTGGCTGTGG - Intronic
1195845280 X:109220955-109220977 GTGTCTCCTGCATGTGACAGTGG - Intergenic
1198942218 X:141968333-141968355 GCGGCTCCTGCCGGGTGCAGAGG - Intergenic
1200039657 X:153355944-153355966 GCAGCTCATGCAGGTTGGAGGGG + Intronic
1200124569 X:153807231-153807253 GCGGCTCCCGCAGCTGGCTGCGG + Intronic
1200177463 X:154126782-154126804 GTGGTTCTTGCAGGTGGCAAAGG - Intergenic