ID: 922791497

View in Genome Browser
Species Human (GRCh38)
Location 1:228313708-228313730
Sequence GCCGGAGGCCCGCTGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 201}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922791487_922791497 11 Left 922791487 1:228313674-228313696 CCACGTTCTCCTGTGAGGTGTCT 0: 1
1: 0
2: 0
3: 12
4: 128
Right 922791497 1:228313708-228313730 GCCGGAGGCCCGCTGGTGGCTGG 0: 1
1: 0
2: 0
3: 18
4: 201
922791490_922791497 2 Left 922791490 1:228313683-228313705 CCTGTGAGGTGTCTCACGCGGGT 0: 1
1: 0
2: 1
3: 32
4: 679
Right 922791497 1:228313708-228313730 GCCGGAGGCCCGCTGGTGGCTGG 0: 1
1: 0
2: 0
3: 18
4: 201

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922791497 Original CRISPR GCCGGAGGCCCGCTGGTGGC TGG Intronic
900171919 1:1273525-1273547 GCCGGGGCCCCGCGGGCGGCGGG + Intronic
900486260 1:2924214-2924236 GCCCGAAGCCAGCTGGTGGGAGG - Intergenic
900600618 1:3501282-3501304 TCCCGAGGGCCGCTGGGGGCTGG - Exonic
900638573 1:3677292-3677314 GCCGGAGGGCCCTCGGTGGCTGG + Intronic
902194536 1:14788628-14788650 GACGGAGGCCCTTTGGTGCCTGG - Intronic
904086852 1:27915401-27915423 GCAGGAGGACCGCTTGAGGCTGG + Intergenic
905172040 1:36115202-36115224 GCCTGAGGCCTGGGGGTGGCTGG - Intronic
905416702 1:37808710-37808732 GCCCGGAGCCGGCTGGTGGCGGG + Exonic
906917171 1:50023923-50023945 GCGGCAGGCGCGCGGGTGGCCGG + Intergenic
910849279 1:91635222-91635244 GCCTAAGGCCCACAGGTGGCTGG - Intergenic
915339292 1:155167505-155167527 GCATGATGCCCTCTGGTGGCCGG + Intergenic
917318814 1:173758175-173758197 GCAGGAGGCCCGCTTGAGCCTGG + Intronic
920246240 1:204589674-204589696 GCAGGAGGCCAGCAGATGGCTGG + Intergenic
921462398 1:215444720-215444742 GTGGGAGGCCTGCTGGTGACTGG + Intergenic
922791497 1:228313708-228313730 GCCGGAGGCCCGCTGGTGGCTGG + Intronic
924527211 1:244863526-244863548 GCCGGAGCCCCGCAGGGGGAGGG - Intronic
1062856710 10:783476-783498 GCCGGAGGAGCGCTGGCCGCTGG - Intergenic
1063231138 10:4066832-4066854 GCCCCAGGGCCGCTGGTGGTAGG - Intergenic
1063674837 10:8131674-8131696 GCCGAAGGCCAGGTGGTGGCTGG - Intergenic
1069943457 10:71970567-71970589 GCTGCAGGGACGCTGGTGGCTGG + Intronic
1070800750 10:79243267-79243289 GCCGGGGGCGCGCGGGGGGCGGG - Intronic
1073121237 10:101123556-101123578 GCGGGTGGCGCGCGGGTGGCAGG + Intronic
1074314629 10:112350017-112350039 CGCGGAAGCCCACTGGTGGCGGG - Intergenic
1076829906 10:132988983-132989005 GCCTGAGGCCCGGTGGGGGGGGG + Intergenic
1076854528 10:133109323-133109345 CCTGGAGGCCCGCTGGGGTCAGG - Intronic
1077061725 11:620488-620510 GGCCCAGTCCCGCTGGTGGCCGG + Intronic
1077394859 11:2315812-2315834 GCAGGAAGCCAGCTGGTGGAGGG - Intronic
1078090778 11:8263198-8263220 GCGGGCGGCGCGCTGGGGGCCGG - Intronic
