ID: 922787019

View in Genome Browser
Species Human (GRCh38)
Location 1:228287883-228287905
Sequence ACCTCCGGCCGCAGGACAGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 110}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922787008_922787019 18 Left 922787008 1:228287842-228287864 CCTACGCCAGGAGGGTGCCATGC 0: 1
1: 0
2: 0
3: 12
4: 145
Right 922787019 1:228287883-228287905 ACCTCCGGCCGCAGGACAGCGGG 0: 1
1: 0
2: 0
3: 16
4: 110
922787013_922787019 1 Left 922787013 1:228287859-228287881 CCATGCTGGAGCTGGTGGTCCGG 0: 1
1: 0
2: 1
3: 8
4: 247
Right 922787019 1:228287883-228287905 ACCTCCGGCCGCAGGACAGCGGG 0: 1
1: 0
2: 0
3: 16
4: 110
922787010_922787019 12 Left 922787010 1:228287848-228287870 CCAGGAGGGTGCCATGCTGGAGC 0: 1
1: 0
2: 1
3: 36
4: 262
Right 922787019 1:228287883-228287905 ACCTCCGGCCGCAGGACAGCGGG 0: 1
1: 0
2: 0
3: 16
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922787019 Original CRISPR ACCTCCGGCCGCAGGACAGC GGG Exonic