ID: 922791842

View in Genome Browser
Species Human (GRCh38)
Location 1:228315183-228315205
Sequence CACAGGTGGCTCGGACAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
922791837_922791842 -8 Left 922791837 1:228315168-228315190 CCGGTGGCGCTGGGACACAGGTG 0: 1
1: 0
2: 1
3: 47
4: 350
Right 922791842 1:228315183-228315205 CACAGGTGGCTCGGACAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
922791842 Original CRISPR CACAGGTGGCTCGGACAGGT GGG Intronic
No off target data available for this crispr