ID: 922789255

View in Genome Browser
Species Human (GRCh38)
Location 1:228301418-228301440
Sequence CATTATAACCAGAGGGTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 272}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922789255_922789261 9 Left 922789255 1:228301418-228301440 CCCTCTACCCTCTGGTTATAATG 0: 1
1: 0
2: 2
3: 19
4: 272
Right 922789261 1:228301450-228301472 TCAACTCCTGAACTAACTTTTGG 0: 1
1: 0
2: 1
3: 12
4: 160
922789255_922789262 10 Left 922789255 1:228301418-228301440 CCCTCTACCCTCTGGTTATAATG 0: 1
1: 0
2: 2
3: 19
4: 272
Right 922789262 1:228301451-228301473 CAACTCCTGAACTAACTTTTGGG 0: 1
1: 0
2: 0
3: 13
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922789255 Original CRISPR CATTATAACCAGAGGGTAGA GGG (reversed) Intronic
904026099 1:27504693-27504715 CATTCTCACCAGAGGGAAGCAGG - Intergenic
905168302 1:36096425-36096447 AATTGGAACCAGAGGGTGGAAGG + Exonic
906219881 1:44070033-44070055 CAATAAAACCAGAGGGTCAAAGG - Intergenic
907195558 1:52683817-52683839 CATAGTAACCAAAGGGTAGAAGG - Intergenic
910627981 1:89328421-89328443 CATTAAAAGCAGAGTGTAGAGGG + Intergenic
911859637 1:102931244-102931266 CATTCAAAGCAGTGGGTAGAGGG - Intronic
911954776 1:104220216-104220238 CATTCAAAGCAGAGTGTAGACGG - Intergenic
912352651 1:109028908-109028930 GATTTTAACCAGAGGCCAGAAGG - Intronic
913965068 1:143370059-143370081 CTTTATAACAAGAGGAGAGAAGG + Intergenic
914059444 1:144195661-144195683 CTTTATAACAAGAGGAGAGAAGG + Intergenic
914119706 1:144770710-144770732 CTTTATAACAAGAGGAGAGAAGG - Intergenic
914320941 1:146558949-146558971 CCATAAAACCAAAGGGTAGAAGG + Intergenic
914921072 1:151847832-151847854 CATTACAACCAGAGAGTCCACGG + Exonic
917712664 1:177702751-177702773 CATTGTAACCAGAGGCTCAAAGG + Intergenic
919473071 1:198002766-198002788 CATCATAACTAGAGGTTAGACGG - Intergenic
920831315 1:209468248-209468270 CATTATCACCAGAGATGAGATGG - Intergenic
921288207 1:213628734-213628756 CATTCAAAGCAGAGTGTAGAGGG - Intergenic
922387426 1:225101515-225101537 GATAATAACCAGAGGATAGGAGG - Intronic
922789255 1:228301418-228301440 CATTATAACCAGAGGGTAGAGGG - Intronic
923376686 1:233371053-233371075 CAATATTACCAGAGGAAAGAGGG - Intronic
923841475 1:237676411-237676433 CATTCTATCCACAGGGTAGAGGG + Intronic
924250263 1:242125885-242125907 CATGGTAACCACAGGATAGATGG + Intronic
1064386041 10:14892617-14892639 CATTATCACCAGAATATAGAGGG - Intronic
1064671546 10:17719963-17719985 CATTCAAACCAGTGTGTAGAGGG - Intergenic
1069141893 10:64837574-64837596 CATTAAAAGCAGTGTGTAGAGGG + Intergenic
1072045515 10:91650899-91650921 CAGAATAACCAGAAGCTAGAAGG - Intergenic
1072863209 10:99029242-99029264 GATTATAACCAGAAGATATAAGG + Intronic
