ID: 922791526

View in Genome Browser
Species Human (GRCh38)
Location 1:228313827-228313849
Sequence TGCGCGGAAGATGACAGTGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 64}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922791526_922791536 15 Left 922791526 1:228313827-228313849 CCGGCACTGTCATCTTCCGCGCA 0: 1
1: 0
2: 0
3: 3
4: 64
Right 922791536 1:228313865-228313887 ACGGCCAAGTTGTTGATCAAAGG 0: 1
1: 0
2: 0
3: 1
4: 79
922791526_922791540 29 Left 922791526 1:228313827-228313849 CCGGCACTGTCATCTTCCGCGCA 0: 1
1: 0
2: 0
3: 3
4: 64
Right 922791540 1:228313879-228313901 GATCAAAGGTATTGGCCGATGGG 0: 1
1: 0
2: 0
3: 0
4: 40
922791526_922791538 21 Left 922791526 1:228313827-228313849 CCGGCACTGTCATCTTCCGCGCA 0: 1
1: 0
2: 0
3: 3
4: 64
Right 922791538 1:228313871-228313893 AAGTTGTTGATCAAAGGTATTGG 0: 1
1: 0
2: 0
3: 7
4: 147
922791526_922791539 28 Left 922791526 1:228313827-228313849 CCGGCACTGTCATCTTCCGCGCA 0: 1
1: 0
2: 0
3: 3
4: 64
Right 922791539 1:228313878-228313900 TGATCAAAGGTATTGGCCGATGG 0: 1
1: 0
2: 0
3: 4
4: 50
922791526_922791531 -4 Left 922791526 1:228313827-228313849 CCGGCACTGTCATCTTCCGCGCA 0: 1
1: 0
2: 0
3: 3
4: 64
Right 922791531 1:228313846-228313868 CGCAGGGCCCCTGGTCTCCACGG 0: 1
1: 0
2: 0
3: 25
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922791526 Original CRISPR TGCGCGGAAGATGACAGTGC CGG (reversed) Intronic