1078510284 11:11979725-11979747 GAGGGAGGCAGGCTGGTGGCTGG - Intronic
1081666491 11:44919900-44919922 GCCGGAGGCCTGCTGCCGGAGGG + Exonic
1081709157 11:45205937-45205959 GCAGGGGGCCCGCTGGTCTCTGG - Intronic
1081977605 11:47245613-47245635 GCCGTAGGCCTGCTGATGCCAGG - Intronic
1084015874 11:66381222-66381244 GCCGGGCGCCTGGTGGTGGCGGG - Intergenic
1084526347 11:69700786-69700808 GCCGGCGCCCAGCTGGTGGCCGG + Intronic
1085516895 11:77116726-77116748 GCCAGAGGGCCCCTGGAGGCAGG - Intronic
1085522539 11:77146849-77146871 GCTGGAGACCCTCTGGGGGCGGG + Intronic
1085705956 11:78786980-78787002 GTGGCAGGCCCGCTGGTCGCAGG + Exonic
1089454225 11:118616472-118616494 GCCCCAGGCCCTCTGATGGCGGG - Intronic
1091545694 12:1500190-1500212 GCGGGAGGCGTGGTGGTGGCCGG - Intergenic
1091582820 12:1799307-1799329 CCCGGAGTCCCGCTGAGGGCTGG + Intronic
1092406847 12:8227496-8227518 GCCCGAGGCCAGCTGGCTGCAGG + Exonic
1096627507 12:52904560-52904582 GCAGGACGCCAGCTGGGGGCTGG + Intronic
1102008946 12:109606403-109606425 GCAGCAGGCCTGCGGGTGGCGGG + Intergenic
1102563418 12:113778954-113778976 GCCGGAGCCCCCATGGGGGCAGG - Intergenic
1108541704 13:51452358-51452380 CCCGGCGGCCCGCGGGCGGCAGG - Intronic
1115320916 14:32077706-32077728 GGCGGAGGCCTGATGCTGGCCGG + Intronic
1115399217 14:32939053-32939075 GCCGGAGCCTCGCGGGCGGCCGG - Intronic
1119003903 14:70907521-70907543 GCTGGCGGGCCGCGGGTGGCGGG + Exonic
1119717478 14:76869019-76869041 GTGGGAGGCCCGGTGGTAGCAGG - Intronic
1121514900 14:94543067-94543089 GCAGGAGGCCAGCTGGTGAATGG - Intergenic
1122826825 14:104374624-104374646 GCCGGAGGGGCCCTGCTGGCTGG + Intergenic
1123122986 14:105926717-105926739 TCGGGAGGCCCCATGGTGGCAGG - Intronic
1128128014 15:65207120-65207142 GCCTGAGGCCAGCTGGGGGTGGG - Intronic
1128263939 15:66252283-66252305 GCCGGAGGGGCGCTGGTGCCGGG + Intronic
1128830446 15:70763523-70763545 GCCCGGGGCCCGCAGGTGGCAGG - Exonic
1129757685 15:78108508-78108530 GCCCGCCGCCCTCTGGTGGCTGG + Intronic
1129776630 15:78241211-78241233 GCCGGAGGCCTTCTGGGGGCAGG - Intronic
1131188245 15:90293461-90293483 GCATGAGGGCAGCTGGTGGCTGG - Intronic
1131282583 15:91033334-91033356 GCATGAGGGCAGCTGGTGGCTGG + Intergenic
1131506934 15:93027676-93027698 GCCGGAAGACCGCTGGTGCTGGG - Exonic
1132251351 15:100337713-100337735 GCTGGAGGCCCCCTGCTGTCGGG - Intronic
1132657346 16:1046805-1046827 GCCGGCGGGCAGCGGGTGGCGGG + Intergenic
1132831803 16:1932149-1932171 GCTGGAGGCCTGCTGGCGCCTGG - Intergenic
1133347517 16:5080706-5080728 GCCCGAGGCCAGCTGGCTGCAGG + Intronic
1134081143 16:11325954-11325976 GCCTGCGGCCAGCTGGGGGCCGG - Intronic
1135325372 16:21522192-21522214 GGCGGAGCCTCCCTGGTGGCCGG - Intergenic