1073298931 10:102458896-102458918 CTATATAATCAGAGGGTTGAGGG + Intergenic
1073979154 10:109134395-109134417 CATTAAAAGCAGTGGGTAGAGGG + Intergenic
1074096094 10:110313824-110313846 CATTATATCCAAGGGGTAGGGGG + Intergenic
1076978596 11:193399-193421 TATTATGACCAGAGGCTTGAAGG - Intronic
1077972650 11:7211237-7211259 CATTTTACCCAAAGGGCAGAGGG - Intergenic
1078252262 11:9625947-9625969 CACTGTAACAAGAGGGAAGAAGG - Intergenic
1078902950 11:15658505-15658527 CATTTGAACCAGAGAGTAAAAGG - Intergenic
1078981796 11:16543949-16543971 CACAATAACTAAAGGGTAGAAGG + Intronic
1080185779 11:29483706-29483728 CATAATAACAAAAGGGAAGAAGG - Intergenic
1080346581 11:31332530-31332552 CATTTAAAGCAGTGGGTAGAGGG - Intronic
1080711556 11:34752684-34752706 CATTATACTCATAGGGAAGAGGG + Intergenic
1082314937 11:50706439-50706461 CATTCAAAGCAGTGGGTAGAGGG - Intergenic
1082937590 11:58670595-58670617 CGTAATATCCAGGGGGTAGAGGG - Intronic
1086181959 11:83962979-83963001 CATTGTTGCCAGAGAGTAGATGG + Exonic
1086294746 11:85352557-85352579 CATTTAAAGCAGAGTGTAGAGGG - Intronic
1092859286 12:12706037-12706059 TAGTCTAAGCAGAGGGTAGATGG - Intergenic
1092995633 12:13947883-13947905 CAGTAAACCCAGAGGGTAGTAGG - Intronic
1093679644 12:21987234-21987256 CATTAGAATGAGAGGTTAGATGG + Intergenic
1095797665 12:46237967-46237989 CATTATAACCAGAGGGAGGAGGG + Intronic
1095798742 12:46249325-46249347 CATTTAAACCAGTGTGTAGAGGG + Intronic
1098844311 12:75517174-75517196 CACGGTAACCAGAGGGTAGAGGG + Intergenic
1098993629 12:77093601-77093623 CATTTTAAGCAGTGTGTAGAGGG - Intergenic
1099381893 12:81964706-81964728 CAATATAACCAGAAGTGAGATGG + Intergenic
1099657802 12:85517253-85517275 CATTAGAATCACAGGGTAGTGGG - Intergenic
1101401486 12:104391716-104391738 CATTAAAAGCAGTGTGTAGAGGG - Intergenic
1101644595 12:106619055-106619077 CATTAAAACCAGAGCTCAGAAGG - Intronic
1101789031 12:107911524-107911546 CATTAGTCCCAGAGGGTGGAGGG + Intergenic
1104619725 12:130302003-130302025 CATTTTTCCCAGAGGGAAGAGGG - Intergenic
1105073010 12:133247913-133247935 CATTCAAAGCAGTGGGTAGAGGG + Intergenic
1106644222 13:31615587-31615609 CTTAATAACCAGAGGGGAGATGG + Intergenic
1108436489 13:50406106-50406128 CATTATCATCACATGGTAGAGGG - Intronic
1110514348 13:76392237-76392259 AAATATAAGCAGAGAGTAGAAGG + Intergenic
1110755945 13:79174057-79174079 CATTATACAAAGAGGGTAAAAGG + Intergenic
1111653343 13:91121467-91121489 CATTATAGACAAAGGCTAGAAGG - Intergenic
1114308891 14:21448116-21448138 CTTAATAACCAGAGGCTATACGG + Intronic
1115679894 14:35726076-35726098 CAAAATAACCAGAGGGGAGGAGG - Intronic
1115856392 14:37633735-37633757 CATTGACACCAGAGGGAAGAGGG - Intronic
1116305800 14:43254719-43254741 CATTCAAACCAGTGTGTAGAGGG + Intergenic