1136336859 16:29615460-29615482 GGCGGAGCCTCCCTGGTGGCCGG - Intergenic
1136366649 16:29812121-29812143 GCCGGAGGCTCGCGAGGGGCGGG + Intronic
1136535750 16:30898274-30898296 GCCTCAGGCCCCCTGGTAGCTGG + Intronic
1136778866 16:32885188-32885210 GCCGGCGGCCTGCTGGGGGAGGG + Intergenic
1136891752 16:33976330-33976352 GCCGGCGGCCTGCTGGGGGAGGG - Intergenic
1138104055 16:54277577-54277599 GCCTGAGGCCCGCAGGAGCCTGG - Intergenic
1139550224 16:67668664-67668686 GGCCTAGGCCCTCTGGTGGCGGG + Exonic
1140078632 16:71723949-71723971 GCCGGCGGGCCGCGGGGGGCGGG - Intronic
1140228278 16:73096255-73096277 GCTGGAGACCGGGTGGTGGCTGG + Intergenic
1141521070 16:84580040-84580062 TCCGGAGGCCAGCTGCTGGCAGG + Intronic
1142038378 16:87876792-87876814 GGCGGAGCCTCCCTGGTGGCCGG - Intergenic
1203081280 16_KI270728v1_random:1147277-1147299 GCCGGCGGCCTGCTGGGGGAGGG + Intergenic
1144778477 17:17796427-17796449 GGCGGAGGCCCTCTGAGGGCCGG + Exonic
1146264056 17:31439384-31439406 GCCGGAGACCAGCAGGTGGATGG - Intronic
1146703908 17:34985847-34985869 GCCCAAGGCTGGCTGGTGGCTGG - Intronic
1148456394 17:47813762-47813784 GCCCCAGGCCCGCTGGCCGCCGG + Exonic
1149344263 17:55718317-55718339 GCATGGGGCCCCCTGGTGGCCGG + Intergenic
1149491051 17:57085432-57085454 GCCGGAGACCCGAAGGCGGCGGG + Intronic
1149546552 17:57508184-57508206 GCCTGTGGCCCGCTATTGGCTGG + Intronic
1151766910 17:76137531-76137553 ACCGAAGGCCCCCAGGTGGCAGG + Exonic
1151956794 17:77384141-77384163 GCGGGAGGCTGGCTGGGGGCTGG + Intronic
1152744144 17:82031480-82031502 GCCGGGGTCGCGCTGGAGGCGGG + Intergenic
1152946511 17:83200598-83200620 GCCTGAGGCCCAGCGGTGGCTGG + Intergenic
1154302066 18:13203073-13203095 GGAGGAGGCTCGCTGGTGCCAGG - Intergenic
1154395337 18:13982316-13982338 GCCTGAGACCCTCTGGTGGTGGG + Intergenic
1160622213 18:80179432-80179454 GCCAGTGGCCCGCTGAGGGCAGG - Intronic
1160673761 19:377830-377852 GCCGGCCCCACGCTGGTGGCAGG - Intergenic
1160682801 19:419537-419559 TCCCGGCGCCCGCTGGTGGCCGG - Intronic
1160777601 19:863098-863120 TCCGGGGGCCCGCTGGTGTGCGG + Exonic
1160790679 19:921860-921882 GCCGCAGTCCCGCAGGTGCCCGG + Intergenic
1160864530 19:1250997-1251019 CCCGGAGGCCCGCGGGGGGAGGG - Intronic
1161231936 19:3178827-3178849 GCCGGCCGCCAGCTGTTGGCAGG - Exonic
1161357816 19:3828834-3828856 GCCGGTGGCCTGCAGGTGACGGG - Intronic
1161777464 19:6271433-6271455 GCCTGCGGCCCCCTGGTGACCGG + Intronic
1161854409 19:6755034-6755056 GCCAGAGGCCCCATGGTGGGAGG - Exonic
1162416991 19:10544156-10544178 GCCCGAGGCCCGCAGGCCGCGGG + Exonic
1162500322 19:11049757-11049779 GTCGCAGGCAGGCTGGTGGCTGG - Intronic
1162723227 19:12674676-12674698 GATGGAGCCCAGCTGGTGGCAGG + Intronic
1162818773 19:13210577-13210599 GCCGGAGCCCTGCTGGGCGCTGG + Intronic
1163368225 19:16888062-16888084 GAGGGAGGCCCCCTGGAGGCTGG + Intergenic
1166203321 19:41252770-41252792 GCTGGAGGCTGGCTGGTGGGGGG + Intronic
1166895912 19:46021891-46021913 GACAGAGGCCTGCAGGTGGCAGG - Intronic
1167084552 19:47300291-47300313 GCCGCTGGCAAGCTGGTGGCTGG + Intronic
1168173751 19:54608152-54608174 GCCCGTGGCCCTCTGGTGTCAGG + Intronic
1168636722 19:58002614-58002636 GCCGGAGGCAGGCTGCTGGCTGG + Exonic
925928071 2:8685013-8685035 TCCGGAGGCCCGGAGGTGGGTGG - Intergenic
926035280 2:9631082-9631104 GCCAGCGGCGCGCTGGGGGCGGG - Intergenic
926335752 2:11861463-11861485 GGCAGAGCCCCGCTGGAGGCAGG + Intergenic
928540579 2:32280027-32280049 GCTGGAGACCGTCTGGTGGCTGG + Intronic
937906579 2:127055567-127055589 GCTGGCCGCCCGCTGGTGGGAGG - Intronic
938293432 2:130162324-130162346 GCAGGAGGCATGCTGCTGGCGGG - Intronic
938370929 2:130767995-130768017 GCTGGAGGGCCACTTGTGGCTGG - Exonic
938463122 2:131510637-131510659 GCAGGAGGCATGCTGCTGGCGGG + Intergenic
944563383 2:200963640-200963662 ACCGGAGGCCAGCTGGGGGATGG + Exonic
946339605 2:219059140-219059162 GCCGAAGGTTGGCTGGTGGCCGG - Intronic
946345820 2:219109625-219109647 GCTGGAGGCGGGCTGGTGTCTGG + Intronic
946420174 2:219560549-219560571 GCCTCTGGCCCCCTGGTGGCTGG + Intronic
947636112 2:231681374-231681396 GGCACAGGCCCGCTTGTGGCTGG + Intergenic
948806605 2:240455903-240455925 CCCTGAGGCCCGCTGCAGGCTGG - Intronic
948824186 2:240566517-240566539 GCCTGACGCCCCCTGGCGGCGGG - Intronic
948958688 2:241315450-241315472 GCGGGAGGGCAGGTGGTGGCGGG - Intronic
1169068916 20:2709792-2709814 GCTGGAGGCTCCCTGGTGCCTGG - Intronic
1171032719 20:21691696-21691718 GCAGGAGTGCAGCTGGTGGCTGG + Intergenic
1171175536 20:23048969-23048991 GCCAGTGGCCTGCAGGTGGCTGG + Exonic
1173221705 20:41137329-41137351 GACGGAGGCGCGATGGCGGCGGG - Intronic
1174178824 20:48662207-48662229 GCCAGCGGCCCCCTGGTGCCTGG - Intronic
1178891456 21:36524212-36524234 GCAGGAGGCTCGCTGGAGCCCGG - Intronic
1179875906 21:44267319-44267341 GCCGATGGCCCGCTGGGGGCTGG + Intergenic
1179984041 21:44911498-44911520 GCTGGATGCCCGCGGGTGCCAGG + Intronic
1181786849 22:25233447-25233469 ACCGGAGGCCCGGGGGTGGAGGG - Intergenic
1183383343 22:37501464-37501486 GCCGGGGGCCAGGTGGGGGCAGG + Intronic
1183410233 22:37650646-37650668 GCCGGAGCCGGGGTGGTGGCTGG - Exonic
1183683759 22:39350193-39350215 GCCGGGGGCCCGTTGGGGTCGGG - Intronic
1183731144 22:39619255-39619277 GCTGGAGGCCAGCTGGGGCCAGG - Intronic
1183883391 22:40856397-40856419 GCCTGAGGACCGTTGGGGGCGGG - Intronic
950263319 3:11557533-11557555 GCGGGAGGCCAGCTCCTGGCAGG - Exonic
950529563 3:13545439-13545461 GCCCGAGGGCAGCTGCTGGCAGG - Intergenic