1116455954 14:45121148-45121170 CATTCTTAACAAAGGGTAGAGGG + Intronic
1116768431 14:49099558-49099580 CATTAAAAGCAGTGTGTAGAGGG + Intergenic
1117587016 14:57218955-57218977 CATTATAACAAGTGGGTACATGG + Intronic
1118839784 14:69501658-69501680 CATTAAAACAGAAGGGTAGAGGG - Intronic
1119599448 14:75965311-75965333 CACTAGGACCAGAGGCTAGATGG + Intronic
1119914787 14:78387778-78387800 CATTATCACCATAGGAAAGAAGG - Intronic
1120461994 14:84809029-84809051 CATTAGAACCAGAAGTCAGAAGG + Intergenic
1123127528 14:105959272-105959294 CATTCAAAGCAGAGTGTAGAGGG - Intergenic
1124176144 15:27425965-27425987 CATTGTAGCCAGATGGGAGAGGG - Intronic
1124563844 15:30797762-30797784 CATTATACACATCGGGTAGAGGG + Intergenic
1125637979 15:41205259-41205281 CATTGGAACAGGAGGGTAGAGGG + Intronic
1125925389 15:43558883-43558905 CAGTGTTTCCAGAGGGTAGATGG + Exonic
1126862981 15:52905026-52905048 CATTTAAAGCAGGGGGTAGAGGG + Intergenic
1127189282 15:56512676-56512698 CATTCAAAGCAGTGGGTAGAGGG - Intergenic
1127355622 15:58196383-58196405 CATTAAAAGCAGTGTGTAGAGGG + Intronic
1127685797 15:61342389-61342411 CATTTTAACCAGAGCAAAGAAGG - Intergenic
1127749490 15:62019440-62019462 CATTAAAAGCAGTGTGTAGAGGG - Intronic
1129542127 15:76359000-76359022 CTTTATAAAATGAGGGTAGATGG + Intronic
1129785139 15:78304760-78304782 CAGGATAACCAGTGGGCAGAGGG + Intergenic
1131887059 15:96927386-96927408 AATTATAACAAGAGGGTTTAGGG + Intergenic
1132065492 15:98727653-98727675 CATTATACCCAGGGGCTGGAGGG + Intronic
1134758306 16:16689468-16689490 CATTAAAAGCAGCGTGTAGAGGG + Intergenic
1135540905 16:23329783-23329805 CATTCTAACCAGGCGATAGAAGG + Intronic
1136992502 16:35162999-35163021 CATTCTAAGCAGTGTGTAGAGGG + Intergenic
1137356617 16:47772321-47772343 CATTTAAGGCAGAGGGTAGAGGG - Intergenic
1138756565 16:59493597-59493619 AATTGAAACCAGAGGGAAGAGGG - Intergenic
1140012592 16:71151158-71151180 CCATATAACCAAAGGGTAGAAGG - Intronic
1140883680 16:79223352-79223374 CATTTAAACCAGTGTGTAGAGGG + Intergenic
1141047598 16:80729941-80729963 CATTCAAAGCAGTGGGTAGAGGG + Intronic
1142466027 17:137890-137912 TATTATGACCAGAGGCTTGAAGG - Intronic
1142977625 17:3655313-3655335 CATGATCACCTGAGGGTAGAAGG - Exonic
1144182028 17:12761491-12761513 CATTGTAGCAAGAGGGAAGAAGG + Intronic
1144188288 17:12817318-12817340 CATAATAATCACAGGGTAAATGG - Intronic
1145016144 17:19399578-19399600 CATTTGAACCAGAGGGTCGGAGG + Intergenic
1149225247 17:54463046-54463068 CATTAAAAGCAGTGTGTAGAGGG - Intergenic
1150178202 17:63084981-63085003 CATTATAACCAGTTGATGGATGG + Intronic
1150368268 17:64611336-64611358 CATCATAACCATAGAGTAAATGG - Intronic
1154174575 18:12076871-12076893 AATTATAACCAGATGGTAGAAGG + Intergenic