952646042 3:35660308-35660330 GCAAGAGGTCCTCTGGTGGCTGG - Intronic
953561165 3:43995045-43995067 GCCTGAGGGCCGCTGCCGGCAGG - Intergenic
953719390 3:45342049-45342071 GCTGGTGGCACACTGGTGGCTGG + Intergenic
953953101 3:47207918-47207940 GCCTGAGCCCTGCTGGTAGCTGG + Intergenic
954004104 3:47578524-47578546 GCAGGGGTCCCGCTGGCGGCGGG - Intronic
954256633 3:49411936-49411958 GACGGAGGACCGCGGGCGGCGGG + Exonic
954327186 3:49869942-49869964 GCCGGGGGCGGGCTGGGGGCGGG + Exonic
954554681 3:51508615-51508637 GCTGGGGACACGCTGGTGGCTGG - Intergenic
957051905 3:75417931-75417953 GCCCGAGGCCAGCTGGTTGCAGG + Intergenic
957350632 3:79018929-79018951 GCGGGTGGCCCGCTGCTGACTGG - Intronic
961654365 3:128433159-128433181 GCAGATGGCCCGCTGGCGGCCGG + Intergenic
961885518 3:130094163-130094185 GCCCGAGGCCAGCTGGTTGCAGG + Intronic
962808880 3:138945722-138945744 GCCGGGGGCGCGGCGGTGGCTGG + Exonic
968505651 4:970178-970200 GCCGGATGCCCGCCAGTGGCAGG + Intronic
968994706 4:3938306-3938328 GCCCGAGGCCAGCTGGCTGCAGG + Intergenic
969819254 4:9707967-9707989 GCCCGAGGCCAGCTGGCTGCAGG - Intergenic
984584147 4:181543616-181543638 GCAGTAGGCCAGCAGGTGGCTGG - Intergenic
985573224 5:661893-661915 GCCTGAGGGCCGCTGGGGGAGGG + Exonic
985904546 5:2823208-2823230 GCCAGGGGCCTGCTGGGGGCAGG + Intergenic
986787950 5:11132276-11132298 GCCGGATACCCGCAGGTGGTAGG - Intronic
998156286 5:139788711-139788733 GCCGGCGGCCGGCTGCCGGCTGG + Intergenic
1001381113 5:171307351-171307373 GCAGGAGGCCCCCTGGAGCCAGG + Exonic
1002526143 5:179817079-179817101 GCCGGAGCCGCGCCGGGGGCCGG + Intronic
1003942564 6:11044004-11044026 GCCCGAGGCCCGCGGGTCTCGGG - Intronic
1006083528 6:31580994-31581016 GCCGGGCGCCCCCTGGCGGCGGG - Exonic
1006632009 6:35436575-35436597 GCCCCAGGCCTGCTGGTGGGAGG - Intergenic
1006933478 6:37701389-37701411 GCCGGAGGCGAGCTAGTGGCAGG - Intergenic
1007257845 6:40541157-40541179 GCCTGGGACCCGCTGATGGCTGG - Intronic
1007376960 6:41463479-41463501 GCCTGAGGCCCCCTGCTGGGCGG - Intergenic
1015786583 6:136924547-136924569 CGAGGAGTCCCGCTGGTGGCTGG + Exonic
1017732040 6:157325137-157325159 TCTGAAGGCCCGCGGGTGGCAGG + Intergenic
1019410480 7:904578-904600 GCTGGAGGTGGGCTGGTGGCTGG - Intronic
1022400184 7:30028820-30028842 GCCGGGGGCGCGCCGGGGGCCGG + Intronic
1026691334 7:72552593-72552615 GCAGGAGGACCGCTTGAGGCAGG + Intergenic
1026892784 7:73992175-73992197 GCAGAGGGCCCGCTGGAGGCTGG + Intergenic
1029712046 7:102304971-102304993 GCCTGAGGCCCCCTTGGGGCTGG - Intronic
1031966597 7:128031796-128031818 GCCGGCGGCGCGCCGGGGGCCGG - Intronic
1032095913 7:128938432-128938454 CCGGGAGCCCCGCTGGAGGCTGG + Intronic
1034221614 7:149450864-149450886 GAAGGAGGCCCGCAGGTGCCAGG - Intronic
1035552990 8:544594-544616 GCCGGGGGCGCGCAGGTGGAGGG - Intronic
1036381437 8:8238518-8238540 GCCCGAGGCCAGCTGGCTGCAGG - Intergenic
1036847224 8:12178474-12178496 GCCCGAGGCCAGCTGGCTGCAGG + Intergenic
1036868591 8:12420795-12420817 GCCCGAGGCCAGCTGGCTGCAGG + Intergenic
1037752681 8:21692895-21692917 GCCTGAGGCTGGCTGGGGGCAGG - Exonic
1037884498 8:22589189-22589211 GCCGGGGGCCCCCTGGTGTCGGG + Intronic
1039886400 8:41656537-41656559 GCTGGAGGCCCCATGGGGGCAGG - Intronic
1039903020 8:41766836-41766858 CCCGGAGGCCCCCAGGTAGCAGG - Intronic
1040481465 8:47831472-47831494 GCGGGAGGGCAGCTGGGGGCTGG - Intronic
1042591501 8:70402786-70402808 GCAGGAGGCGCGCTGGGGCCGGG - Intronic
1047277367 8:123416464-123416486 GGCGGAGCCCGGCTGGTGGGTGG - Intergenic
1049069762 8:140347271-140347293 GCCTGAGGCAGGCAGGTGGCTGG - Intronic
1049237518 8:141519461-141519483 GCTGTGGGCCCGCTGGTGGCAGG + Intergenic
1049598345 8:143494816-143494838 GCCGTTTGCCCGTTGGTGGCCGG - Intronic
1049646407 8:143737832-143737854 GCTGGAGGACCGGTGGCGGCAGG - Intergenic
1050405399 9:5304013-5304035 CCCGGAGACCCGCAGGAGGCCGG - Intronic
1050408701 9:5339179-5339201 CCCGGAGACCCGCAGGAGGCCGG - Intronic
1054745961 9:68853958-68853980 GCTGGAGGCCGGCTTGTGCCAGG + Intronic
1055569457 9:77601767-77601789 GACGGAAGCCCACTGGTGCCGGG + Intronic
1057146959 9:92764887-92764909 GCGCGGGGCCCGCTGGGGGCTGG + Intergenic
1057495443 9:95556735-95556757 GCTGGAGGGCTGCTGGTGGGAGG + Intergenic
1057716851 9:97502153-97502175 GCTGGAGTCCTGCGGGTGGCGGG - Intronic
1058956248 9:109951515-109951537 GCCTGAAGTCCGCTAGTGGCAGG - Intronic
1059191818 9:112333771-112333793 GCCGGAGGCCGGCTGCCAGCGGG - Intergenic
1059334359 9:113559441-113559463 CCCAGAGGCCTGCTGCTGGCTGG - Intronic
1060348527 9:122837643-122837665 GAGAGAGGCCAGCTGGTGGCGGG + Intergenic
1060602432 9:124887089-124887111 GCCAGAGGACCGCAGGTGTCGGG + Intronic
1060826807 9:126692343-126692365 GCGGGAGGCCCAGTGGTGGCTGG + Intronic
1060934429 9:127507069-127507091 GCAGGGGGCCGGCTGGTGGGGGG + Exonic
1061091613 9:128429539-128429561 GCCATAGGACCCCTGGTGGCTGG - Intronic
1061587388 9:131577809-131577831 GCGGGACCCCCTCTGGTGGCGGG - Exonic
1061954216 9:133953256-133953278 TCCGGTGGCCAGCTGGTGGCAGG + Intronic
1062036882 9:134386365-134386387 GGCGGGGGACCGCAGGTGGCTGG + Intronic
1062516705 9:136940562-136940584 GACGGTGGCCCAGTGGTGGCAGG - Exonic
1186296221 X:8151385-8151407 GCAAGAGGTCAGCTGGTGGCTGG + Intergenic
1192510802 X:71719448-71719470 GCCGGTGGCACGATGGTGGCTGG - Intergenic
1192515895 X:71762105-71762127 GCCGGTGGCACGATGGTGGCTGG + Intergenic
1200123778 X:153803831-153803853 GCCGGTGGCCCTCGGGTGGGCGG - Exonic