1154932240 18:21011780-21011802 CATTATAAACAGAGAGTAATGGG - Intronic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1155675031 18:28419693-28419715 CATTCAAAGCAGAGTGTAGAGGG - Intergenic
1156902430 18:42316056-42316078 CACTAAAACCAGAGGGCAGAAGG - Intergenic
1157074010 18:44444992-44445014 CATTAAAAGCAGTGTGTAGAGGG + Intergenic
1158054048 18:53258363-53258385 CATTAAAAGCAGTGTGTAGAGGG - Intronic
1158057605 18:53300633-53300655 TATTGTAACCAGAGGCTTGAAGG + Intronic
1158168744 18:54572662-54572684 CATTCAAAGCAGTGGGTAGAGGG - Intergenic
1158888901 18:61855114-61855136 AATTATAACCAGTGGGAAGAAGG + Intronic
1160260387 18:77288498-77288520 CATTTTAAGCAGTGTGTAGAGGG - Intergenic
1160301171 18:77680470-77680492 CATTTAAAGCAGAGTGTAGAGGG - Intergenic
1161498614 19:4600784-4600806 CACTACAAGCAGAGGGGAGAAGG + Intergenic
1164091186 19:21953986-21954008 CATTTTAAGCAGTGTGTAGAGGG - Intronic
1164110377 19:22151358-22151380 CATTTAAAGCAGTGGGTAGAGGG + Intergenic
1164110990 19:22158675-22158697 CATTTAAAGCAGTGGGTAGAGGG - Intergenic
1165980345 19:39717093-39717115 CATTTAAATCAGTGGGTAGAGGG - Intergenic
1165980916 19:39722683-39722705 CATTTAAATCAGTGGGTAGAGGG + Intergenic
1166243650 19:41510664-41510686 CTTTATATCCCGAGGGGAGAAGG - Intergenic
1202698846 1_KI270712v1_random:147548-147570 CTTTATAACAAGAGGAGAGAAGG + Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
926734779 2:16064715-16064737 CATTATAACCAGAGGCTCTCAGG - Intergenic
927639222 2:24836280-24836302 CCGTAGAACAAGAGGGTAGATGG - Intronic
928462914 2:31492077-31492099 CATTTAAAGCAGAGTGTAGAGGG + Intergenic
929195650 2:39181679-39181701 CCTTATAAGAAGAGGGAAGATGG + Intronic
930437314 2:51361842-51361864 CATTTAAAGCAGTGGGTAGAGGG - Intergenic
930910941 2:56628898-56628920 AATTATAATCAGAGTGTAGTGGG + Intergenic
931887192 2:66630237-66630259 CATTAAAAGCAGTGTGTAGAGGG - Intergenic
934169794 2:89531024-89531046 CTTTATAACAAGAGGAGAGAAGG + Intergenic
934280096 2:91605332-91605354 CTTTATAACAAGAGGAGAGAAGG + Intergenic
935527590 2:104190161-104190183 TATTATAAGAAGAGGGTTGAAGG - Intergenic
936025360 2:109027528-109027550 TATCATAAACAGAGGGTGGATGG - Intergenic
938752188 2:134343315-134343337 CATTATAACCAGTGATTTGAAGG + Intronic
938988786 2:136606553-136606575 TAATAGAAACAGAGGGTAGAAGG - Intergenic
939092566 2:137796403-137796425 CATTAGAAACAGATGGTATAAGG + Intergenic
939363503 2:141204021-141204043 CATTTAAAGCAGAGTGTAGAGGG + Intronic
939473108 2:142650526-142650548 CATTATTTCCAGAGGTGAGAAGG + Intergenic
940824782 2:158398617-158398639 CATTTAAAGCAGTGGGTAGAGGG + Intronic
940828122 2:158436466-158436488 CATTAAAAGCAGTGTGTAGAGGG + Intronic
943065898 2:183085796-183085818 CATTGTAATCAGAAGGCAGAGGG + Intronic
943942060 2:194011022-194011044 CATTCAAAGCAGTGGGTAGAGGG - Intergenic
943978746 2:194518664-194518686 CATTCAAACCAGAGGGTACTTGG - Intergenic
946067258 2:216998639-216998661 CATTATAACCAGATGAAAGGGGG - Intergenic
1169071003 20:2730380-2730402 CCTTATAACAATAGGATAGAGGG - Intronic
1169585879 20:7084870-7084892 CACAATAACCAAAAGGTAGAAGG - Intergenic
1170671344 20:18436773-18436795 CATTATAATCAGACTGTTGAAGG + Intronic
1171912200 20:30973604-30973626 CATTCAAAGCAGTGGGTAGAGGG - Intergenic
1173477189 20:43368566-43368588 CATTCAAAGCAGAGTGTAGAGGG + Intergenic
1174316781 20:49709302-49709324 CATAAAGGCCAGAGGGTAGAGGG + Intronic
1176270641 20:64234249-64234271 CATTATCACCACAGCCTAGAGGG + Intronic
1177181699 21:17751229-17751251 CATTCAAAGCAGAGTGTAGAGGG - Intergenic
1180724283 22:17933461-17933483 CATTTAAAGCAGAGTGTAGAGGG + Intronic
1185292668 22:50035026-50035048 CATCATAACCACAGGGAATAAGG + Intronic
951150356 3:19281904-19281926 AATTATAACCAGAAGATACAAGG - Intronic
951269281 3:20604984-20605006 TATTATAACAGGAGGGCAGAGGG + Intergenic
951303257 3:21024706-21024728 CATTCTGACCAGAGGAGAGATGG - Intergenic
951769723 3:26242214-26242236 CATTCTAAGCAGTGTGTAGAGGG - Intergenic
951985992 3:28621575-28621597 CATTTAAAGCAGTGGGTAGAGGG + Intergenic
952924457 3:38310882-38310904 CATTATACCCAGATGAGAGATGG + Intronic
954259150 3:49426162-49426184 CAATATACCAAGAGGGAAGAGGG - Intronic
956472043 3:69577504-69577526 CATTTAAAGCAGTGGGTAGACGG - Intergenic
957215995 3:77320187-77320209 TTTTAAAACAAGAGGGTAGAGGG - Intronic
957815562 3:85292779-85292801 CATTAAAAGCAGTGTGTAGAGGG + Intronic
958267676 3:91458624-91458646 AATTATAAGCAGAGAGTACAAGG - Intergenic
958409986 3:93804539-93804561 CATTAAAAGCAGTGTGTAGAGGG - Intergenic
958546025 3:95551422-95551444 CATTTAAACCAGTGTGTAGATGG - Intergenic
958553812 3:95648038-95648060 CATTTAAACCAGTGTGTAGATGG + Intergenic
959532318 3:107447664-107447686 CCTAATAACCAGAAGGTAGGAGG + Intergenic
960025857 3:113008569-113008591 CATAATAACCACAGGGTAAATGG - Intronic
960339573 3:116458166-116458188 CATTCAAAGCAGTGGGTAGAGGG + Intronic
960863974 3:122181828-122181850 TATTATGACCAGTGGATAGAAGG - Intergenic
962691130 3:137899582-137899604 CATTTAAAGCAGTGGGTAGAGGG + Intergenic
962699487 3:137982817-137982839 CATTTAAAGCAGTGGGTAGAGGG + Intergenic
964214615 3:154265563-154265585 CATTTAAAGCAGTGGGTAGAAGG + Intergenic
964270291 3:154948137-154948159 CATTGAAACCAGTGTGTAGAGGG + Intergenic
964889837 3:161521156-161521178 CATAATATCCAGGGGGGAGAGGG - Intergenic
974141838 4:57897888-57897910 CATTCTAATCAGTGTGTAGAGGG - Intergenic
975803323 4:78086265-78086287 CATTAAAAGCAGTGTGTAGAGGG + Intronic
975806251 4:78115981-78116003 CATTAAAAGCAGTGTGTAGACGG - Intronic
977496451 4:97780921-97780943 CATTTAAAGCAGTGGGTAGAGGG + Intronic
977624339 4:99173877-99173899 CATTTAAACCAGTGTGTAGAGGG - Intergenic
978369914 4:108019766-108019788 GGTTTTAACCTGAGGGTAGAAGG + Intronic
981712243 4:147721036-147721058 CATGAAAACCAGAGGGTCCAAGG - Intergenic
982785416 4:159531191-159531213 CATTTAAAGCAGTGGGTAGAGGG - Intergenic
983004369 4:162465773-162465795 CATTCAAAGCAGAGTGTAGAGGG - Intergenic
983047194 4:163001866-163001888 CATTTAAAGCAGAGTGTAGAGGG - Intergenic
983636494 4:169902765-169902787 CATAATTTCCATAGGGTAGAAGG + Intergenic
984166185 4:176305386-176305408 CATTATAGCCAGAGAGAACAAGG - Intergenic
986581955 5:9274821-9274843 CATTTAAAGCAGTGGGTAGAGGG + Intronic
989664923 5:43842735-43842757 CATGATAACCAAAGGGAAGAGGG + Intergenic
989949729 5:50283066-50283088 CATTCAAACCAGTGTGTAGAGGG + Intergenic
990083176 5:51942036-51942058 CATTATAGCCAGAAGGCAGTAGG + Intergenic
990110169 5:52313567-52313589 CATTCAAAACAGAGTGTAGAGGG + Intergenic
990657127 5:57969766-57969788 CATTAAAAGCAGTGTGTAGAAGG - Intergenic
990663639 5:58047408-58047430 CAGTAACACCAGGGGGTAGAAGG - Intergenic
991403463 5:66278015-66278037 CACTATTCTCAGAGGGTAGAAGG + Intergenic
991461670 5:66865083-66865105 CATTAGAGCCACTGGGTAGATGG + Intronic
992935052 5:81694377-81694399 CATAATAATCACAGGGTAAATGG - Intronic
993142641 5:84053298-84053320 CATTCAAAGCAGTGGGTAGAGGG + Intronic
993822795 5:92641066-92641088 CATTAGAACCAGAGGTAAGCTGG + Intergenic
994280820 5:97900305-97900327 CATTAAAAGCAGTGTGTAGAGGG - Intergenic
994288109 5:97994295-97994317 CATTAAAAGCAGTGTGTAGAGGG + Intergenic
994290676 5:98025585-98025607 CATTAAAAGCAGTGTGTAGAGGG + Intergenic
994394655 5:99217867-99217889 CATAATATCCAGGGGGGAGAGGG - Intergenic
995046424 5:107653613-107653635 TATTTTAACTAGAGGGAAGAGGG + Intronic
995626069 5:114077560-114077582 CATTCTAATCAGGTGGTAGATGG + Intergenic
996776566 5:127138735-127138757 CATTATGACCAGTTGGTTGATGG - Intergenic
996988227 5:129594598-129594620 CATTATAATCAAATGGAAGAAGG - Intronic
997004332 5:129800850-129800872 CATTTAAAGCAGAGTGTAGAGGG - Intergenic
997682566 5:135766482-135766504 CATAATATCCAGGGGGGAGAGGG + Intergenic
997685554 5:135785698-135785720 CATAATATCCAGAGGGGAGAGGG + Intergenic
997687014 5:135795808-135795830 CATAATATCCAGGGGGGAGAGGG + Intergenic
998371236 5:141662991-141663013 TATTGTAACCAGAGGCTAGCAGG + Intronic
998537559 5:142948669-142948691 CATTAAAAACAGAGGTTAGAAGG + Intronic
1000250537 5:159490588-159490610 GATTATAAGCAGAGGCTAGGAGG - Intergenic
1000271409 5:159687241-159687263 CATTCAAAGCAGAGTGTAGAGGG - Intergenic
1000739991 5:164956798-164956820 CAGTAAAACCAGAGTTTAGATGG + Intergenic
1003899023 6:10636047-10636069 CAAAATAATCTGAGGGTAGATGG + Intergenic
1005100659 6:22169522-22169544 CATTAAAAGCAGTGTGTAGAGGG - Intergenic
1006052089 6:31353013-31353035 CATTATAACCAGAGTAAGGAAGG - Intronic
1007723236 6:43898500-43898522 CATTCCAGCCAGAGGGAAGAGGG - Intergenic
1007851125 6:44803755-44803777 CATCATAGCCAGAGGATAAAGGG + Intergenic
1008493427 6:52109078-52109100 CTTTATAGCCAGTTGGTAGATGG + Intergenic
1008987538 6:57562969-57562991 CATTATAAGCAGAGAGTACGAGG + Intronic
1009176138 6:60461570-60461592 CATTATAAGCAGAGAGTACAAGG + Intergenic
1009581245 6:65536552-65536574 CATTAAAACCAGAAGTTTGAAGG - Intronic
1011764560 6:90606188-90606210 CAGAATAACTTGAGGGTAGATGG - Intergenic
1012504445 6:99928989-99929011 CATTCAAAGCAGAGTGTAGAGGG - Intronic
1015296216 6:131596424-131596446 CATTAGAACCAGAGAGAAAACGG + Intronic
1015667884 6:135651724-135651746 CATTATAACCAGTTGATTGATGG - Intergenic
1016158723 6:140848470-140848492 TATTGTAACCAGAGGCTTGAGGG - Intergenic
1017237847 6:152135914-152135936 CATTGTGACCAGAGTGTAGTCGG - Intronic
1017999728 6:159568498-159568520 TACTATAACCAGAAGGGAGAAGG + Intergenic
1020562622 7:9748868-9748890 CATTATATCCAGATGATTGATGG + Intergenic
1020957461 7:14759422-14759444 AATGATAGCCAGAGGTTAGAGGG - Intronic
1021319747 7:19195088-19195110 CATTAAAAGCAGTGTGTAGAGGG - Intergenic
1022456508 7:30563036-30563058 CATTCTAACCAGAGTCAAGAGGG - Intergenic
1023084420 7:36556135-36556157 CATTAAAAGCAGTGTGTAGAGGG - Intronic
1024666797 7:51555283-51555305 CATTTAAAACAGAGTGTAGAGGG - Intergenic
1025919259 7:65895220-65895242 CATTATAAGCACAAGTTAGATGG + Intronic
1025952420 7:66155909-66155931 CATAATAATCACAGGGTAAAGGG - Intergenic
1027160602 7:75799628-75799650 CATTGTAACCCGAGGCTAGGAGG - Intergenic
1028159331 7:87467885-87467907 CATTTAAAGCAGTGGGTAGAGGG + Intronic
1029006262 7:97213190-97213212 CATTTAAAGCAGTGGGTAGAGGG - Intergenic
1030489927 7:110219486-110219508 CATTATAACCAGAGGAACTACGG - Intergenic
1031527330 7:122837268-122837290 CATTTAAAGCAGTGGGTAGAGGG + Intronic
1033772564 7:144568617-144568639 AATTATAATCAGAGGGCTGATGG - Intronic
1034583082 7:152063613-152063635 CATTTAAAGCAGTGGGTAGAGGG - Intronic
1036515977 8:9444462-9444484 CATTTAAACCAGTGTGTAGAGGG - Intergenic
1036955545 8:13184450-13184472 CATTTAAAGCAGAGTGTAGAGGG - Intronic
1037352517 8:17976429-17976451 CATTAGAACCTGAGAGGAGATGG + Intronic
1038287691 8:26220313-26220335 GATTATTATCTGAGGGTAGAGGG - Intergenic
1040749649 8:50690399-50690421 CATTCAAACCAGTGTGTAGAGGG - Intronic
1041441826 8:57905181-57905203 CATCATAACCAAGGGGAAGAAGG + Intergenic
1042292422 8:67183283-67183305 CATTATATCCAGTTGGTTGATGG - Intronic
1043048508 8:75356991-75357013 CATTTTAAGCAGCGTGTAGAGGG - Intergenic
1043484612 8:80686976-80686998 ATTTATAACCAGAGGATGGATGG + Intronic
1046137916 8:110054489-110054511 CATTGTAACCAGAGGGTATGAGG - Intergenic
1048252322 8:132877001-132877023 CATTGTAACCAGAATGTGGAAGG + Intronic
1049411294 8:142475138-142475160 GATGGTAAGCAGAGGGTAGAGGG - Intronic
1050373877 9:4950861-4950883 CATTCAAAGCAGAGTGTAGAGGG - Intergenic
1051298910 9:15627469-15627491 CATTCAAACCAGCGTGTAGAGGG - Intronic
1055173772 9:73292490-73292512 TGTTATAACCAGAGGCAAGAGGG + Intergenic
1056898855 9:90579930-90579952 TTTTAAAGCCAGAGGGTAGAGGG + Intergenic
1058096707 9:100869792-100869814 CATTTAAAGCAGAGTGTAGAGGG + Intergenic
1058519338 9:105803293-105803315 CCTAATATCCAGAGGGGAGAAGG - Intergenic
1058998369 9:110322281-110322303 CATTATAATCAGAGGCTTGTTGG + Intronic
1059435363 9:114272812-114272834 CAGCATAACCCGAGGGTTGAGGG + Intronic
1060659516 9:125396050-125396072 GATAAGAACCAGAGTGTAGATGG - Intergenic
1061428027 9:130513067-130513089 CCTTATAGCCAGGGGGTAGGAGG - Intergenic
1185954728 X:4477240-4477262 CATTATAATCACAGGTTTGAAGG + Intergenic
1185954931 X:4478783-4478805 CATTATAATCACAGGTTTGAAGG - Intergenic
1187255610 X:17639184-17639206 CATTATAGCCAGAGCCTTGAGGG + Intronic
1187949306 X:24456229-24456251 CATTATAATAAGAGGGAAAAAGG - Intergenic
1189770756 X:44424477-44424499 CATTTAAAGCAGAGTGTAGAGGG - Intergenic
1192910540 X:75599652-75599674 CATTTAAACCAGTGTGTAGAGGG - Intergenic
1193123157 X:77844598-77844620 CATTTAAACCAGTGTGTAGAGGG - Intronic
1193338865 X:80322419-80322441 CATTTTAAGCAGTGGGTAGAGGG + Intergenic
1193387700 X:80890762-80890784 CATTCAAAGCAGTGGGTAGAGGG - Intergenic
1193651778 X:84144381-84144403 CATTTTACCAAGAGGATAGATGG + Intronic
1193766255 X:85532056-85532078 CATTCAAAGCAGTGGGTAGAGGG + Intergenic
1194628774 X:96257358-96257380 CATTCAAAGCAGTGGGTAGAGGG - Intergenic
1194922552 X:99784468-99784490 TATTTTATTCAGAGGGTAGAGGG + Intergenic
1195284849 X:103374705-103374727 CATTCGCACCAAAGGGTAGATGG + Intergenic
1197957117 X:131963436-131963458 CATTAAAAGCAGTGTGTAGAGGG + Intergenic
1198702235 X:139409693-139409715 CCTTAAAAACTGAGGGTAGAAGG - Intergenic
1199973296 X:152876330-152876352 CATTATTCCAAGAGAGTAGAAGG - Intergenic
1200871111 Y:8099611-8099633 CATTCAAAGCAGTGGGTAGAGGG - Intergenic
1201780103 Y:17711332-17711354 CATTCAAAGCAGAGTGTAGAGGG + Intergenic
1201821452 Y:18194660-18194682 CATTCAAAGCAGAGTGTAGAGGG - Intergenic
1201942042 Y:19470675-19470697 CATTTAAATCAGTGGGTAGAGGG - Intergenic
1201976314 Y:19852952-19852974 CATTCAAAGCAGAGTGTAGAGGG + Intergenic